FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1973582506> ?p ?o ?g. }

• W1973582506 endingPage "1553" @default.
• W1973582506 startingPage "1552" @default.
• W1973582506 abstract "cationic amino acid transporter normal human epidermal keratinocyte human dermal microvascular endothelial cell To the Editor: We read with great interest the article “The importance of cationic amino acid transporter expression in human skin” by Schnorr et al (J Invest Dermatol 120:1016–1022, 2003) and would like to make some comments of interest. To date, four transport systems for cationic amino acids in animal cells have been described and characterized (Deves and Boyd, 1998Deves R. Boyd C.A.R. Transporters of cationic amino acids in animal cells: Discovery, structure, and function.Physiol Rev. 1998; 78: 487-545Crossref PubMed Scopus (424) Google Scholar). The functionally most important transport system is probably the y+ system, which selectively and stereospecifically transports L-arginine, L-lysine, and L-ornithine (Christensen and Antonioli, 1969). It is represented by the family of cationic amino acid transporter (CAT) proteins, which are coded in humans by at least four genes (CAT1-CAT4) (Palacin et al., 1998Palacin M. Estevez R. Bertran J. Zorzano A. Molecular biology of mammalian plasma membrane amino acid transports.Physiol Rev. 1998; 78: 969-1054Crossref PubMed Scopus (690) Google Scholar;Sperandeo et al., 1998Sperandeo M.P. Borsani G. Incerti B. et al.The gene encoding a cationic amino acid transporter (SLC7A4) maps to the region deleted in the velocardiofacial syndrome.Genomics. 1998; 49: 230-236Crossref PubMed Scopus (39) Google Scholar;Vekony et al., 2001Vekony N. Wolf S. Boissel J.P. Gnauert K. Closs E.I. Human cationic amino acid transporter hCAT-3 is preferentially expressed in peripheral tissue.Biochem. 2001; 40: 12387-12394Crossref PubMed Scopus (68) Google Scholar). The CAT2 gene has a special characteristic: it codes for two splice variants CAT2A and CAT2B differing in a stretch of only 42 amino acids (Closs et al., 1993Closs E.I. Lyons C.R. Kelly C. Cunningham J.M. Characterization of the third member of the MCAT family of cationic amino acid transporters. Identification of a domain that determines the transport properties of the MCAT proteins.J Biol Chem. 1993; 268: 20796-20800Abstract Full Text PDF PubMed Google Scholar). An indication of the existence of CAT pro-teins in keratinocytes too has been provided by the finding that an increase in arginase activity and urea synthesis was dependent on extracellular L-arginine but not D-arginine (Wohlrab et al., 2002Wohlrab J. Siemens C. Marsch W.C. The influence of L-arginine on the regulation of epidermal arginase.Skin Pharmacol Appl Skin Physiol. 2002; 15: 44-54Crossref PubMed Scopus (14) Google Scholar). Schnorr et al., 2003Schnorr O. Suschek C.V. Kolb-Bachofen V. The importance of cationic amino acid transporter expression in human skin.J Invest Dermatol. 2003; 120: 1016-1022Crossref PubMed Scopus (25) Google Scholar demonstrate the CAT system in keratinocytes (NHEK), dermal endothelial cells (HDMEC), HaCaT cells, and fibroblasts on the mRNA level using semiquantitative RT-PCR. In NHEK and HDMEC, both CAT1 and CAT2 were constitutively expressed, whereas fibroblasts and HaCaT cells constitutively possessed CAT1 only. Although CAT2 as an inducible isoform and CAT2A as constitutively expressed in hepatocytes and muscle cells are mentioned in the introduction, the presentation does not consider the differentiation between CAT2A and CAT2B, but refers solely to CAT2. Due to the primer used for CAT2, it is actually not possible to distinguish between CAT2A and CAT2B mRNA. The authors give constitutive expression levels of CAT1 and CAT2 within a comparable order of magnitude. For quantitative comparisons, however, more reliable results should be obtained using real-time PCR. Applying this method, we found CAT1, CAT2B, and CAT4 to be constitutively expressed in NHEK, HDMEC, and HaCaT cells (Figure 1), whereas CAT3 mRNA could not be detected at all (data not shown). In respect of the expression level, it could be shown that CAT1 mRNA was 10- to 100-fold more strongly expressed than CAT2B or CAT4. In line withSchnorr et al., 2003Schnorr O. Suschek C.V. Kolb-Bachofen V. The importance of cationic amino acid transporter expression in human skin.J Invest Dermatol. 2003; 120: 1016-1022Crossref PubMed Scopus (25) Google Scholar, HaCaT cells possessed the highest level of CAT1. In addition, it should be noticed that CAT2B mRNA in HDMEC and CAT4 mRNA in NHEK were detectable at clearly higher levels than in the respective other cell lines (Figure 1). Using real-time PCR again, we found a statistically significant increase in CAT1 in HDMEC after cytokine challenge for 24 h, whereas no change was stated bySchnorr et al., 2003Schnorr O. Suschek C.V. Kolb-Bachofen V. The importance of cationic amino acid transporter expression in human skin.J Invest Dermatol. 2003; 120: 1016-1022Crossref PubMed Scopus (25) Google Scholar. For NHEK, the increase in CAT2B induced by the cytokine cocktail was consistent with the increase in CAT2 reported bySchnorr et al., 2003Schnorr O. Suschek C.V. Kolb-Bachofen V. The importance of cationic amino acid transporter expression in human skin.J Invest Dermatol. 2003; 120: 1016-1022Crossref PubMed Scopus (25) Google Scholar. For HDMEC, however, our result differs by a factor of 7.5 (30-fold increase) (Figure 2) compared toSchnorr et al., 2003Schnorr O. Suschek C.V. Kolb-Bachofen V. The importance of cationic amino acid transporter expression in human skin.J Invest Dermatol. 2003; 120: 1016-1022Crossref PubMed Scopus (25) Google Scholar (4-fold increase), but this might be attributed to the use of different primers leading exclusively to the amplification of the isoform CAT2B in our experiments. To quantify the PCR products we used the following real-time PCR method. The cells (NHEK, HDMEC, HaCaT cells) were incubated with a cytokine cocktail as indicated in Figure 2 or were left untreated as a control. RNA was isolated and transcribed to cDNA. In addition, a standard of each CAT product was produced via in vitro transcription and run in defined concentrations in each PCR. The products obtained from the individual samples were then calculated in relation to the respective standard. The PCR was performed on a Rotor-Gene 2000 (Corbett Research, Sydney) and was assessed using the appropriate software provided by the manufacturer. Primers (Metabion, Martinsried, Germany) and PCR conditions are listed in Table I.Table IGenBank accession numbers and sequences of primers usedProduct/GenBank accession no.StrandSequenceFragment sizeHuman CAT1/NM–003045Sense5′GATTTAGGTGACACTATAGAATACATCTGCTTCATCGCCTACTT′3228 bpAnti-sense5′TAGCAGTCCATCCTCAGCCATG′3Human CAT2B/U76369Sense5′GATTTAGGTGACACTATAGAATACCCCAATGCCTCGTGTAATCT-′3120 bpAnti-sense5′TGCCACTGCACCCGATGATAAAGT-′3Human CAT4/AJ000730Sense5′GATTTAGGTGACACTATAGAATACATGGTGGGCTCGGGTCTCTA′3303 bpAnti-sense5′TGCGGATGCTGTGGCTGAAC′3Cycle protocol: 95°C 5 min; cycle 1 (eight replicates) 95°C 15 s, 64°C 30 s, 72°C 30 s, 80°C 10 s; cycle 2 (30 replicates) 95°C 20 s, 55°C 30 s, 72°C 30 s, 80°C 15 s; 40°C 30 s.Measurement of the amplificates obtained was made via the intercalated substance SybGreen every 7 s. Open table in a new tab Cycle protocol: 95°C 5 min; cycle 1 (eight replicates) 95°C 15 s, 64°C 30 s, 72°C 30 s, 80°C 10 s; cycle 2 (30 replicates) 95°C 20 s, 55°C 30 s, 72°C 30 s, 80°C 15 s; 40°C 30 s. Measurement of the amplificates obtained was made via the intercalated substance SybGreen every 7 s. In summary, our aim is to contribute some additional data and to point out the splice variants of CAT2, which should be more strongly considered in future studies on CAT expression." @default.
• W1973582506 created "2016-06-24" @default.
• W1973582506 creator A5017046198 @default.
• W1973582506 creator A5035169110 @default.
• W1973582506 creator A5051450645 @default.
• W1973582506 creator A5081781073 @default.
• W1973582506 date "2003-12-01" @default.
• W1973582506 modified "2023-09-26" @default.
• W1973582506 title "The Importance of Cationic Amino Acid Transporter Expression in Human Skin" @default.
• W1973582506 cites W1524832496 @default.
• W1973582506 cites W1575097947 @default.
• W1973582506 cites W1927805387 @default.
• W1973582506 cites W1981140849 @default.
• W1973582506 cites W1994554366 @default.
• W1973582506 cites W2009259569 @default.
• W1973582506 cites W2013362164 @default.
• W1973582506 cites W2145806440 @default.
• W1973582506 doi "https://doi.org/10.1046/j.1523-1747.2003.12646.x" @default.
• W1973582506 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14675209" @default.
• W1973582506 hasPublicationYear "2003" @default.
• W1973582506 type Work @default.
• W1973582506 sameAs 1973582506 @default.
• W1973582506 citedByCount "3" @default.
• W1973582506 crossrefType "journal-article" @default.
• W1973582506 hasAuthorship W1973582506A5017046198 @default.
• W1973582506 hasAuthorship W1973582506A5035169110 @default.
• W1973582506 hasAuthorship W1973582506A5051450645 @default.
• W1973582506 hasAuthorship W1973582506A5081781073 @default.
• W1973582506 hasBestOaLocation W19735825061 @default.
• W1973582506 hasConcept C104317684 @default.
• W1973582506 hasConcept C149011108 @default.
• W1973582506 hasConcept C178790620 @default.
• W1973582506 hasConcept C183882617 @default.
• W1973582506 hasConcept C185592680 @default.
• W1973582506 hasConcept C199360897 @default.
• W1973582506 hasConcept C2777459323 @default.
• W1973582506 hasConcept C2781313199 @default.
• W1973582506 hasConcept C41008148 @default.
• W1973582506 hasConcept C515207424 @default.
• W1973582506 hasConcept C54355233 @default.
• W1973582506 hasConcept C55493867 @default.
• W1973582506 hasConcept C86803240 @default.
• W1973582506 hasConcept C90559484 @default.
• W1973582506 hasConceptScore W1973582506C104317684 @default.
• W1973582506 hasConceptScore W1973582506C149011108 @default.
• W1973582506 hasConceptScore W1973582506C178790620 @default.
• W1973582506 hasConceptScore W1973582506C183882617 @default.
• W1973582506 hasConceptScore W1973582506C185592680 @default.
• W1973582506 hasConceptScore W1973582506C199360897 @default.
• W1973582506 hasConceptScore W1973582506C2777459323 @default.
• W1973582506 hasConceptScore W1973582506C2781313199 @default.
• W1973582506 hasConceptScore W1973582506C41008148 @default.
• W1973582506 hasConceptScore W1973582506C515207424 @default.
• W1973582506 hasConceptScore W1973582506C54355233 @default.
• W1973582506 hasConceptScore W1973582506C55493867 @default.
• W1973582506 hasConceptScore W1973582506C86803240 @default.
• W1973582506 hasConceptScore W1973582506C90559484 @default.
• W1973582506 hasIssue "6" @default.
• W1973582506 hasLocation W19735825061 @default.
• W1973582506 hasLocation W19735825062 @default.
• W1973582506 hasOpenAccess W1973582506 @default.
• W1973582506 hasPrimaryLocation W19735825061 @default.
• W1973582506 hasRelatedWork W1964503720 @default.
• W1973582506 hasRelatedWork W1973582506 @default.
• W1973582506 hasRelatedWork W1974467523 @default.
• W1973582506 hasRelatedWork W2122930447 @default.
• W1973582506 hasRelatedWork W2167048413 @default.
• W1973582506 hasRelatedWork W2399713826 @default.
• W1973582506 hasRelatedWork W2774400393 @default.
• W1973582506 hasRelatedWork W2956146669 @default.
• W1973582506 hasRelatedWork W3125458157 @default.
• W1973582506 hasRelatedWork W3140101239 @default.
• W1973582506 hasVolume "121" @default.
• W1973582506 isParatext "false" @default.
• W1973582506 isRetracted "false" @default.
• W1973582506 magId "1973582506" @default.
• W1973582506 workType "article" @default.