FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1972783122> ?p ?o ?g. }

• W1972783122 endingPage "31421" @default.
• W1972783122 startingPage "31409" @default.
• W1972783122 abstract "The pathology of joint destruction is associated with elevated production of basic fibroblast growth factor (bFGF) and matrix metalloproteinase-13 (MMP-13). In osteoarthritic joint disease, expression of bFGF and MMP-13 in chondrocytes and their release into the synovial fluid are significantly increased. We have previously found that the capacity for cartilage repair in human adult articular chondrocytes is severely compromised by minimal exposure to bFGF because bFGF reduces responsiveness to bone morphogenetic protein-7 and insulin-like growth factor-1 and induces MMP-13 through protein kinase Cδ-dependent activation of multiple mitogen-activated protein kinase (MAPK) signaling pathways. Here we show using biochemical and molecular approaches that transcription factor Elk-1, a direct downstream target of MAPK, is a critical transcriptional activator of of MMP-13 by bFGF in human articular chondrocytes. We also provide evidence that Elk-1 is a direct target of NFκB and induces MMP-13 expression upon activation of the NFκB signaling pathway. Taken together, our results suggest that elevated expression of MMP-13 occurs through Elk-1 activation of both MAPK and NFκB signaling pathways, thus revealing a two-pronged biological mechanism by which bFGF controls the production of catabolic enzymes that are associated with excessive degradation of the cartilage matrix in degenerative joint diseases such as osteoarthritis. The pathology of joint destruction is associated with elevated production of basic fibroblast growth factor (bFGF) and matrix metalloproteinase-13 (MMP-13). In osteoarthritic joint disease, expression of bFGF and MMP-13 in chondrocytes and their release into the synovial fluid are significantly increased. We have previously found that the capacity for cartilage repair in human adult articular chondrocytes is severely compromised by minimal exposure to bFGF because bFGF reduces responsiveness to bone morphogenetic protein-7 and insulin-like growth factor-1 and induces MMP-13 through protein kinase Cδ-dependent activation of multiple mitogen-activated protein kinase (MAPK) signaling pathways. Here we show using biochemical and molecular approaches that transcription factor Elk-1, a direct downstream target of MAPK, is a critical transcriptional activator of of MMP-13 by bFGF in human articular chondrocytes. We also provide evidence that Elk-1 is a direct target of NFκB and induces MMP-13 expression upon activation of the NFκB signaling pathway. Taken together, our results suggest that elevated expression of MMP-13 occurs through Elk-1 activation of both MAPK and NFκB signaling pathways, thus revealing a two-pronged biological mechanism by which bFGF controls the production of catabolic enzymes that are associated with excessive degradation of the cartilage matrix in degenerative joint diseases such as osteoarthritis. Degenerative osteoarthritis (OA) 2The abbreviations used are: OA, osteoarthritis; ECM, extracellular matrix; MMP, matrix metalloproteinase; bFGF, basic fibroblast growth factor; FGFR1, FGF receptor 1; MAPK, mitogen-activated protein kinase; Erk, extracellular signal-regulated kinase; MEK, MAPK/ERK kinase; IKK, IκB kinase; JNK, c-Jun N-terminal kinase; IL-1, interleukin-1; CMV, cytomegalovirus; siRNA, small interference RNA; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PKC, protein kinase C; RT, reverse transcription; PBS, phosphate-buffered saline; DN, dominant negative; wt, wild type; PI3K, phosphatidylinositol 3-kinase. is both a serious cause of disability and a major source of health care costs. Given the physiological significance and potential clinical impact on cartilage homeostasis, comparatively little is known about the role of growth factors, cytokines, and inflammatory mediators in the pathogenesis of the disease. Articular cartilage is a relatively uncomplicated tissue composed of chondrocytes and extracellular matrix (ECM). Despite its limited cell diversity and absence of vasculature and innervation, it is a dynamic tissue in which maintenance of the ECM depends on the delicate and physiologically regulated balance between anabolic and catabolic responses of sparsely distributed chondrocytes in normal cartilage. However, in OA, chondrocyte metabolism is unbalanced due to excessive production of matrix metalloproteinases (MMPs), aggrecanases (ADAMTS), and other proteinases by chondrocytes (1Pelletier J.P. Kim J. Howell D.S. Arthrits and Allied Conditions: A Textbook of Rheumatologyi. 2001; (Lippincott Williams & Wilkins, Baltimore, 14th Ed.,): 2195-2245Google Scholar, 2Martel-Pelletier J. Kim D.J. Pelletier J.P. Best Pract. Res. Clin. Rheumatol. 2001; 15: 805-829Crossref PubMed Scopus (236) Google Scholar). Among the MMPs, MMP-1 (collagenase-1) and MMP-13 (collagenase-3) play a significant role in the development of OA, because they are rate-limiting enzymes involved in collagen degradation (1Pelletier J.P. Kim J. Howell D.S. Arthrits and Allied Conditions: A Textbook of Rheumatologyi. 2001; (Lippincott Williams & Wilkins, Baltimore, 14th Ed.,): 2195-2245Google Scholar, 3Reboul P. Kim J.P. Tardif G. Cloutier J.M. Martel-Pelletier J. J. Clin. Invest. 1996; 97: 2011-2019Crossref PubMed Scopus (426) Google Scholar, 4Fernandes J.C. Kim J. Lascau-Coman V. Moldovan F. Jovanovic D. Raynauld J.P. Pelletier J.P. J. Rheumatol. 1998; 25: 1585-1594PubMed Google Scholar, 5Burrage P.S. Kim K.S. Brinckerhoff C.E. Front. Biosci. 2006; 11: 529-543Crossref PubMed Scopus (982) Google Scholar). MMP-1 is produced primarily by synovial cells, whereas MMP-13 is almost exclusively produced by chondrocytes that reside in the cartilage. In addition to collagen, MMP-13 also degrades the proteoglycan molecule aggrecan, suggesting a potential dual role in matrix destruction (5Burrage P.S. Kim K.S. Brinckerhoff C.E. Front. Biosci. 2006; 11: 529-543Crossref PubMed Scopus (982) Google Scholar, 6Miwa H.E. Kim T.A. Hyunh T.D. Flory D.M. Hering T.M. Biochim. Biophys. Acta. 2006; 1760: 472-486Crossref PubMed Scopus (23) Google Scholar, 7Fosang A.J. Kim K. Maciewicz R.A. J. Clin. Invest. 1996; 98: 2292-2299Crossref PubMed Scopus (179) Google Scholar). Given the important role of MMP-13, it is vital to elucidate the key regulators and signaling pathways that control MMP-13 gene expression. Defining this mechanism is necessary to understand the molecular etiology of OA and to design new strategies for the development of therapautics to prevent the joint destruction seen in OA. Basic FGF (or FGF-2) is a member of a large FGF family of structurally related proteins that bind heparin or heparin sulfate and modulate the growth, differentiation, migration, and survival of a wide variety of cell types (8Bikfalvi A. Kim S. Pintucci G. Rifkin D.B. Endocr. Rev. 1997; 18: 26-45Crossref PubMed Scopus (855) Google Scholar). Basic FGF (bFGF) is expressed by chondrocytes and is stored in the ECM of adult articular cartilage (9Vincent T. Kim M. Bolton M. Wait R. Saklatvala J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 8259-8264Crossref PubMed Scopus (177) Google Scholar, 10Vincent T.L. Kim M.A. Hansen U.N. Amis A.A. Saklatvala J. Arthritis Rheum. 2004; 50: 526-533Crossref PubMed Scopus (104) Google Scholar). The mitogenic capacity of bFGF in growth plate cartilage (11O'Keefe R.J. Kim I.D. Puzas J.E. Rosier R.N. J. Orthop. Res. 1994; 12: 299-310Crossref PubMed Scopus (68) Google Scholar, 12Rosselot G. Kim R. Leach R.M. J. Bone. Miner. Res. 1994; 9: 431-439Crossref PubMed Scopus (56) Google Scholar) and adult articular cartilage (13Osborn K.D. Kim S.B. Mankin H.J. J. Orthop. Res. 1989; 7: 35-42Crossref PubMed Scopus (158) Google Scholar) is well known. Nevertheless, previous studies on bFGF from a variety of species have yielded inconsistent results with regards to production of ECM and articular cartilage homeostasis. We recently showed that bFGF has a striking antagonistic effect on the well known cartilage anabolic activities of insulin-like growth factor-1 and osteogenic protein-1, as reflected by inhibition of proteoglycan synthesis and its deposition (14Loeser R.F. Kim S. Pacione C. Im H.J., Arthritis Rheum. 2005; 52: 3910-3917Crossref PubMed Scopus (88) Google Scholar). Signals generated by bFGF stimulate MMP-13 expression in several cell types, including cultured human chondrosarcoma cells (15Uria J.A. Kim M. Lopez J.M. Alvarez J. Vizoso F. Takigawa M. Lopez-Otin C. Am. J. Pathol. 1998; 153: 91-101Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar) and osteoblasts (16Varghese S. Kim S. Canalis E. Endocrinology. 2000; 141: 2185-2191Crossref PubMed Scopus (49) Google Scholar), as well as human adult articular chondrocytes (17Wang X. Kim P.A. Horner A. Shum L. Tuan R.S. Nuckolls G.H. Osteoarthritis Cartilage. 2004; 12: 963-973Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar, 18Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar), and the induction is at the transcriptional level (18Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). Hence, bFGF stimulation of articular chondrocytes may disturb cartilage homeostasis by increasing MMP-13 expression and ECM degradation. Despite these findings, though, the transcriptional mechanisms by which bFGF stimulates MMP-13 expression are poorly understood. Immediate release of bFGF upon mechanical injury to cartilage leads to the rapid and sustained activation of Erk, and it occurs concomitantly with striking changes in chondrocyte gene expression (9Vincent T. Kim M. Bolton M. Wait R. Saklatvala J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 8259-8264Crossref PubMed Scopus (177) Google Scholar, 10Vincent T.L. Kim M.A. Hansen U.N. Amis A.A. Saklatvala J. Arthritis Rheum. 2004; 50: 526-533Crossref PubMed Scopus (104) Google Scholar). Recently, we have reported that the activation of multiple MAPK subgroups (Erk, p38, and JNK) is required for the bFGF-mediated stimulation of MMP-13 in human adult articular chondrocytes (18Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). Elk-1 is a direct downstream target gene of MAPK and is a member of the Ets domain-containing ternary complex factor subfamily of transcription factors (19Gille H. Kim M. Thomae O. Moomaw C. Slaughter C. Cobb M.H. Shaw P.E. EMBO J. 1995; 14: 951-962Crossref PubMed Scopus (590) Google Scholar, 20Gille H. Kim T. Shaw P.E. Curr. Biol. 1995; 5: 1191-1200Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 21Janknecht R. Kim T. EMBO J. 1997; 16: 1620-1627Crossref PubMed Scopus (204) Google Scholar, 22Whitmarsh A.J. Kim P. Sharrocks A.D. Davis R.J. Science. 1995; 269: 403-407Crossref PubMed Scopus (882) Google Scholar, 23Cahill M.A. Kim R. Nordheim A. Curr. Biol. 1996; 6: 16-19Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar). bFGF-initiated transcriptional repression of elastin gene expression, an ECM protein produced by lung fibroblasts, has been reported to be mediated via the activation of Elk-1 (24Carreras I. Kim C.B. Jaworski J.A. Dicamillo S.J. Panchenko M.P. Goldstein R. Foster J.A. Am. J. Physiol. 2001; 281: L766-L775Crossref PubMed Google Scholar). However, the precise physiological role of this transcription factor in chondrocytes has not yet been characterized after stimulation with bFGF. Similarly the critical role of the NFκB pathway in the stimulation of MMP-13 production by various stimuli such as IL-1β, fibronectin fragment, and hyaluranon oligonucleotide has been suggested in previous studies (25Mengshol J.A. Kim M.P. Coon C.I. Barchowsky A. Brinckerhoff C.E. Arthritis Rheum. 2000; 43: 801-811Crossref PubMed Scopus (572) Google Scholar, 26Forsyth C.B. Kim J. Loeser R.F. Arthritis Rheum. 2002; 46: 2368-2376Crossref PubMed Scopus (158) Google Scholar, 27Ohno S. Kim H.J. Knudson C.B. Knudson W. J. Biol. Chem. 2006; 281: 17952-17960Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Nevertheless, the precise cellular and molecular mechanism by which the NFκB pathway stimulates MMP-13 is not clearly understood. In this study, we investigated the concept that the transcriptional activities of Elk-1 and NFκB may together control ECM homeostasis in cartilage. We identified Elk-1 as a key transcriptional regulator of MMP-13 expression by a two-pronged mechanism, because it acts both directly and indirectly. Our data show that activation of MMP-13 transcription occurs via Elk-1 directly, as well as via the NFκB pathway, in which Elk-1 plays a role as an intermediate regulatory molecule to lead to the NFκB-dependent induction of MMP-13 expression. These findings provide a mechanistic understanding of how the release of growth factors and inflammatory cytokines upon cartilage damage can result in the sustained activation of MMPs that may cause further destruction of articular cartilage. Chondrocyte Isolation and Culture Conditions—Normal human ankle cartilage was obtained from tissue donors through the Gift of Hope Organ and Tissue Donor Network. Each donor specimen was graded for gross degenerative changes based on a modified version of the 5-point scale of Collins (28Muehleman C. Kim D. Huch K. Cole A.A. Kuettner K.E. Osteoarthritis Cartilage. 1997; 5: 23-37Abstract Full Text PDF PubMed Scopus (196) Google Scholar). Chondrocytes were isolated by enzymatic digestion of ankle articular cartilage (grade 0 or 1, which has no sign of cartilage degeneration) using Pronase followed by overnight digestion with collagenase-P as described previously (18Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). Isolated cells were resuspended in media at 2 × 106 per milliliter and plated onto 12-well plates at 1 ml/well. Cells were cultured in Dulbecco's modified Eagle's medium/F-12 containing 10% fetal bovine serum and antibiotics (complete media) for 5 days before the experiments. Chondrocyte Stimulation and Immunoblotting—Cells were serum-starved by changing media to serum-free Dulbecco's modified Eagle's medium/F-12 with antibiotics for 1 day. For inhibitor studies, cells were preincubated with individual pathway-specific chemical inhibitors for 30 min before stimulation with bFGF or IL-1β. Experiments were terminated with removal of media and/or cell lysate preparation. The conditioned media was stored at 4 °C with 0.1% NaN3 and used for the experiments within 5 days. Cell lysates were prepared using modified cell lysis radioimmune precipitation assay buffer: 20 mm Tris (pH 7.5), 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, 1% Nonidet P-40, 0.25% deoxycholate, 2.5 mm sodium pyrophosphate, 1 mm glycerol phosphate, 1 mm NaVO4, with 2 mm phenylmethylsulfonyl fluoride (Sigma). Total protein concentrations of both media and cell lysates were determined by a bicinchoninic acid (BCA) protein assay (Pierce). Equal amounts of protein were resolved by 10% SDS-PAGE gels and transferred to nitrocellulose membrane for immunoblot analysis as described previously (18Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). Immunoreactivity was visualized using the ECL system (Amersham Biosciences) and the Signal Visual Enhancer system (Pierce), which magnifies the signal. Plasmids Constructs—Dominant negative forms of individual MAPK expression vectors (Erk-DN, p38-DN, and JNK-DN) were kindly provided by Dr. Ralf Janknecht (Mayo Clinic, Rochester, MN). Elk-1 wild type and its positive luciferase promoter plasmid construct, c-Fos-Luc, Elk-1-associated mutant constructs (CMV-Elk-1 383A) and Gal4-Elk-1 system, including the Luciferase reporter plasmid construct (Gal4 RE-Luc), Gal4-Elk-1 wt, and Gal4-Elk1 Ser383A, were provided by Dr. A. D. Sharrocks (University of Manchester, UK) and R. A. Hipskind (Institute of Genetics, France). FGFR1-DN construct was provided by Dr. C. J. Coscia (St. Louis University). Dominant negative construct of IκBα (pCMV-IκBαM) was purchased from Clontech (Mountain View, CA). Human MMP-13 promoter construct and plasmid expression vector containing siRNA targeting Akt (Mu6pro-Akt1/2) and control siRNA plasmid construct (Mu6pro) were previously described (27Ohno S. Kim H.J. Knudson C.B. Knudson W. J. Biol. Chem. 2006; 281: 17952-17960Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 29Roberts M.S. Kim A.J. Dale T.C. van der Sluijs P. Norman J.C. Mol. Cell. Biol. 2004; 24: 1505-1515Crossref PubMed Scopus (127) Google Scholar, 30Im H.J. Kim C. Chubinskaya S. Van Wijnen A.J. Sun Y. Loeser R.F. J. Biol. Chem. 2003; 278: 25386-25394Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). The p3xNFκBLuc plasmid construct, containing three copies of tandemly repeated NFκB response element sequences (5′-TTGGGCACTCCCTG-3′) of MMP-13 promoter region was achieved by placing the NFκB response elements of MMP-13 promoter region upstream of an SV40 promoter at the SacI site of the pGL3-promoter vector, which contains a luciferase reporter gene system (Promega) as described previously (31Im H.J. Kim S.W. Loh H.H. Brain Res. 1999; 829: 174-179Crossref PubMed Scopus (13) Google Scholar). Transient Transfection by Nucleofection (Electroporation)—Nucleofection methods were optimized for use with human articular chondrocytes by minor modifications of the instructions for the Nucleofector™ kit (Amaxa Biosystems) that have been described previously (18Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 32Pulai J.I. Kim H. Im H.-J. Kumar S. Hanning C. Hegde P.S. Loeser F.R. J. Immunol. 2005; 174: 5781Crossref PubMed Scopus (168) Google Scholar). The Renilla vector (pRL-TK) was co-transfected as an internal control, and the luciferase activity representing promoter activity was measured using the Dual-Luciferase reporter assay system (Promega) and a luminometer (Berthold). In samples containing combinations of plasmids (i.e. co-transfections with Elk-1 or pCMV-IκBαM cDNA construct with MMP-13 promoter/luciferase reporter construct) we adjusted the total amount of DNA concentration to <5 μg per 100 μl of cell-Nucleofector solution complex for the entire set of experiments to minimize toxic effects observed at higher DNA concentrations. To introduce siRNA-targeting Elk-1, the validated TranSilent TF siRNAs targeting Elk-1 and GAPDH were purchased from Panomics (Fremont, CA) or SuperArray Bioscience Co. (Frederick, MD) and were introduced into human articular chondrocytes using nucleofection (as described above) by following the manufacturer's protocol. The effect of Elk-1 siRNA on bFGF-mediated MMP-13 expression was assessed by immunoblotting using anti-MMP-13 (R&D System) or anti-GAPDH antibody (Abcam, UK). Chemical Inhibitors, Growth Factors, and Cytokines—The PKC inhibitor bisindolylmaleimide I (10 μm), PKCδ inhibitor (Rottlerin, 4 μm), PKCϵ inhibitor, and PKCα/β inhibitor (GÖ6976, 5 nm); NFκB inhibitor SN50 (peptide inhibitor, 10 μm), IKK inhibitor II (wedelolactone, 10 μm), FGFR1 inhibitor (SU5402, 5 μm), LY294002 (50 nm), rapamycin (20 nm), and wortmanin (10 μm); Ras inhibitor (manumycin A, 3 μm), Raf inhibitor (Raf1 kinase inhibitor 1, 20 μm), MEK inhibitor (PD098059, 20 μm), p38 inhibitor (SB203580, 10 μm), and JNK inhibitor (SP600125, 20 μm) were purchased from Calbiochem. Human recombinant bFGF and IL-1β were provided by NCI (National Institutes of Health) and Amgen, respectively. Optimal doses were evaluated by dose-dependent experiments for the use of chemical and peptide inhibitors to ensure specific effects on signaling pathways operative in human adult articular chondrocytes. Reverse Transcription and PCR—Reverse transcription (RT) was carried out with 500 ng of total cellular RNA using either real-time or the One-Step RT-PCR System (Invitrogen) following the instructions provided by the manufacturer. For all experiments, optimal conditions were determined by initially generating cycle number-dependent expression curves and the linear range for the PCR amplification. The same amounts of total RNA or genomic DNA were subjected to One-Step RT-PCR simultaneously to minimize experimental variation due to differences in amplification efficiency. The assessment for GAPDH was performed in parallel (18Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 25Mengshol J.A. Kim M.P. Coon C.I. Barchowsky A. Brinckerhoff C.E. Arthritis Rheum. 2000; 43: 801-811Crossref PubMed Scopus (572) Google Scholar). The One-Step RT-PCR was performed using 30 cycles of 95 °C for 30 s, 62 °C for 1 min, and 72 °C for 40 s in the presence of 50 pmol of sense and antisense primers. The primer sequences and the conditions for their use are summarized in Table 1. The resulting PCR products were resolved in 1.5% agarose gels and visualized by staining with ethidium bromide and UV transillumination. Integrated density values for testing genes were normalized relative to GAPDH values to yield a semi-quantitative assessment. For real-time PCR, the primer sets specific to human genes and optimized conditions were used to generate <200-bp coding regions, spanning at least one exon and an intron as we performed previously (18Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar).TABLE 1Primer sequences for semi-quantitative and real-time PCRGenesPrimer sequences (forward/reverse) (5′-3′)SizeAnnealing temperatureReference or accession no.bp°CSemi-quantitative PCR MMP-13GGCTCCGAGAAATGCAGTCTTTCTT3376418Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google ScholarATCAAATGGGTAGAAGTCGCCATGCNM_002427 GAPDHCTGAGAACGGGAAGCTTGTCATCA3185818Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google ScholarAGTTGTCATGGATGACCTTGGCCANM_002046Real-time PCR bFGFGGCTATGAAGGAAGATGGAAGATT13062NM_002006TGCCACATACCAACTGGTGTATTT Elk-1TTGGAGGCCTGTCTGGAGGCTGAA9257NM_005229AGCTCTTCCGATTTCAGGTTTGGG c-FosTAGCCTCTCTTACTACCACTCACC11353NM_006365TGGGAATGAAGTTGGCACTGGAGA GAPDHTCGACAGTCAGCCGCATCTTCTTT1485818Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google ScholarGCCCAATACGACCAAATCCGTTGANM_002046 Open table in a new tab Preparation of Nuclear Extracts—The nuclear extracts were prepared by using the nuclear extraction kit (Panomics) according to the manufacturer's protocol. Following stimulation, culture media was removed, and the cells were then lysed with 1 ml buffer A, incubated on ice for 10 min, and centrifuged at 15,000 × g at 4 °C for 3 min. The supernatants were discarded, and the pellets were resuspended in 150 μl of buffer B. The samples were incubated on ice for 2 h and centrifuged, and the supernatants were aliquoted and stored at -80 °C. Gel Shift Assays (Electrophoretic Mobility Shift Assays)—Gel shift assays of Elk-1 and NFκB were performed by using the commercially available kits (Panomics). Following stimulation, the nuclear extracts (prepared as mentioned above) were incubated with the biotin-labeled double-stranded transcription factor (Elk-1 and NFκB) either consensus sequence or the sequence present in MMP-13 gene. The samples were then resolved on a 6% non-denaturing polyacrylamide gel and transferred to Pall Biodyne B membrane, blocked, and incubated with Streptavidin-horseradish conjugate. The bands were visualized with a chemiluminescence-imaging system. Unlabeled, double-stranded wild-type oligonucleotides were used to determine the binding specificity of the assay. Nuclear Translocalization of Elk-1—Chondrocytes plated at a density of 100,000 in 4-well chamber slides were cultured for 24 h in complete media containing 10% fetal bovine serum. The medium was then changed to serum-free medium for 18 h. Chemical inhibitors were incubated for 1 h prior to treatment with bFGF (100 ng/ml). The treatment was then aborted by washing the cells with 1× PBS three times followed by fixation in 4% paraformaldehyde for 15 min at room temperature. The cells were then washed with 1× PBS and incubated with 0.2% Triton X-100 prepared in PBS for 10 min at room temperature. After permeabilizing the cells with Triton X-100, the cells were washed and blocked with 10% normal goat serum in PBS for 60 min at room temperature. After washing the cells with PBS, the primary antibody prepared in 1% bovine serum albumin made in PBS (1:200 dilution) was then added, and the mixture was incubated overnight at 4 °C. The cells were then washed and incubated with green fluorescent-labeled anti-mouse secondary antibody (prepared in 1% bovine serum albumin-PBS) for 1 h at 4 °C in the dark. The cells were then washed, the slides were prepared using the mounting media containing 4′,6-diamidino-2-phenylindole (Molecular Probes), which can counterstain the nucleus, and visualized using the fluorescent microscope (Nikon Eclipse E600 microscope) connected to a PC running MetaView Imaging Series 6.1. The nuclear image was visualized using a UV filter, whereas the cytoplasmic fluorescence staining was visualized by using a blue filter. Both images were overlaid using MetaView imaging software. Histology—Safranin Orange staining was performed using full thickness cartilage slices prepared from OA knee joint tissues and a 4-mm diameter puncher. These explants were cultured in 1.0 ml of Dulbecco's modified Eagle's medium/F-12 containing 10% fetal bovine serum. Following a 2-day recovery period, the cartilage explants were treated with or without bFGF (100 ng/ml) under serum-free conditions (mini-ITS). Following 14 days of incubation, the slices were fixed with 4% paraformaldehyde for overnight and embedded in paraffin, and 8 μm sections were prepared. The paraffin sections were deparaffinized and stained with Safranin Orange staining to assess matrix proteoglycan loss. Type II Collagen Digestion Assay—75 ml of culture media from each sample to be tested was activated with 1 μm 4-aminophenylmercuric acetate (Sigma, catalog no. A9563) for 1 h at 37 °C in the dark. After activation, 75 ml of 0.5 mg/ml chick sternal type II collagen (Sigma, catalog no. C9301) was added to the activated culture media, and the mixture was vortexed thoroughly followed by placing the mixture of culture media and type II collagen (150 μl) in a heating block for 24 h at 37 °C. The reaction was terminated by the addition of 150 μl of 2× reducing Laemmli sample buffer (Bio-Rad, catalog no. 161-0737), and the samples were then resolved on 8% SDS-PAGE followed by staining with Coomassie Brilliant Blue R-250 for 2 h. The gel was destained with water containing 10% methanol and 10% acetate acid. Statistical Analyses—The statistical significance of results was determined by analysis of variance, using StatView 5.0 software (SAS Institute, Cary, NC). Data interpretation was performed by statistical normalization as assessed with histograms, and a 0.05 significance level was used for all statistical tests. Identification of an Elk-1 Response Element in the Distal Promoter Region of the MMP-13 Gene That Regulates MMP-13 Expression in Human Adult Articular Chondrocytes—Our previous studies suggest that bFGF-mediated up-regulation of MMP-13 occurs via a transcriptional stimulation (18Im H.J. Kim P. Natarajan V. Schmid T.M. Block J.A. Davis F. van Wijnen A.J. Loeser R.F. J. Biol. Chem. 2007; 282: 11110-11121Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). To define elements controlling MMP-13 transcription, MMP-13 promoter-luciferase reporter constructs were transiently transfected into primary human articular chondrocytes. Deletion from -1600 (-1600MMP-13) to -736 (-736MMP-13) upstream of the ATG of the MMP-13 promoter region shows no significant change in the basal promoter activity (Fig. 1A), consistent with our previous report with an immortalized chondrocyte cell line (30Im H.J. Kim C. Chubinskaya S. Van Wijnen A.J. Sun Y. Loeser R.F. J. Biol. Chem. 2003; 278: 25386-25394Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 32Pulai J.I. Kim H. Im H.-J. Kumar S. Hanning C. Hegde P.S. Loeser F.R. J. Immunol. 2005; 174: 5781Crossref PubMed Scopus (168) Google Scholar). Further deletion from -736 to -370 of the MMP-13 promoter (-370MMP-13) significantly reduces basal promoter activity (up to ∼40% reduction). This decreased level of promoter activity is similar to the activity observed for the -186MMP-13 promoter that contains minimal core transcription factor response elements, including motifs for Runx2, ETS, and AP-1. These results suggest that the distal -736 to -370 promoter region of the MMP-13 gene encompasses key elements that regulate MMP-13 promoter activity in human adult articular chondrocytes. Bioinformatic analysis reveals the presence of an Elk-1 recognition motif (" @default.
• W1972783122 created "2016-06-24" @default.
• W1972783122 creator A5008755139 @default.
• W1972783122 creator A5009640354 @default.
• W1972783122 creator A5025989065 @default.
• W1972783122 creator A5037185854 @default.
• W1972783122 creator A5066463438 @default.
• W1972783122 date "2007-10-01" @default.
• W1972783122 modified "2023-10-18" @default.
• W1972783122 title "Basic Fibroblast Growth Factor Activates the MAPK and NFκB Pathways That Converge on Elk-1 to Control Production of Matrix Metalloproteinase-13 by Human Adult Articular Chondrocytes" @default.
• W1972783122 cites W1494401713 @default.
• W1972783122 cites W1539871462 @default.
• W1972783122 cites W1586814698 @default.
• W1972783122 cites W1755902553 @default.
• W1972783122 cites W1774678646 @default.
• W1972783122 cites W1964429103 @default.
• W1972783122 cites W1970267055 @default.
• W1972783122 cites W1974209694 @default.
• W1972783122 cites W1979972616 @default.
• W1972783122 cites W1984350356 @default.
• W1972783122 cites W1986409534 @default.
• W1972783122 cites W1991545343 @default.
• W1972783122 cites W1992735807 @default.
• W1972783122 cites W1997075903 @default.
• W1972783122 cites W2002282120 @default.
• W1972783122 cites W2009129803 @default.
• W1972783122 cites W2016291234 @default.
• W1972783122 cites W2017045877 @default.
• W1972783122 cites W2020558284 @default.
• W1972783122 cites W2024973490 @default.
• W1972783122 cites W2033701197 @default.
• W1972783122 cites W2040780377 @default.
• W1972783122 cites W2042771683 @default.
• W1972783122 cites W2045392251 @default.
• W1972783122 cites W2062084226 @default.
• W1972783122 cites W2063147214 @default.
• W1972783122 cites W2069145276 @default.
• W1972783122 cites W2070267630 @default.
• W1972783122 cites W2070523769 @default.
• W1972783122 cites W2084116082 @default.
• W1972783122 cites W2094871351 @default.
• W1972783122 cites W2095512005 @default.
• W1972783122 cites W2106792841 @default.
• W1972783122 cites W2107487363 @default.
• W1972783122 cites W2138706690 @default.
• W1972783122 cites W2170539704 @default.
• W1972783122 doi "https://doi.org/10.1074/jbc.m706508200" @default.
• W1972783122 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17724016" @default.
• W1972783122 hasPublicationYear "2007" @default.
• W1972783122 type Work @default.
• W1972783122 sameAs 1972783122 @default.
• W1972783122 citedByCount "94" @default.
• W1972783122 countsByYear W19727831222012 @default.
• W1972783122 countsByYear W19727831222013 @default.
• W1972783122 countsByYear W19727831222014 @default.
• W1972783122 countsByYear W19727831222015 @default.
• W1972783122 countsByYear W19727831222016 @default.
• W1972783122 countsByYear W19727831222017 @default.
• W1972783122 countsByYear W19727831222018 @default.
• W1972783122 countsByYear W19727831222019 @default.
• W1972783122 countsByYear W19727831222020 @default.
• W1972783122 countsByYear W19727831222021 @default.
• W1972783122 countsByYear W19727831222022 @default.
• W1972783122 countsByYear W19727831222023 @default.
• W1972783122 crossrefType "journal-article" @default.
• W1972783122 hasAuthorship W1972783122A5008755139 @default.
• W1972783122 hasAuthorship W1972783122A5009640354 @default.
• W1972783122 hasAuthorship W1972783122A5025989065 @default.
• W1972783122 hasAuthorship W1972783122A5037185854 @default.
• W1972783122 hasAuthorship W1972783122A5066463438 @default.
• W1972783122 hasBestOaLocation W19727831221 @default.
• W1972783122 hasConcept C106487976 @default.
• W1972783122 hasConcept C109523444 @default.
• W1972783122 hasConcept C170493617 @default.
• W1972783122 hasConcept C185592680 @default.
• W1972783122 hasConcept C202751555 @default.
• W1972783122 hasConcept C2775960820 @default.
• W1972783122 hasConcept C2777587049 @default.
• W1972783122 hasConcept C2777730290 @default.
• W1972783122 hasConcept C2780381497 @default.
• W1972783122 hasConcept C43617362 @default.
• W1972783122 hasConcept C55493867 @default.
• W1972783122 hasConcept C55728118 @default.
• W1972783122 hasConcept C57074206 @default.
• W1972783122 hasConcept C62478195 @default.
• W1972783122 hasConcept C74373430 @default.
• W1972783122 hasConcept C86803240 @default.
• W1972783122 hasConcept C95444343 @default.
• W1972783122 hasConceptScore W1972783122C106487976 @default.
• W1972783122 hasConceptScore W1972783122C109523444 @default.
• W1972783122 hasConceptScore W1972783122C170493617 @default.
• W1972783122 hasConceptScore W1972783122C185592680 @default.
• W1972783122 hasConceptScore W1972783122C202751555 @default.
• W1972783122 hasConceptScore W1972783122C2775960820 @default.
• W1972783122 hasConceptScore W1972783122C2777587049 @default.
• W1972783122 hasConceptScore W1972783122C2777730290 @default.
• W1972783122 hasConceptScore W1972783122C2780381497 @default.
• W1972783122 hasConceptScore W1972783122C43617362 @default.

• next