FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1973951124> ?p ?o ?g. }

• W1973951124 endingPage "24657" @default.
• W1973951124 startingPage "24651" @default.
• W1973951124 abstract "The phosphatidylinositol-specific phospholipase C from Bacillus thuringiensis can be activated by nonsubstrate interfaces such as phosphatidylcholine micelles or bilayers. This activation corresponds with partial insertion into the interface of two tryptophans, Trp-47 in helix B and Trp-242 in a loop, in the rim of the αβ-barrel. Both W47A and W242A have much weaker binding to interfaces and considerably lower kinetic interfacial activation. Tryptophan rescue mutagenesis, reinsertion of a tryptophan at a different place in helix B in the W47A mutant or in the loop (residues 232–244) of the W242A mutant, has been used to determine the importance and orientation of a tryptophan in these two structural features. Phosphotransferase and phosphodiesterase assays, and binding to phosphatidylcholine vesicles were used to assess both orientation and position of tryptophans needed for interfacial activity. Of the helix B double mutants, only one mutant, I43W/W47A, has tryptophan in the same orientation as Trp-47. I43W/W47A shows recovery of phosphatidylinositol-specific phospholipase C (PC) activation of d-myo-inositol 1,2-cyclic phosphate hydrolysis. However, the specific activity toward phosphatidylinositol is still lower than wild type enzyme and high activity with phosphatidylinositol solubilized in 30% isopropyl alcohol (a hallmark of the native enzyme) is lost. Reinserting a tryptophan at several positions in the loop composed of residues 232–244 partially recovers PC activation and affinity of the enzyme for lipid interfaces as well as activation by isopropyl alcohol. G238W/W242A shows an enhanced activation and affinity for PC interfaces above that of wild type. These results provide constraints on how this bacterial phosphatidylinositol-specific phospholipase C binds to activating PC interfaces. The phosphatidylinositol-specific phospholipase C from Bacillus thuringiensis can be activated by nonsubstrate interfaces such as phosphatidylcholine micelles or bilayers. This activation corresponds with partial insertion into the interface of two tryptophans, Trp-47 in helix B and Trp-242 in a loop, in the rim of the αβ-barrel. Both W47A and W242A have much weaker binding to interfaces and considerably lower kinetic interfacial activation. Tryptophan rescue mutagenesis, reinsertion of a tryptophan at a different place in helix B in the W47A mutant or in the loop (residues 232–244) of the W242A mutant, has been used to determine the importance and orientation of a tryptophan in these two structural features. Phosphotransferase and phosphodiesterase assays, and binding to phosphatidylcholine vesicles were used to assess both orientation and position of tryptophans needed for interfacial activity. Of the helix B double mutants, only one mutant, I43W/W47A, has tryptophan in the same orientation as Trp-47. I43W/W47A shows recovery of phosphatidylinositol-specific phospholipase C (PC) activation of d-myo-inositol 1,2-cyclic phosphate hydrolysis. However, the specific activity toward phosphatidylinositol is still lower than wild type enzyme and high activity with phosphatidylinositol solubilized in 30% isopropyl alcohol (a hallmark of the native enzyme) is lost. Reinserting a tryptophan at several positions in the loop composed of residues 232–244 partially recovers PC activation and affinity of the enzyme for lipid interfaces as well as activation by isopropyl alcohol. G238W/W242A shows an enhanced activation and affinity for PC interfaces above that of wild type. These results provide constraints on how this bacterial phosphatidylinositol-specific phospholipase C binds to activating PC interfaces. Phosphatidylinositol-specific phospholipase C (PI-PLC), 1The abbreviations used are: PI-PLC, phosphatidylinositol-specific phospholipase C; WT, wild type PI-PLC; PI, phosphatidylinositol; cIP, d-myo-inositol 1,2-cyclic phosphate; I-1-P, d-myo-inositol-1-phosphate; CMC, critical micelle concentration; PC, phosphatidylcholine; diCnPC, 1,2-diacylphosphatidylcholine with n carbons in each acyl chain; POPC, 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine; iPrOH, isopropyl alcohol; SUVs, small unilamellar vesicles. an enzyme with a critical role in membrane-associated signal transduction, carries out PI cleavage by an intramolecular phosphotransferase step that cleaves PI to cIP followed by a cyclic phosphodiesterase step that converts cIP to I-1-P (1Griffith O.H. Ryan M. Biochim. Biophys. Acta. 1999; 1441: 237-254Google Scholar, 2Williams R.L. Biochim. Biophys. Acta. 1999; 1441: 255-267Google Scholar). Bacterial PI-PLC enzymes, which are secreted by the bacterium, have a simpler structure than the complex multidomain mammalian enzymes. Whereas bacterial PI-PLC enzymes do not have a role in signaling in the bacterium, they can be critical for infection of other cells (3Wadsworth S.J. Goldfine H. Infect. Immun. 2002; 70: 4650-4660Google Scholar). The PI-PLC enzymes from Bacillus cereus and Listeria monocytogenes are composed of a distorted (βα)6 barrel that is structurally very similar to the catalytic domain of PLCδ1 (4Heinz D.W. Ryan M. Bullock T.L. Griffith O.H. EMBO J. 1995; 14: 3855-3863Google Scholar, 5Essen L.O. Perisic O. Cheung R. Katan M. Williams R.L. Nature. 1996; 380: 581-583Google Scholar, 6Heinz D.W. Essen L O. Williams R.L. J. Mol. Biol. 1998; 275: 635-650Google Scholar, 7Volwerk J.J. Shashidhar M.S. Luppe A. Griffith O.H. Biochemistry. 1990; 29: 8056-8062Google Scholar). Interfacial binding of both bacterial and mammalian enzymes to phospholipid interfaces, which was shown to be linked to the kinetic activity of PI-PLC in both steps in the reaction (8Lewis K.A. Garigapati V.R. Zhou C. Roberts M.F. Biochemistry. 1993; 32: 8836-8841Google Scholar, 9Zhou C. Wu Y. Roberts M.F. Biochemistry. 1997; 36: 347-355Google Scholar, 10Hendrickson H.S. Hendrickson E.K. Johnson J.L. Khan T.H. Chial H.J. Biochemistry. 1992; 31: 12169-12172Google Scholar, 11Volwerk J.J. Filthuth E. Griffith O.H. Jain M.K. Biochemistry. 1994; 33: 3464-3474Google Scholar, 12Wu Y. Perisic O. Williams R.L. Katan M. Roberts M.F. Biochemistry. 1997; 36: 11223-11233Google Scholar, 13Qian X. Zhou C. Roberts M.F. Biochemistry. 1998; 37: 6513-6522Google Scholar, 14Zhou C. Horstman D. Carpenter G. Roberts M.F. J. Biol. Chem. 1999; 274: 2783-2786Google Scholar, 15Ellis M.V. James S.R. Perisic O. Downes C.P. Williams R.L. Katan M. J. Biol. Chem. 1998; 273: 11650-11659Google Scholar), was suggested to involve parts of the rim of the barrel. A good candidate for the interfacial binding site is provided by an unusual clustering of hydrophobic residues (and relative lack of charged residues) in the rim of the bacterial enzyme as well as in a ridge at the top of the barrel of PLCδ1 (15Ellis M.V. James S.R. Perisic O. Downes C.P. Williams R.L. Katan M. J. Biol. Chem. 1998; 273: 11650-11659Google Scholar). The simpler structure of the bacterial enzyme makes it an excellent system for exploring the importance of hydrophobic rim residues for both interfacial binding and catalytic activity. Previously, we showed that two tryptophan residues, Trp-47 in helix B and Trp-242 in Bacillus thuringiensis PI-PLC) in a 13-member loop (232FTSLSSGGTAWNS244), play major roles in binding to PC surfaces and interfacial activation by that nonsubstrate phospholipid (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar). The large hydrophobic side chain of tryptophan has the largest free energy for partitioning into PC membranes as measured by the Wimley and White hydrophobicity scale (17Wimley W.C. White S.H. Nat. Struct. Biol. 1996; 3: 842-848Google Scholar), and mutants that replace these bulky groups are predicted to have dramatically reduced affinities for surfaces. This was observed for W47A and W242A mutants binding to PC interfaces (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar). In the present work, we have investigated the effects of orientation and position of tryptophan residues in helix B and the 232–244 loop on PI-PLC activity. If other factors as well as membrane insertion affect binding and interfacial activation of PI-PLC, replacement of different residues in the rim could alter PI-PLC kinetics and membrane binding. With this in mind, we prepared the following mutant PI-PLCs:doublemutants, I43W/W47A, Q45W/W47A, G48W/W47A, M49W/W47A, S236W/W242A, G238W/W242A, and N243W/W242A, as well as a mutant with three tryptophan residues in the rim, G238W. These were characterized for kinetic activation of PI and cIP hydrolysis by diC7PC (9Zhou C. Wu Y. Roberts M.F. Biochemistry. 1997; 36: 347-355Google Scholar, 13Qian X. Zhou C. Roberts M.F. Biochemistry. 1998; 37: 6513-6522Google Scholar, 16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar) and the water-miscible organic solvent isopropyl alcohol (18Wu Y. Roberts M.F. Biochemistry. 1997; 36: 8514-8521Google Scholar, 19Wehbi H. Feng J. Roberts M.F. Biochim. Biophys. Acta. 2003; (in press)Google Scholar), the ability to bind to PC interfaces (comparing both intrinsic fluorescence in the presence of PC micelles and a vesicle filtration assay), 2H. Wehbi, J. Feng, J. Kohlbeck, B. Ananthanarayanan, W. Cho, and M. F. Roberts, submitted for publication. and any changes in secondary structure (analyzed by CD spectroscopy). Results indicate that the orientation of the tryptophan in helix B is very critical for interfacial binding and kinetic activation by both PC and iPrOH. There are fewer constraints on the position of tryptophan in the rim loop. In fact, replacing Gly-238 with tryptophan in W242A improves the vesicle binding ability of PI-PLC and enhances cleavage of PI solubilized in diC7PC above that of native PI-PLC. Having three tryptophans in the rim does not dramatically enhance vesicle binding or the enzyme-specific activity indicating that only two tryptophans (one in helix B and another in the 232–244 loop) are inserting into PC membranes. The ability to uncouple PC activation from water-miscible solvent activation of the enzyme for many of these mutants strongly suggests that the two methods of activation occur by different pathways. Chemicals—POPC, diC6PC, diC7PC, and PI were purchased from Avanti; crude PI for preparing cIP was purchased from Sigma. cIP was prepared from PI as described previously (9Zhou C. Wu Y. Roberts M.F. Biochemistry. 1997; 36: 347-355Google Scholar). myo-Inositol, Triton X-100, and iPrOH was purchased from Sigma. All other chemicals were reagent-grade. Overexpression of Bacterial PI-PLC and Construction of Mutants—A plasmid containing the Bacillus thuringiensis PI-PLC gene obtained from Dr. Ming-Daw Tsai (Ohio State University) was transformed into E. coli BL21 cells (BL21-Codonplus (DE3)-RIL from Stratagene). Overexpression and purification of the recombinant protein and tryptophan mutants W47A and W242A have been described previously (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar). Protein solutions were concentrated using Millipore Centraplus 10 filters; concentrations were estimated by both A280 (and the calculated extinction coefficient) and by Lowry assays. All of the mutations of the PI-PLC gene were carried out by QuikChange methodology (21Wang W. Malcolm B.A. BioTechniques. 1999; 26: 680-682Google Scholar, 22Zhong L. Johnson W.C. Biochemistry. 1994; 33: 2121-2128Google Scholar) using a site-directed mutagenesis kit from Stratagene. Two complementary mutagenic primers (all purchased from Operon) purified by high pressure liquid chromatography and containing the desired mutation were annealed to the same sequence on opposite strands of the plasmid. The primer CAAGCTTGTCTTCTTGGGGTACAGCAGCG and its complement were used for construction of G238W using the WT PI-PLC gene. Construction of the double mutants started with W47A or W242A single mutants (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar). The primers for I43W, Q45W, G48W, and M49W introduction into W47A were CAAGTTGCAAAATCCGTGGAAGCAAGTGGCGGG, GCAAAATCCGATTAAGTGGGTGGCGGGAATGACG, GCAAGTGGCGGGATGGACGCAAGAATATG, and GATTAAGCAAGTGGCGTGGATGACGCAAGAATATG and the complement to each. The primers for N243W, G238W, and S236W were GGTGGTACAGCAGCGTGGAGTCCATATTACTACG, CAAGCTTGTCTTCTTGGGGTACAGCAGCG, and CTATATATTAATTTTACAAGCTTGTGGTCTGGTGGTACAGCAGCG (along with each complement). All mutations were confirmed by DNA sequencing carried out by the Beth Israel Deaconess Medical Center Sequencing facility. CD Spectroscopy—WT and mutant PI-PLC secondary structure and thermal stability as monitored by the thermal denaturation transition (Tm) were measured using an AVIV 202 spectrophotometer equipped with a thermoelectric sample temperature controller. For Tm measurements, the ellipticity at 222 nm of protein samples (0.03–0.04 mg/ml in 10 mm borate buffer in a 1-cm cell) was monitored as the temperature was increased from 25 to 80 °C in 1 °C steps with an equilibration time of 1 or 2 min. Comparison of secondary structure for WT and mutant PI-PLC used wavelength scans from 300 to 195 nm with protein (0.2–0.3 mg/ml) in a 0.1-cm cell at 25 °C. Secondary structure content was estimated with CDNN (23Bohm G. Muhr R. Jaenicke R. Protein Eng. 1992; 5: 191-195Google Scholar, 24Andrade M.A. Chacon P. Merelo J.J. Moran F. Protein Eng. 1993; 6: 383-390Google Scholar). Fluorescence Spectroscopy—All fluorescence measurements, obtained with a Shimadzu RF5000U spectrofluorometer, were carried out at 25 °C with ∼2 μm protein in 50 mm HEPES, pH 7.5, with 1 mm EDTA, using an excitation wavelength of 290 and 5 nm excitation and emission slit widths. The wavelength maximum for PI-PLC fluorescence, 337 nm, was unaltered for WT and tryptophan mutants both in the absence and presence of ligands. There was no detectable light scattering for any of the protein samples with PC micelles added. Changes in the fluorescence intensity at 337 nm were expressed as (I–I0)/I0, where I0 is the intensity of protein alone, and I is the intensity in the presence of an additive. Kinetic Analysis of PI-PLC Mutants—PI-PLC activity was assayed by two methods. (i) For long chain PI as substrate, 200-μl aliquots were removed from the reaction mixture (typically 8 mm PI dispersed in 32 mm diC7PC or 30% iPrOH in 50 mm Tris, pH 7) at defined intervals and extracted with 200 μl of CHCl3 (this also stops the reaction). The content of cIP and I-1-P in the water-soluble phase was determined by 31P NMR (202.3 MHz) spectroscopy as described previously (9Zhou C. Wu Y. Roberts M.F. Biochemistry. 1997; 36: 347-355Google Scholar, 12Wu Y. Perisic O. Williams R.L. Katan M. Roberts M.F. Biochemistry. 1997; 36: 11223-11233Google Scholar) using a Varian INOVA 500 spectrometer. (ii) For cIP as the substrate, the hydrolysis as monitored by 31P NMR spectroscopy quantified the decrease of substrate and increase in product (I-1-P) resonance intensities as a function of incubation time (9Zhou C. Wu Y. Roberts M.F. Biochemistry. 1997; 36: 347-355Google Scholar, 25Zhou C. Roberts M.F. Biochemistry. 1998; 37: 16430-16439Google Scholar). The amount of protein added was adjusted so that no more than 20% substrate hydrolysis occurred in 2 h. Assays to check for activation by PC typically used 5 mm cIP in the absence or presence of 5 mm diC7PC to probe for PC activation. Samples were usually assayed in duplicate (and often in triplicate); errors in specific activities based on duplicate or triplicate samples were <10%. PC Vesicle Binding Studies—SDS-PAGE (12% polyacrylamide) was used to quantify free PI-PLC separated (via centrifugation/filtration) from PI-PLC bound to POPC vesicles.2 A stock of small unilamellar POPC vesicles (5 mm) with an average diameter ∼300 Å (as estimated by light scattering using a Malvern particle sizer) was prepared by sonication in 10 mm Tris, pH 7.5. Vesicle samples were incubated with 0.03 mg/ml protein in 10 mm Tris, pH 7.5. The bulk POPC concentration was 0, 0.01, 0.02, 0.05, 0.1, and 0.2 mm for WT PI-PLC and G238W and 0, 0.02, 0.05, 0.10, 0.15, and 0.2 mm for all double mutants. In the POPC binding assay with W47A/W242A, the bulk POPC concentration was increased to 2 mm. After incubation for 15 min, the samples were centrifuged to separate free protein from vesicle-bound protein (which was retained on the membrane). The eluant was collected and lyophilized overnight and analyzed by SDS-PAGE. Coomassie Blue-stained gels were imaged and the PI-PLC intensities monitored. Comparison of band intensities to a sample carried through the filtration and centrifugation but without POPC vesicles was used to measure the fraction of free enzyme (ET/ET, where ET is the total amount of enzyme). The fraction of enzyme bound, Eb/ET, was then evaluated as (1–Ef /ET). The apparent dissociation constant (KD), which in this case represents the partitioning of the enzyme to the interface, was calculated with equation Eb/ET = [POPC]/(KD + [POPC]). This value is equivalent to (nKD) estimated with a Langmuir adsorption isotherm treatment of the protein binding with a dissociation constant KD to a site composed of n phospholipids (26Cho W. Bittova L. Stahelin R.V. Anal. Biochem. 2001; 296: 153-161Google Scholar, 27Stieglitz K. Seaton B. Roberts M.F. J. Biol. Chem. 1999; 274: 35367-35374Google Scholar). The error in estimating the apparent dissociation constant for PC SUVs, KD, was <15%. Strategy for Tryptophan Rescue Mutants, Secondary Structure, and Thermostability—The active site of PI-PLC is located at the C-terminal side (as determined by strand orientation) of the distorted (βα)6-barrel. Helix B and loop 232–244 are at the mouth of the barrel (Fig. 1). The distance between Cα of Trp-47 to Cα of Trp-242 is 10.5 Å. These residues are both quite far from the active site, a measure of this is the distance between the Cα atoms of the two rim tryptophans and the Cα of Trp-178, a residue at the bottom of the active site that forms a hydrogen bond with a residue critical for substrate binding (Asp-198). Trp-47 is 22.9 Å and Trp-242 is 28.8 Å from the Trp-178 Cα. Because W47A and W242A exhibited impaired interfacial activation by PC and reduced affinities for PC surfaces, a series of tryptophan rescue double mutants was prepared to explore where a tryptophan could be reintroduced to restore enzymatic activity and activation by PC surfaces. Helix B has only two turns with Trp-47 at the C-terminal end of this short helix (Fig. 2A). Gln-45 is on the same turn as Trp-47 but with an orientation on the opposite face of the helix. Ile-43 is in the first turn of helix B and has the same orientation as Trp-47 but is displaced along the helix. Gly-48 and Met-49 residues follow Trp-47 but are not part of the short helix. Starting with W47A, each of these residues was replaced by tryptophan to test the importance of tryptophan placement in helix B for optimal catalysis and PC binding.Fig. 2A, orientation of Trp at different positions in helix B mutants. B, orientation of Trp at different positions in the 232–244 loop. These place the Trp in the orientation of the side chain that was replaced and do not represent energy-minimized conformations since most of these two structural features are fully exposed to solvent and hence very flexible in the absence of surfaces.View Large Image Figure ViewerDownload (PPT) The 232–244 loop appears to be very flexible in the crystal structure, although replacement of Trp-242 by alanine profoundly effects PI cleavage and binding to PC vesicles (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar). Because replacement of the tryptophan by phenylalanine or isoleucine rescued PI cleavage rates, insertion of a tryptophan at many positions in the loop could lead to WT behavior. With this in mind, we chose Ser-236, Gly-238, and Asn-243 as target positions to introduce tryptophan into the W242A protein (Fig. 2B). Asparagine and serine are uncharged polar residues; Asn-243 is adjacent to Trp-242, and Ser-236 is 6 residues away. Gly-238 is in the middle of the loop and might contribute significantly to loop flexibility. Therefore, mutation of glycine to tryptophan should alter the loop flexibility as well as significantly increase protein hydrophobicity, both properties of the local structure that could be relevant to PI-PLC interfacial activity. CD spectra of WT and mutant PI-PLC proteins were acquired and used to check for overall structural elements. A large change might not be expected in either secondary structure or stability, since helix B and loop 232–244 had weaker density in the crystal structure and were assumed to be flexible (4Heinz D.W. Ryan M. Bullock T.L. Griffith O.H. EMBO J. 1995; 14: 3855-3863Google Scholar). Estimates of WT secondary structure calculated from the CD wavelength spectra by CDNN (23Bohm G. Muhr R. Jaenicke R. Protein Eng. 1992; 5: 191-195Google Scholar, 24Andrade M.A. Chacon P. Merelo J.J. Moran F. Protein Eng. 1993; 6: 383-390Google Scholar) agreed moderately well with the secondary structure elements in the crystal structure (4Heinz D.W. Ryan M. Bullock T.L. Griffith O.H. EMBO J. 1995; 14: 3855-3863Google Scholar), and nearly all the single and double tryptophan mutants had essentially the same proportion (±1%) of secondary structure elements (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar) and Tm values within 1 °Cofthe Tm for WT PI-PLC (54.4 °C). The one exception was M49W/W47A, which exhibited a 2 °C decrease in Tm. Residue 49 is close to the C-terminal end of helix B and interacts with other portions of the protein. Insertion of a bulky tryptophan side chain at this position could slightly destabilize the molecule. However, the lack of significant changes in secondary structure in all these PI-PLC mutants indicates that any changes in PC binding and kinetics are not due to protein that has a significantly altered structure. Catalytic Properties of Helix B Mutants—By using W47A activities (low compared with native protein (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar)) as a point of reference, cIP hydrolysis and PI cleavage activities of the helix B mutants were obtained. Of all the helix B double mutants constructed, only I43W/W47A had significantly increased specific activity toward PI in the presence of diC7PC compared with W47A (Fig. 3A). All the other mutants in this region of the protein had PI cleavage activity reduced compared with the parent W47A as follows: 53, 40, and 20% for G48W/W47A, M49W/W47A, and Q45W/W47A, respectively. Phosphodiesterase activities (cIP hydrolysis) of these mutants were consistent with the trends in PI hydrolysis. With 5 mm cIP, native PI-PLC activity was enhanced 8–9-fold with diC7PC added (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar). W47A shows ∼60% of the diC7PC activation of WT (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar). Hence, an improved double mutant would have a specific activity toward cIP in the presence of diC7PC higher than W47A. As shown in Fig. 3A, the specific activity of I43W/W47A toward cIP in the presence of PC micelles was basically the same as WT. The other helix B mutants exhibited cIP hydrolysis rates with diC7PC present that were less than W47A, indicating that PC activation of this step was not restored (and impaired even more than the removal of Trp-47 for some of the mutants). An alternate means of activating PI-PLC is the addition of moderate percentages of water-miscible organic solvents (18Wu Y. Roberts M.F. Biochemistry. 1997; 36: 8514-8521Google Scholar). 30% iPrOH has been postulated to activate PI-PLC by changing the local polarity of the active site and also possibly altering the protein conformation slightly. This amount of water-miscible solvent solubilizes PI and can be used as an assay system for PI-PLC (19Wehbi H. Feng J. Roberts M.F. Biochim. Biophys. Acta. 2003; (in press)Google Scholar). In the presence of isopropyl alcohol, all helix B mutants, including I43W/W47A, which could be activated by diC7PC, showed reduced activity compared with WT protein that was comparable with that of W47A. A tryptophan at any position but residue 47 produces an enzyme that cannot be activated by iPrOH. These results indicate that not only orientation (face of the helix) but position of tryptophan in helix B is critical for optimized phosphotransferase and phosphodiesterase activities. Tryptophan (or a large hydrophobic group) located at residue 47 is absolutely necessary for PI cleavage to be enhanced by iPrOH. Catalytic Properties of Loop 232–244 Mutants—The specific activity of W242A toward PI solubilized in diC7PC was 3-fold less than WT. This mutant also showed impaired PC activation of cIP hydrolysis (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar). Reinsertion of tryptophan at three different positions in the loop (residues 236, 238, and 243) was much more successful at increasing PI cleavage rates above that for W242A (Fig. 3B). For S236W/W242A and N243W/W242A the increases in PI cleavage rates (1.88- and 1.25-fold above W242A, respectively) were moderate, and specific activities were still less than that exhibited by WT enzyme. However, G238W/W242 was able to cleave PI with a rate 4.8-fold higher than W242A and 1.6-fold higher than WT in the presence of a PC interface. The movement of tryptophan from residue 242 in the loop to position 238 produces an enzyme with an enhanced capacity to cleave PI. With PI dispersed in water-miscible organic solvent (PI in 30% iPrOH), all three loop double mutants had higher activity than W242A, in fact N243W/W242A and G238W/W242A had activity comparable with WT enzyme. If loop 232–244 is a flexible structure, then one might expect insertion of tryptophan almost anywhere would enhance enzymatic activity, and indeed this occurs for PI cleavage. Enhanced specific activities toward cIP in the presence of diC7PC (compared with W242A) were also observed for G238W/W242A and N243W/W242A but not for S236W/W242A. Because G238W/W242A had high activity with PI in micellar diC7PC and in organic solvent, construction of the mutant G238W was undertaken. Addition of another tryptophan to this loop would be predicted to enhance binding of the protein to PC vesicles (assuming all rim tryptophans partition into the membrane) and might also enhance catalytic activity assuming surface binding and catalysis are coupled. Indeed, both G238W and G238W/W242A had similar activities toward PI (1.6-fold higher than WT) and similar rates toward cIP with diC7PC added (Fig. 3B). Placement of a tryptophan at residue 238 enhances interfacial activation compared with Trp-242. However, having two tryptophan residues in the 232–244 loop does not significantly increase activity any further. Binding of Mutant PI-PLC Enzymes to PC Vesicles—Moving tryptophan in helix B or loop 232–244 could alter the affinity of these mutants for activating interfaces (e.g. PC). This possibility was investigated by measuring the partitioning of all enzymes to PC SUVs using a centrifugation/filtration assay (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar, 27Stieglitz K. Seaton B. Roberts M.F. J. Biol. Chem. 1999; 274: 35367-35374Google Scholar).2 The data were fit with a hyperbolic curve to generate an apparent dissociation constant, KD. The results, shown in Fig. 4, provide a way of comparing affinities of the different PI-PLCs for a PC surface. The apparent KD of WT PI-PLC for PC SUVs was 88 μm with the KD of W47A and W242A for PC vesicles ≥2 mm, and no significant binding of W47A/W242A to PC vesicles (16Feng J.W. Wehbi H. Roberts M.F. J. Biol. Chem. 2002; 277: 19867-19875Google Scholar). For these mutants, PI cleavage rates and PC apparent KD values followed inverse trends: the higher the PI cleavage rate the lower KD. Apparent KD values and specific activity toward PI were loosely correlated for the helix B double mutants. Mutants with enhanced PI cleavage exhibited KD values lower than that for W47A. For example, the KD for I43W/W47A was 0.85 mm, 4-fold lower than W47A but still 10-fold higher than WT. Q45W/W47A had a similar KD value to W47A. The other two mutants, G48W/W47A and M49W/W47A, exhibited slightly improved binding affinity for POPC SUVs (KD of 0.45 and 1.02 mm, respectively). For each of the mutants one can predict the change in KD for a mutant compared with WT using the Wimley-White hydrophobicity scale (17Wimley W.C. White S.H. Nat. Struct. Biol. 1996; 3: 842-848Google Scholar) to estimate the change in ΔG caused by the replacement of a given residue by tryptophan and assuming that the residues so modified insert into a PC bilayer. As shown in Fig. 4A, inserting a tryptophan in place of Ile-43 or Gly-48 in helix B is compatible with partial (but not complete) insertion of the tryptophan into PC vesicles. However, only I43W/W47A was able to regain diC7PC activation of PI cleavage and cIP hydrolysis. In contrast to the helix B double mutants, apparent KD values for double mutants of the 232–244 loop were all significantly decreased (10–100-fold) compared with W242A (Fig. 4B). N243W/W242A had the largest discrepancy between experimental and predicted KD values suggesting that a tryptophan in this position is not effectively partitioning the protein to the membrane surface. The affinity of G238W/W242A for the PC surface was increased above that for WT protein, and the affinity of G238W with three tryptophan residues in the rim region was not dramatically enhanced over G238W/W242A. Fluorescence Sensitivity of Helix B and Loop 232–244 Mutants to Ligand Binding—Previous studies (11Volwerk J.J. F" @default.
• W1973951124 created "2016-06-24" @default.
• W1973951124 creator A5014679061 @default.
• W1973951124 creator A5047196423 @default.
• W1973951124 creator A5087533970 @default.
• W1973951124 date "2003-07-01" @default.
• W1973951124 modified "2023-09-29" @default.
• W1973951124 title "Optimizing the Interfacial Binding and Activity of a Bacterial Phosphatidylinositol-specific Phospholipase C" @default.
• W1973951124 cites W16780149 @default.
• W1973951124 cites W1970692622 @default.
• W1973951124 cites W1973450983 @default.
• W1973951124 cites W1987075231 @default.
• W1973951124 cites W1987713423 @default.
• W1973951124 cites W2007708814 @default.
• W1973951124 cites W2015096311 @default.
• W1973951124 cites W2019704247 @default.
• W1973951124 cites W2019878495 @default.
• W1973951124 cites W2020994777 @default.
• W1973951124 cites W2026593599 @default.
• W1973951124 cites W2039391510 @default.
• W1973951124 cites W2045194116 @default.
• W1973951124 cites W2047786582 @default.
• W1973951124 cites W2052749821 @default.
• W1973951124 cites W2053166689 @default.
• W1973951124 cites W2058628523 @default.
• W1973951124 cites W2058969554 @default.
• W1973951124 cites W2064262345 @default.
• W1973951124 cites W2072637321 @default.
• W1973951124 cites W2076032365 @default.
• W1973951124 cites W2081164763 @default.
• W1973951124 cites W2090747098 @default.
• W1973951124 cites W2093063929 @default.
• W1973951124 cites W2095039779 @default.
• W1973951124 cites W2105363389 @default.
• W1973951124 cites W2108666301 @default.
• W1973951124 cites W2129520858 @default.
• W1973951124 cites W2411757394 @default.
• W1973951124 cites W2418361432 @default.
• W1973951124 cites W2481128133 @default.
• W1973951124 cites W596271391 @default.
• W1973951124 doi "https://doi.org/10.1074/jbc.m301207200" @default.
• W1973951124 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12714598" @default.
• W1973951124 hasPublicationYear "2003" @default.
• W1973951124 type Work @default.
• W1973951124 sameAs 1973951124 @default.
• W1973951124 citedByCount "22" @default.
• W1973951124 countsByYear W19739511242012 @default.
• W1973951124 countsByYear W19739511242016 @default.
• W1973951124 countsByYear W19739511242018 @default.
• W1973951124 countsByYear W19739511242020 @default.
• W1973951124 countsByYear W19739511242022 @default.
• W1973951124 crossrefType "journal-article" @default.
• W1973951124 hasAuthorship W1973951124A5014679061 @default.
• W1973951124 hasAuthorship W1973951124A5047196423 @default.
• W1973951124 hasAuthorship W1973951124A5087533970 @default.
• W1973951124 hasBestOaLocation W19739511241 @default.
• W1973951124 hasConcept C12927208 @default.
• W1973951124 hasConcept C181199279 @default.
• W1973951124 hasConcept C185592680 @default.
• W1973951124 hasConcept C2778597717 @default.
• W1973951124 hasConcept C2780610907 @default.
• W1973951124 hasConcept C55493867 @default.
• W1973951124 hasConcept C62478195 @default.
• W1973951124 hasConcept C86803240 @default.
• W1973951124 hasConcept C95444343 @default.
• W1973951124 hasConceptScore W1973951124C12927208 @default.
• W1973951124 hasConceptScore W1973951124C181199279 @default.
• W1973951124 hasConceptScore W1973951124C185592680 @default.
• W1973951124 hasConceptScore W1973951124C2778597717 @default.
• W1973951124 hasConceptScore W1973951124C2780610907 @default.
• W1973951124 hasConceptScore W1973951124C55493867 @default.
• W1973951124 hasConceptScore W1973951124C62478195 @default.
• W1973951124 hasConceptScore W1973951124C86803240 @default.
• W1973951124 hasConceptScore W1973951124C95444343 @default.
• W1973951124 hasIssue "27" @default.
• W1973951124 hasLocation W19739511241 @default.
• W1973951124 hasOpenAccess W1973951124 @default.
• W1973951124 hasPrimaryLocation W19739511241 @default.
• W1973951124 hasRelatedWork W1763215782 @default.
• W1973951124 hasRelatedWork W1977769302 @default.
• W1973951124 hasRelatedWork W2055617588 @default.
• W1973951124 hasRelatedWork W2061416854 @default.
• W1973951124 hasRelatedWork W2081610379 @default.
• W1973951124 hasRelatedWork W2087236557 @default.
• W1973951124 hasRelatedWork W2094178034 @default.
• W1973951124 hasRelatedWork W2171787368 @default.
• W1973951124 hasRelatedWork W2409905311 @default.
• W1973951124 hasRelatedWork W2410779175 @default.
• W1973951124 hasVolume "278" @default.
• W1973951124 isParatext "false" @default.
• W1973951124 isRetracted "false" @default.
• W1973951124 magId "1973951124" @default.
• W1973951124 workType "article" @default.