FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1972772092> ?p ?o ?g. }

• W1972772092 endingPage "19750" @default.
• W1972772092 startingPage "19743" @default.
• W1972772092 abstract "Polydnaviruses are essential for the survival of many Ichneumonoid endoparasitoids, providing active immune suppression of the host in which parasitoid larvae develop. The Cotesia rubecula bracovirus is unique among polydnaviruses in that only four major genes are detected in parasitized host (Pieris rapae) tissues, and gene expression is transient. Here we describe a novel C. rubecula bracovirus gene (CrV3) encoding a lectin monomer composed of 159 amino acids, which has conserved residues consistent with invertebrate and mammalian C-type lectins. Bacterially expressed CrV3 agglutinated sheep red blood cells in a divalent ion-dependent but Ca2+-independent manner. Agglutination was inhibited by EDTA but not by biological concentrations of any saccharides tested. Two monomers of ∼14 and ∼17 kDa in size were identified on SDS-PAGE in parasitized P. rapae larvae. The 17-kDa monomer was found to be an N-glyscosylated form of the 14-kDa monomer. CrV3 is produced in infected hemocytes and fat body cells and subsequently secreted into hemolymph. We propose that CrV3 is a novel lectin, the first characterized from an invertebrate virus. CrV3 shows over 60% homology with hypothetical proteins isolated from polydnaviruses in two other Cotesia wasps, indicating that these proteins may also be C-type lectins and that a novel polydnavirus lectin family exists in Cotesia-associated bracoviruses. CrV3 is probably interacting with components in host hemolymph, resulting in suppression of the Pieris immune response. The high similarity of CrV3 with invertebrate lectins, as opposed to those from viruses, may indicate that some bracovirus functions were acquired from their hosts. Polydnaviruses are essential for the survival of many Ichneumonoid endoparasitoids, providing active immune suppression of the host in which parasitoid larvae develop. The Cotesia rubecula bracovirus is unique among polydnaviruses in that only four major genes are detected in parasitized host (Pieris rapae) tissues, and gene expression is transient. Here we describe a novel C. rubecula bracovirus gene (CrV3) encoding a lectin monomer composed of 159 amino acids, which has conserved residues consistent with invertebrate and mammalian C-type lectins. Bacterially expressed CrV3 agglutinated sheep red blood cells in a divalent ion-dependent but Ca2+-independent manner. Agglutination was inhibited by EDTA but not by biological concentrations of any saccharides tested. Two monomers of ∼14 and ∼17 kDa in size were identified on SDS-PAGE in parasitized P. rapae larvae. The 17-kDa monomer was found to be an N-glyscosylated form of the 14-kDa monomer. CrV3 is produced in infected hemocytes and fat body cells and subsequently secreted into hemolymph. We propose that CrV3 is a novel lectin, the first characterized from an invertebrate virus. CrV3 shows over 60% homology with hypothetical proteins isolated from polydnaviruses in two other Cotesia wasps, indicating that these proteins may also be C-type lectins and that a novel polydnavirus lectin family exists in Cotesia-associated bracoviruses. CrV3 is probably interacting with components in host hemolymph, resulting in suppression of the Pieris immune response. The high similarity of CrV3 with invertebrate lectins, as opposed to those from viruses, may indicate that some bracovirus functions were acquired from their hosts. Polydnaviruses are particles specifically associated with the ovaries of certain Braconid and Ichneumonid endoparasitoids (1Stoltz D.B. Vinson S.B. Adv. Virus Res. 1979; 24: 125-171Crossref PubMed Scopus (233) Google Scholar). They are divided into genera, Ichnovirus and Bracovirus, based on differing host range and morphology (2Stoltz D.B. Whitfield J.B. J. Hym. Res. 1992; 1: 125-139Google Scholar). Polydnavirus genomes exist as a series of different circular DNA segments (3Krell P.J. Summers M.D. Vinson S.B. J. Virol. 1982; 43: 859-870Crossref PubMed Google Scholar), which are packaged singly or in groups into individual polydnavirus particles (1Stoltz D.B. Vinson S.B. Adv. Virus Res. 1979; 24: 125-171Crossref PubMed Scopus (233) Google Scholar). Particle-associated DNA segments are known to originate from wasp chromosomal DNA and are transferred in their integrated form to subsequent generations of wasps (4Stoltz D.B. Guzo D. Cook D. Virology. 1986; 155: 120-131Crossref PubMed Scopus (74) Google Scholar). Thus, polydnaviruses from different wasps are genetically isolated from each other and considered as separate “species” (5Webb B.A. Miller L.K. Ball L.A. The Insect Viruses. Plenum Publishing Corp., New York1998: 105-139Crossref Google Scholar). “Transmission” of particles is exclusively vertical (4Stoltz D.B. Guzo D. Cook D. Virology. 1986; 155: 120-131Crossref PubMed Scopus (74) Google Scholar, 6Stoltz D.B. J. Gen. Virol. 1990; 71: 1051-1056Crossref PubMed Scopus (86) Google Scholar), and particles are therefore not detected in males, although episomal polydnavirus DNA may exist (7Fleming J.G. Summers M.D. J. Virol. 1986; 57: 552-562Crossref PubMed Google Scholar). Production of particles is restricted to specialized ovarian calyx cells (1Stoltz D.B. Vinson S.B. Adv. Virus Res. 1979; 24: 125-171Crossref PubMed Scopus (233) Google Scholar) and is initiated in the pupal phase, soon after the onset of cuticular melanization, and continues in female adult wasps (8Norton W.N. Vinson S.B. Cell Tissue Res. 1983; 231: 387-398Crossref PubMed Scopus (53) Google Scholar, 9Albrecht U. Wyler T. Pfisterwilhelm R. Gruber A. Stettler P. Heiniger P. Kurt E. Schumperli D. Lanzrein B. J. Gen. Virol. 1994; 75: 3353-3363Crossref PubMed Scopus (93) Google Scholar, 10Pasquier-Barre F. Dupuy C. Huguet E. Monteiro F. Moreau A. Poirié M. Drezen J.-M. J. Gen. Virol. 2002; 83: 2035-2045Crossref PubMed Scopus (51) Google Scholar, 11Tanaka K. Matsumoto H. Hayakawa Y. Appl. Entomol. Zool. 2002; 37: 323-328Crossref Scopus (7) Google Scholar). Although the replication mechanism is not completely understood, recent evidence suggests that controlled localized chromosomal amplification occurs before excision of the particle segments (10Pasquier-Barre F. Dupuy C. Huguet E. Monteiro F. Moreau A. Poirié M. Drezen J.-M. J. Gen. Virol. 2002; 83: 2035-2045Crossref PubMed Scopus (51) Google Scholar). Larger chromosomal segments may have smaller segments nested within (12Cui L. Webb B.A. J. Virol. 1997; 71: 8504-8513Crossref PubMed Google Scholar). Particles accumulate in the oviduct and are injected into the host hemocoel, together with the parasitoid egg and various maternal secretions, at oviposition. The presence of polydnavirus particles is essential for survival of the egg and/or developing parasitoid larva (13Edson K.M. Vinson S.B. Stoltz D.B. Summers M.D. Science. 1981; 211: 582-583Crossref PubMed Scopus (242) Google Scholar, 14Stoltz D.B. Guzo D. J. Insect Physiol. 1986; 32: 377-388Crossref Scopus (107) Google Scholar, 15Guzo D. Stoltz D.B. J. Insect Physiol. 1987; 33: 19-31Crossref Scopus (78) Google Scholar). Polydnavirus DNA segments do not contain genes for particle replication, so no particles are produced in the lepidopteran host (1Stoltz D.B. Vinson S.B. Adv. Virus Res. 1979; 24: 125-171Crossref PubMed Scopus (233) Google Scholar, 16Webb B.A. Cui L.W. J. Insect Physiol. 1998; 44: 785-793Crossref PubMed Scopus (46) Google Scholar). Particles enter most host cell types (17Strand M.R. Mckenzie V. Grassl B.A. Aiken J.M. J. Gen. Virol. 1992; 73: 1627-1635Crossref PubMed Scopus (114) Google Scholar, 18Harwood S.H. Beckage N.E. Insect Biochem. Mol. Biol. 1994; 24: 685-698Crossref Scopus (64) Google Scholar), and viral transcripts are produced in the first few hours after parasitization. Transcripts are generated either transiently (19Asgari S. Hellers M. Schmidt O. J. Gen. Virol. 1996; 77: 2653-2662Crossref PubMed Scopus (129) Google Scholar) or persistently (17Strand M.R. Mckenzie V. Grassl B.A. Aiken J.M. J. Gen. Virol. 1992; 73: 1627-1635Crossref PubMed Scopus (114) Google Scholar) during parasitism. Relative levels of Campoletis sonorensis ichnovirus gene expression in Helicoverpa virescens larvae depend largely on gene copy number (16Webb B.A. Cui L.W. J. Insect Physiol. 1998; 44: 785-793Crossref PubMed Scopus (46) Google Scholar); therefore, segment nesting could conceivably function to increase the copy number of genes essential for parasitoid survival. Such genes presumably would encode abundantly expressed, secreted proteins rather than intracellular proteins (16Webb B.A. Cui L.W. J. Insect Physiol. 1998; 44: 785-793Crossref PubMed Scopus (46) Google Scholar). Cotesia rubecula bracovirus (CrBV) 1The abbreviations used are: CrBV, Cotesia rubecula bracovirus; CTL, C-type lectin; CRD, carbohydrate recognition domain; PBS, phosphate-buffered saline; RT, reverse transcription; ORBC, ovine red blood cell. genes are expressed in the host larvae, Pieris rapae, over a relatively short time period, from 4 to 12 h after parasitization (19Asgari S. Hellers M. Schmidt O. J. Gen. Virol. 1996; 77: 2653-2662Crossref PubMed Scopus (129) Google Scholar). CrBV appears to express only 4 major genes, which differs from other systems, such as C. sonorensis ichnovirus, which is suspected of expressing over 35 genes comprising several gene families (20Turnbull M. Webb B. Adv. Virus Res. 2002; 58: 203-254Crossref PubMed Google Scholar). The products of particle-associated genes act to suppress the host immune response (19Asgari S. Hellers M. Schmidt O. J. Gen. Virol. 1996; 77: 2653-2662Crossref PubMed Scopus (129) Google Scholar, 21Strand M.R. Noda T. J. Insect Physiol. 1991; 37: 839-850Crossref Scopus (132) Google Scholar, 22Li X. Webb B.A. J. Virol. 1994; 68: 7482-7489Crossref PubMed Google Scholar, 23Lavine M.D. Beckage N.E. J. Insect Physiol. 1996; 42: 41-51Crossref Scopus (98) Google Scholar, 24Luckhart S. Webb B.A. Dev. Com. Immunol. 1996; 20: 1-21Crossref PubMed Scopus (75) Google Scholar, 25Cui L. Soldevila A. Webb B.A. Arch. Insect Biochem. Physiol. 1997; 36: 251-271Crossref PubMed Scopus (58) Google Scholar), most often by targeting hemocytes. Gene products may also lead to physiological disorders (e.g. arrested development) by interfering with the host endocrine system (26Vinson S.B. Iwantsch G.F. Q. Rev. Biol. 1980; 55: 143-165Crossref Google Scholar, 27Webb B.A. Dahlman D.L. J. Insect Physiol. 1986; 32: 339-345Crossref Scopus (21) Google Scholar, 28Lawrence P.O. Lanzrein B. Beckage N.E. Thompson S.N. Federici B.A. Parasites and Pathogens of Insects. 1. Academic Press, CA1993: 59-86Google Scholar, 29Balgopal M.M. Dover B.A. Goodman W.G. Strand M.R. J. Insect Physiol. 1996; 42: 337-345Crossref Scopus (36) Google Scholar). Suppression of the host immune response appears to be the primary function of most polydnavirus genes expressed in lepidopteran larvae and is considered an important evolutionary adaptation for an organism directly exposed to the immune system of its host. One of the four major CrBV genes, CrV1, encodes a glycoprotein that is abundantly expressed in host tissues and inactivates hemocytes by destabilizing the cytoskeleton (19Asgari S. Hellers M. Schmidt O. J. Gen. Virol. 1996; 77: 2653-2662Crossref PubMed Scopus (129) Google Scholar, 30Asgari S. Schmidt O. Theopold U. J. Gen. Virol. 1997; 78: 3061-3070Crossref PubMed Scopus (106) Google Scholar). As a result, infected hemocytes are unable to encapsulate the parasitoid egg. A 32-kDa wasp-specific protein (Crp32) produced in calyx cells is associated with particles and also covers the parasitoid's eggs, providing passive immune protection for the developing embryo (31Asgari S. Theopold U. Wellby C. Schmidt O. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3690-3695Crossref PubMed Scopus (94) Google Scholar). Whereas Crp32 appears to provide passive protection for the parasitoid, polydnavirus genes provide protection by actively suppressing host immune function. Both elements are required for survival and development of the C. rubecula parasitoid (31Asgari S. Theopold U. Wellby C. Schmidt O. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3690-3695Crossref PubMed Scopus (94) Google Scholar). C-type lectins (CTLs) are proteins that bind to specific glycodeterminants and require the presence of divalent metal ions, most commonly Ca2+, to exhibit binding (32Kilpatrick D.C. Biochim. Biophys. Acta. 2002; 1572: 187-197Crossref PubMed Scopus (375) Google Scholar). CTLs are defined by a series of conserved residues in their carbohydrate recognition domains (CRDs) (33Drickamer K. Taylor M.E. Rev. Cell Biol. 1993; 9: 237-264Crossref Scopus (710) Google Scholar). Amino acid sequence differences in various CRDs produce a range of carbohydrate binding specificities. CTLs are extremely diverse and have been subdivided into seven groups based on gene structure and nature of non-lectin domains (32Kilpatrick D.C. Biochim. Biophys. Acta. 2002; 1572: 187-197Crossref PubMed Scopus (375) Google Scholar). One class, simple CTLs, has been isolated from invertebrates and appears to function as part of induced humoral immune responses (32Kilpatrick D.C. Biochim. Biophys. Acta. 2002; 1572: 187-197Crossref PubMed Scopus (375) Google Scholar), presumably binding to carbohydrates on the surface of foreign bodies or damaged tissue. These lectins are generally multimeric, with each monomer containing one CRD, and most often bind galactose as the primary ligand (33Drickamer K. Taylor M.E. Rev. Cell Biol. 1993; 9: 237-264Crossref Scopus (710) Google Scholar). Here we report on a novel CrBV gene, CrV3, the product of which shows divalent ion-dependent lectin activity and has a conserved CTL domain similar to those isolated from invertebrates and mammals. Although CTLs have been isolated from a range of invertebrates, this is the first report of a CTL associated with invertebrate viruses. Insect Cultures—C. rubecula (Hymenoptera: Braconidae) endoparasitoid wasps were reared on cabbage-fed P. rapae (Lepidoptera: Pieridae) as described previously (34Asgari S. Schmidt O. J. Insect Physiol. 1994; 40: 789-795Crossref Scopus (46) Google Scholar). Virus and Genomic DNA Isolation—Calyx fluid from 50 female wasps was collected in PBS (138 mm NaCl, 2.7 mm KCl, 1.47 mm KH2PO4, and 7.3 mm Na2HPO4, pH 7.6) by homogenization of ovaries. The suspension was passed through a 0.45 μm syringe filter (Minisart®) and centrifuged at 15,800 × g in a desktop centrifuge for 15 min (35Beckage N.E. Tan F.F. Schleifer K.W. Lane R.D. Cherubin L.L. Arch. Insect Physiol. Biochem. 1994; 26: 165-195Crossref Scopus (118) Google Scholar). Pelleted virus particles were resuspended in 180 μl of PBS, and DNA was isolated from this suspension as described previously (4Stoltz D.B. Guzo D. Cook D. Virology. 1986; 155: 120-131Crossref PubMed Scopus (74) Google Scholar). DNA was isolated from ovaries and female and male wasps by homogenizing them in a buffer made up of 10 mm Tris, 10 mm EDTA, and 1% SDS, pH 8.0. Proteinase K was added to a final concentration of 0.25 μg/μl, and the samples were incubated at 40 °C overnight. Samples were treated with RNase A (125 μg/μl) at 37 °C for 30 min and then extracted with phenol/chloroform. DNA was precipitated by adding 2 volumes of ethanol and 0.2 volume of 3 m sodium acetate, pH 5.3, and centrifugation at 15,800 × g for 20 min. Pellet was washed with 70% ethanol, dried at 37 °C, and resuspended in water. Southern and Northern Hybridization—DNA samples were run on a 1% agarose gel and transferred to a nylon membrane (Amersham Biosciences) as described previously (36Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Total RNA was isolated from 6 h parasitized P. rapae caterpillars according to Chomczynski and Sacchi (37Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63184) Google Scholar). RNA samples were run on 1% agarose gels under denaturing conditions, using formaldehyde, and transferred to nylon membranes as described previously (36Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Construction and Screening of a 6 h Parasitized Larval P. rapae Library—Total RNA was extracted from P. rapae larvae at 6 h after parasitization by mated C. rubecula wasps (QuickPrep™ total RNA extraction kit; Amersham Biosciences). mRNA was then isolated from total RNA (PolyATtract™ mRNA isolation system; Promega). The isolated mRNA was used for construction of the cDNA library containing clones packaged in pBlueskript® SK(±) phagemids (cDNA synthesis kit, ZAP-cDNA® synthesis kit, and ZAP-cDNA® Gigapak® III Gold cloning kit; Stratagene). The library was amplified and titered according to the manufacturer's instructions before being probed with total CrBV DNA previously digested with BamHI and HindIII and labeled with 32P. Probes were prepared as described (Ready-To-Go™ DNA labeling beads; Amersham Biosciences). Positive clones were re-screened, resulting in isolation of the complete CrV3 coding region. CrV3 was sequenced using M13 forward and reverse primers directly from the phagemid vectors produced by the aforementioned protocols and subsequent automated sequencing (Applied Biosystems). PCR Amplifications—Specific primers to the CrV3 open reading frame (5′ primer CrV3-F and 3′ primer CrV3-R; see Fig. 1A) were designed containing SphI and PstI restriction sites to allow for direct ligation of the amplified fragment into the pQE30 expression vector (Qiagen). Primer sequences were as follows (restriction sites are underlined): CrV3-F, CGCGGCATGCAAAAACATAAGCATTCAG; and CrV3-R, GCGCCTGCAGTCACTCCTTTGTGCAGAAG. Approximately 30 ng of genomic DNA from female C. rubecula wasps or 100–350 ng of plasmid DNA was used as template in PCR reactions. A 50-μl reaction was prepared by mixing 5 μl of 10× reaction buffer, 3 μl of MgCl2 (Promega), 1 μl of CrV3-F primer (0.1 μg/μl), 1 μl of CrV3-R (0.1 μg/μl), 0.5 μl of deoxynucleotide triphosphates (15 mm), and 0.5 μl of Taq DNA polymerase (Promega) and template DNA. After 5 min at 94 °C, 30 amplification cycles were run including denaturing at 94 °C for 1 min, annealing at 56 °C for 1 min, and extension at 72 °C for 1 min. Final extension was carried out for 5 min at 72 °C. Reaction products were electrophoresed on 1.2% agarose gels at 110 mA and visualized using ethidium bromide. Reverse Transcription-PCR (RT-PCR)—CrV3-F and CrV3-R primers were used in RT-PCR of RNA isolated from 6 h parasitized P. rapae larvae, utilizing avian myeloblastosis virus reverse transcriptase (Promega). 1.5 μg of RNA and 0.1 μg of CrV3-R primer, in a final volume of 10.7 μl, were heated to 95 °C for 5 min to denature RNA, before being cooled on ice. Reverse transcription was performed by adding 3 μl of 5× RT buffer (Promega), 0.3 μl of RNasin (Promega), 0.5 μl of avian myeloblastosis virus reverse transcriptase, and 0.5 μl of deoxynucleotide triphosphates (15 mm) before heating at 42 °C for 1 h and then heating at 95 °C for 5 min. The total contents were then used in a PCR by adding 3.5 μl of 10× reaction buffer, 1 μl of CrV3-F primer (0.1 μg/μl), 1 μl of CrV3-R (0.1 μg/μl), 0.5 μl of deoxynucleotide triphosphates (15 mm), 0.5 μl of Taq DNA polymerase, and 29 μl of H2O. Cycling, electrophores s, and visualization protocols were as performed for standard PCR of CrV3. Collection of Protein Samples and Western Blotting—P. rapae larvae were bled into PBS saturated with phenylthiourea via removal of a proleg, and the hemolymph was centrifuged at 2300 × g for 5 min at room temperature. Supernatant (cell-free hemolymph) was removed, and the cellular pellet was resuspended in PBS. Gut tissue and head capsule were removed, and the fat body was washed and then homogenized in PBS before centrifugation (9300 × g for 10 min) and removal of supernatant (fat body proteins). Protein samples were stored at –20 °C and electrophoresed on denaturing 15% SDS-polyacrylamide gels as described by Laemmli (38Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207208) Google Scholar). Proteins were generally not heated before electrophoresis unless testing the effect of heating. Samples were run in conjunction with SeeBlue™ pre-stained standard protein markers (Novex) to allow subsequent estimation of sample protein sizes. Proteins were either stained within the gels using Coomassie Blue (Sigma) or, alternatively, transferred to a nitrocellulose membrane (Amersham Biosciences) as described previously (36Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Before obtaining anti-CrV3, blots were probed with a 1:10,000 dilution of an alkaline phosphatase-conjugated monoclonal anti-polyHistidine antibody (clone His-1; Sigma). Anti-CrV3 was used at a dilution of 1:5000 (see below). Expression of CrV3 in Bacteria—Gene-specific primers were designed (CrV3-F and CrV3-R) to amplify the open reading frame of the CrV3 gene, excluding a putative signal sequence corresponding to the first 14 amino acids of the protein (see Fig. 1). These primers were used in PCR of phagemid vector produced during library screening to obtain the required fragment for ligation into the pQE30 bacterial expression vector (Qiagen). The desired PCR product was purified (Perfectprep® Gel Cleanup Kit; Eppendorf), precipitated, and digested with SphI and PstI, as was pQE30, before ligation of the digested DNAs using T4 DNA ligase (Promega). M15 strain of Escherichia coli was transformed with the ligation reaction contents, using heat shock. Colonies containing desired recombinant vectors were identified by PCR of bacterial cells using vector-specific primers. Production of bacterial CrV3 (containing 6 additional vector-derived histidine residues) was induced by the addition of 1 mm isopropyl-1-thio-β-d-galactopyranoside to bacterial cultures before incubation for 2 h at 37 °C. The resultant fusion protein was identified by Western blotting and contained mainly in the insoluble fraction of total bacterial proteins, with only a small amount being soluble. Purification of Insoluble Bacterial CrV3 Protein—50 ml of induced bacterial culture was centrifuged at ∼7700 × g for 10 min at 4 °C. Cells were then resuspended in a lysis buffer (6 m GuHCl, 0.1 m NaH2PO4, and 0.01 m Tris, pH 8 .0) and gently rocked for 1 h. The sample was centrifuged at 12,000 × g for 15 min at 4 °C before incubation (1 h, RT) of the supernatant with 300 μl of nickel-nitrilotriacetic acid resin beads (Qiagen) previously equilibrated in 8 m urea (with 0.1 m NaH2PO4 and 0.01 m Tris, pH 8.0). Non-bound proteins were removed with buffers containing 8 m urea with pH > 6.3, and bound proteins were eluted with buffers containing 8 m urea with pH < 6.0. Samples were diluted with 2 volumes of water before being dialyzed overnight in Tris-buffered saline (0.15 m NaCl and 0.01 m Tris, pH 8.0) at 4 °C to remove excess urea to renature the protein. Protein was concentrated by vacuum drying. Anti-CrV3 Antibody Production—Purified bacterial CrV3 was visualized on 15% SDS-acrylamide gels by staining with water-dissolved Coomassie Blue. CrV3 protein bands were excised from the gel with sterile blades and crushed. One rabbit was used to produce anti-CrV3 by an initial injection of the purified CrV3 (∼5 μg) mixed with Freund's complete adjuvant (Sigma), followed by two booster injections with purified CrV3 with Freund's incomplete adjuvant (Sigma) at 2 and 4 weeks, respectively, after the initial injection. Antiserum was obtained 2 weeks after the final injection and used to probe Western blot membranes at a dilution of 1:5000. Bound anti-CrV3 was then visualized by alkaline phosphatase-labeled secondary anti-rabbit antibody (1:10,000). N-Glycosidase Digestion of CrV3—Total proteins from cell-free hemolymph of 6 h parasitized P. rapae larvae were mixed with SDS-PAGE loading buffer containing β-mercaptoethanol. Igepal CA-630 nonionic detergent (Sigma) was added to a final concentration of 0.8% before addition of 2 units of recombinant N-glycosidase F (Roche Diagnostics) and incubation for 18 h at 37 °C. Characterization of CrV3-mediated Hemagglutination—Lectin activity was measured by mixing 25 μl of serially diluted bacterial CrV3 extract with 25 μl of 2% trypsinized and gluteraldehyde-stabilized ovine red blood cells (ORBCs; Sigma) in PBS containing 2% bovine serum albumin. Samples were mixed well in U-bottomed microtiter wells before incubation at 37 °C for 1 h. Complete agglutination caused ORBCs to form a diffuse layer over the bottom of the wells, whereas unagglutinated cells formed a small dot at the center of the wells. Lectin titer was determined as the reciprocal of the maximum sample dilution causing complete ORBC agglutination. To test for inhibitory ligands, 5 μl of sugar solution (various concentrations) in PBS was added before incubation in place of the 5 μl of PBS used to dilute ORBCs in the standard assay. Lipopolysaccaride (E. coli, serotype 055:B5A; Sigma) and Laminari tetrose were added as described for the other sugars, up to a maximum concentration of 1 mg/ml. Comparison of concentrations causing 50% inhibition of lectin activity was made for all sugars tested. To test for dependence of lectin activity on divalent cations, 25 μl of serial CrV3 sample dilutions was prepared in 1 mm divalent cations (Mg, Mn, and Ca) or 1 mm EDTA and mixed with 25 μl of 2% ORBCs as described above. Increasing concentrations of divalent cations were also added to EDTA-inhibited CrV3 to restore lectin activity. Molecular Characterization and Expression of CrV3—C. rubecula parasitoid wasps inject polydnavirus particles into the hemocoel of P. rapae larvae at oviposition, leading to infection of host tissues by the particles and transient expression of particle-associated genes (19Asgari S. Hellers M. Schmidt O. J. Gen. Virol. 1996; 77: 2653-2662Crossref PubMed Scopus (129) Google Scholar). CrV1 was previously isolated by screening a cDNA library constructed from 6 h parasitized caterpillars using total CrBV DNA as a probe (19Asgari S. Hellers M. Schmidt O. J. Gen. Virol. 1996; 77: 2653-2662Crossref PubMed Scopus (129) Google Scholar). The same method was used here to isolate a ∼700-bp cDNA encompassing the coding region of a putative CrBV gene and including a poly(A) tail (Fig. 1A). To confirm the cDNA as particle-derived, the fragment was cloned and used as a probe in both a Southern blot of digested CrBV DNA (Fig. 2A) and a Northern blot of RNA from unparasitized and 6 h parasitized larvae (Fig. 2B). Hybridization occurred to a CrBV restriction fragment of ∼4 kb and to a parasitism-specific transcript of ∼1.1 kb. These data and the fact that the same probe bound to genomic DNA from female wasps but not to that from P. rapae (data not shown) indicate that the cDNA originated from particles introduced to the larvae at oviposition. Binding of the cDNA to only one site in the Northern blot reveals that CrV3 shows no significant nucleotide sequence homology with other CrBV-related genes. The cDNA was subsequently sequenced with data showing an open reading frame of 480 bp (Fig. 1A). A methionine codon (ATG) at the beginning of the open reading frame was identified as the only possible codon with a nucleotide sequence environment predicted for functional initiation codons (39Cavener R.C. Ray S.C. Nucleic Acids Res. 1991; 19: 3185-3192Crossref PubMed Scopus (526) Google Scholar). The predicted molecular mass of CrV3 is 17.6 kDa, with a pI of 9.13. Computer analyses (PSORT II; psort.nibb.ac.jp/form2.html) of the deduced amino acid sequence revealed a putative signal peptide encompassing the first 14 amino acids of the protein, with a cleavage point predicted at the end of the signal peptide (Fig. 1A), indicating that CrV3 protein is probably secreted from cells of origin. A hydrophobicity plot (Fig. 1B) was produced using ProtScale software (40Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (17215) Google Scholar). Highly hydrophobic residues near the N terminus support predictions of signal sequence composed of N-terminal amino acids. Three putative N-glycosylation sites were found in the open reading frame, as well as a polyadenylation signal ∼150 bp downstream of the stop codon (Fig. 1A). Sequence data were used to generate specific primers to the CrV3 open reading frame (CrV3-F and CrV3-R; see Fig. 1A). Comparison of RT-PCR and genomic DNA PCR products, utilizing these primers, revealed the presence of a 186-bp intron in the genomic CrV3 DNA. The intron was located within the conserved lectin domain. The CrV3 open reading frame (excluding the putative signal peptide) was cloned into pQE30 vector and used to transform Escherichia coli cells in which the CrV3 protein was subsequently induced. Analysis of Coomassie Blue-stained SDS-polyacrylamide gels containing proteins from non-induced and induced cells showed the presence of a ∼16-kDa protein that was heavily up-regulated in induced cells and present mainly in the insoluble portion of the total bacterial proteins (data not shown). Nickel resin beads were used to purify the protein. Confirmation of purification of the up-regulated protein was achieved by using Western blot analysis with anti-polyHistidine as a probe (Fig. 2C). Purified protein from the insoluble fraction was used for injection into rabbits and production of putative anti-CrV3 antibodies. Serum from injected rabbits was used to probe cell-free hemolymph from non-parasitized and 6 h parasitized P. rapae larvae. The serum hybridized to a parasitism-specific protein that was not recognized by rabbit pre-serum (data not shown), confirming successful production of anti-CrV3 antibodies. Western blots utilizing anti-CrV3" @default.
• W1972772092 created "2016-06-24" @default.
• W1972772092 creator A5034246642 @default.
• W1972772092 creator A5059203950 @default.
• W1972772092 creator A5063522497 @default.
• W1972772092 date "2003-05-01" @default.
• W1972772092 modified "2023-10-16" @default.
• W1972772092 title "Characterization of a Novel Protein with Homology to C-type Lectins Expressed by the Cotesia rubecula Bracovirus in Larvae of the Lepidopteran Host, Pieris rapae" @default.
• W1972772092 cites W1517473599 @default.
• W1972772092 cites W1523104860 @default.
• W1972772092 cites W1549107632 @default.
• W1972772092 cites W1591270011 @default.
• W1972772092 cites W1967361018 @default.
• W1972772092 cites W1975304761 @default.
• W1972772092 cites W1985924390 @default.
• W1972772092 cites W1991368224 @default.
• W1972772092 cites W1991732428 @default.
• W1972772092 cites W1993779568 @default.
• W1972772092 cites W2000379512 @default.
• W1972772092 cites W2003217244 @default.
• W1972772092 cites W2006297203 @default.
• W1972772092 cites W2021058088 @default.
• W1972772092 cites W2026936767 @default.
• W1972772092 cites W2033781058 @default.
• W1972772092 cites W2040494620 @default.
• W1972772092 cites W2041492367 @default.
• W1972772092 cites W2046682883 @default.
• W1972772092 cites W2047618483 @default.
• W1972772092 cites W2047921799 @default.
• W1972772092 cites W2056317986 @default.
• W1972772092 cites W2059677534 @default.
• W1972772092 cites W2069029943 @default.
• W1972772092 cites W2070935000 @default.
• W1972772092 cites W2071456465 @default.
• W1972772092 cites W2071767570 @default.
• W1972772092 cites W2082412669 @default.
• W1972772092 cites W2085741631 @default.
• W1972772092 cites W2088432391 @default.
• W1972772092 cites W2089975637 @default.
• W1972772092 cites W2100837269 @default.
• W1972772092 cites W2110031268 @default.
• W1972772092 cites W2119539742 @default.
• W1972772092 cites W2123826664 @default.
• W1972772092 cites W2136410405 @default.
• W1972772092 cites W2141201315 @default.
• W1972772092 cites W2157840525 @default.
• W1972772092 cites W2171701745 @default.
• W1972772092 cites W2173015905 @default.
• W1972772092 cites W2234965527 @default.
• W1972772092 cites W2292359171 @default.
• W1972772092 cites W4294216491 @default.
• W1972772092 doi "https://doi.org/10.1074/jbc.m301396200" @default.
• W1972772092 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12644452" @default.
• W1972772092 hasPublicationYear "2003" @default.
• W1972772092 type Work @default.
• W1972772092 sameAs 1972772092 @default.
• W1972772092 citedByCount "47" @default.
• W1972772092 countsByYear W19727720922012 @default.
• W1972772092 countsByYear W19727720922013 @default.
• W1972772092 countsByYear W19727720922015 @default.
• W1972772092 countsByYear W19727720922016 @default.
• W1972772092 countsByYear W19727720922018 @default.
• W1972772092 countsByYear W19727720922019 @default.
• W1972772092 countsByYear W19727720922021 @default.
• W1972772092 countsByYear W19727720922022 @default.
• W1972772092 crossrefType "journal-article" @default.
• W1972772092 hasAuthorship W1972772092A5034246642 @default.
• W1972772092 hasAuthorship W1972772092A5059203950 @default.
• W1972772092 hasAuthorship W1972772092A5063522497 @default.
• W1972772092 hasBestOaLocation W19727720921 @default.
• W1972772092 hasConcept C126831891 @default.
• W1972772092 hasConcept C173758957 @default.
• W1972772092 hasConcept C177756618 @default.
• W1972772092 hasConcept C2777248757 @default.
• W1972772092 hasConcept C54355233 @default.
• W1972772092 hasConcept C59822182 @default.
• W1972772092 hasConcept C86803240 @default.
• W1972772092 hasConceptScore W1972772092C126831891 @default.
• W1972772092 hasConceptScore W1972772092C173758957 @default.
• W1972772092 hasConceptScore W1972772092C177756618 @default.
• W1972772092 hasConceptScore W1972772092C2777248757 @default.
• W1972772092 hasConceptScore W1972772092C54355233 @default.
• W1972772092 hasConceptScore W1972772092C59822182 @default.
• W1972772092 hasConceptScore W1972772092C86803240 @default.
• W1972772092 hasIssue "22" @default.
• W1972772092 hasLocation W19727720921 @default.
• W1972772092 hasOpenAccess W1972772092 @default.
• W1972772092 hasPrimaryLocation W19727720921 @default.
• W1972772092 hasRelatedWork W1487326814 @default.
• W1972772092 hasRelatedWork W2065787163 @default.
• W1972772092 hasRelatedWork W2356378216 @default.
• W1972772092 hasRelatedWork W2360718519 @default.
• W1972772092 hasRelatedWork W2367465409 @default.
• W1972772092 hasRelatedWork W2370333792 @default.
• W1972772092 hasRelatedWork W2372903316 @default.
• W1972772092 hasRelatedWork W2379408023 @default.
• W1972772092 hasRelatedWork W2617198572 @default.
• W1972772092 hasRelatedWork W347116476 @default.

• next