FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1974547108> ?p ?o ?g. }

• W1974547108 endingPage "1399" @default.
• W1974547108 startingPage "1392" @default.
• W1974547108 abstract "Cells of the vasculature, including macrophages, smooth muscle cells, and endothelial cells, exhibit apoptosis in culture upon treatment with oxidized low density lipoprotein, as do vascular cells of atherosclerotic plaque. Several lines of evidence support the hypothesis that the apoptotic component of oxidized low density lipoprotein is one or more oxysterols, which have been shown to induce apoptosis through the mitochondrial pathway. Activation of the mitochondrial pathway of apoptosis is regulated by members of the BCL family of proteins. In this study, we demonstrate that, in the murine macrophage-like cell line P388D1, oxysterols (25-hydroxycholesterol and 7-ketocholesterol) induced the degradation of the prosurvival protein kinase AKT (protein kinase B). This led, in turn, to the activation of the BCL-2 homology-3 domain-only proteins BIM and BAD and down-regulation of the anti-apoptotic multi-BCL homology domain protein BCL-xL. These responses would be expected to activate the pro-apoptotic multi-BCL homology domain proteins BAX and BAK, leading to the previously reported release of cytochrome c observed during oxysterol-induced apoptosis. Somewhat surprisingly, small interfering RNA knockdown of BAX resulted in a complete block of the induction of apoptosis by 25-hydroxycholesterol. Cells of the vasculature, including macrophages, smooth muscle cells, and endothelial cells, exhibit apoptosis in culture upon treatment with oxidized low density lipoprotein, as do vascular cells of atherosclerotic plaque. Several lines of evidence support the hypothesis that the apoptotic component of oxidized low density lipoprotein is one or more oxysterols, which have been shown to induce apoptosis through the mitochondrial pathway. Activation of the mitochondrial pathway of apoptosis is regulated by members of the BCL family of proteins. In this study, we demonstrate that, in the murine macrophage-like cell line P388D1, oxysterols (25-hydroxycholesterol and 7-ketocholesterol) induced the degradation of the prosurvival protein kinase AKT (protein kinase B). This led, in turn, to the activation of the BCL-2 homology-3 domain-only proteins BIM and BAD and down-regulation of the anti-apoptotic multi-BCL homology domain protein BCL-xL. These responses would be expected to activate the pro-apoptotic multi-BCL homology domain proteins BAX and BAK, leading to the previously reported release of cytochrome c observed during oxysterol-induced apoptosis. Somewhat surprisingly, small interfering RNA knockdown of BAX resulted in a complete block of the induction of apoptosis by 25-hydroxycholesterol. Many of the pathological events associated with the development of atherosclerosis are believed (1.Witztum J.L. Steinberg D. Trends Cardiovasc. Med. 2001; 11: 93-102Crossref PubMed Scopus (387) Google Scholar) to be mediated by oxidized low density lipoprotein (ox-LDL). 1The abbreviations used are: ox-LDL, oxidized low density lipoprotein; 25-OHC, 25-hydroxycholesterol; ETYA, 5,8,11,14-eicosatetraynoic acid; AACOCF3, arachidonyl trifluoromethyl ketone; GFP, green fluorescent protein; myr, myristoylated; BH3, BCL-2 homology-3; STAT, signal transducer and activator of transcription. 1The abbreviations used are: ox-LDL, oxidized low density lipoprotein; 25-OHC, 25-hydroxycholesterol; ETYA, 5,8,11,14-eicosatetraynoic acid; AACOCF3, arachidonyl trifluoromethyl ketone; GFP, green fluorescent protein; myr, myristoylated; BH3, BCL-2 homology-3; STAT, signal transducer and activator of transcription. The constitutive uptake by macrophages of ox-LDL is through specialized scavenger receptors, resulting in these cells becoming lipid-laden foam cells (2.Steinbrecher U.P. Biochim. Biophys. Acta. 1999; 1436: 279-298Crossref PubMed Scopus (188) Google Scholar). The formation of such cells is the hallmark of atherosclerosis. Furthermore, ox-LDL has been shown to be cytotoxic to macrophages (3.Hardwick S.J. Hegyi L. Clare K. Law N.S. Carpenter K.L. Mitchinson M.J. Skepper J.N. J. Pathol. 1996; 179: 294-302Crossref PubMed Scopus (123) Google Scholar) through a process requiring such receptors (4.Wintergerst E.S. Jelk J. Rahner C. Asmis R. Eur. J. Biochem. 2000; 267: 6050-6059Crossref PubMed Scopus (89) Google Scholar, 5.Rusiñol A.E. Yang L. Thewke D. Panini S.R. Kramer M.F. Sinensky M.S. J. Biol. Chem. 2000; 275: 7296-7303Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). This cytotoxicity could be very important in the atherogenicity of ox-LDL through the lysis of foam cells and the concomitant deposition of lipids in the coronary vasculature. The cytotoxic effects of ox-LDL have been shown to proceed, at least in part, through apoptotic pathways, in general (reviewed in Refs. 6.Martinet W. Kockx M.M. Curr. Opin. Lipidol. 2001; 12: 535-541Crossref PubMed Scopus (112) Google Scholar and 7.Colles S.M. Maxson J.M. Carlson S.G. Chisholm G.M. Trends Cardiovasc. Med. 2001; 11: 131-138Crossref PubMed Scopus (167) Google Scholar), as well as in macrophages, in particular (3.Hardwick S.J. Hegyi L. Clare K. Law N.S. Carpenter K.L. Mitchinson M.J. Skepper J.N. J. Pathol. 1996; 179: 294-302Crossref PubMed Scopus (123) Google Scholar, 8.Muller K. Dulku S. Hardwick S.J. Skepper J.N. Mitchinson M.J. Atherosclerosis. 2001; 156: 133-144Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar, 9.Panini S.R. Yang L. Rusiñol A.E. Sinensky M.S. Bonventre J.V. Leslie C.C. J. Lipid Res. 2001; 42: 1678-1686Abstract Full Text Full Text PDF PubMed Google Scholar). The cholesterol oxidation products (oxysterols) found in ox-LDL (10.Schroepfer G.J. Physiol. Rev. 2000; 80: 361-554Crossref PubMed Scopus (823) Google Scholar) have been recognized as a probable basis for its cytotoxicity (11.Chisolm G.M. Ma G. Irwin K.C. Martin L.L. Gunderson K.G. Linberg L.F. Morel D.W. DiCorleto P.E. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 11452-11456Crossref PubMed Scopus (191) Google Scholar, 12.Sevanian A. Hodis H.N. Hwang J. McLeod L.L. Peterson H. J. Lipid Res. 1995; 36: 1971-1986Abstract Full Text PDF PubMed Google Scholar), at least in part, via apoptotic mechanisms (7.Colles S.M. Maxson J.M. Carlson S.G. Chisholm G.M. Trends Cardiovasc. Med. 2001; 11: 131-138Crossref PubMed Scopus (167) Google Scholar, 13.Panini S.R. Sinensky M.S. Curr. Opin. Lipidol. 2001; 12: 529-533Crossref PubMed Scopus (107) Google Scholar, 14.Harada-Shiba M. Kinoshita M. Kamido H. Shimokado K. J. Biol. Chem. 1998; 273: 9681-9687Abstract Full Text Full Text PDF PubMed Scopus (233) Google Scholar). A model compound for such oxysterols is 25-hydroxycholesterol (25-OHC), which has been shown to induce apoptosis in monocyte-macrophage (9.Panini S.R. Yang L. Rusiñol A.E. Sinensky M.S. Bonventre J.V. Leslie C.C. J. Lipid Res. 2001; 42: 1678-1686Abstract Full Text Full Text PDF PubMed Google Scholar, 15.Aupeix K. Weltin D. Mejia J.E. Christ M. Marchal J. Freyssinet J.-M. Bischoff P. Immunobiology. 1995; 194: 415-428Crossref PubMed Scopus (102) Google Scholar, 16.Harada K. Ishibashi S. Miyashita T. Osuga J.-I. Yagyu H. Ohashi K. Yazaki Y. Yamada N. FEBS Lett. 1997; 411: 63-66Crossref PubMed Scopus (49) Google Scholar) and lymphoid (17.Bansal N. Houle A. Melnykovych G. FASEB J. 1991; 5: 211-216Crossref PubMed Scopus (114) Google Scholar, 18.Christ M. Luu B. Mejia J.E. Moosbrugger I. Bischoff P. Immunology. 1993; 78: 455-460PubMed Google Scholar) cell lines in the range of 1-10 μm. Prior studies have been consistent with the activation of the mitochondrial death pathway by oxysterols with its canonical cytochrome c release (19.Yang L. Sinensky M.S. Biochem. Biophys. Res. Commun. 2000; 278: 557-563Crossref PubMed Scopus (43) Google Scholar, 20.Lizard G. Gueldry S. Sordet O. Monier S. Athias A. Miguet C. Bessede G. Lemaire S. Solary E. Gambert P. FASEB J. 1998; 12: 1651-1663Crossref PubMed Scopus (190) Google Scholar). Cytochrome c release from mitochondria is regulated, in turn, through the activation of pro-apoptotic BCL family members, along with possible inactivation of anti-apoptotic BCL family members (21.Kaufmann S.H. Hengartner M.O. Trends Cell Biol. 2001; 11: 526-534Abstract Full Text Full Text PDF PubMed Scopus (597) Google Scholar). In this study, we describe the role of the AKT-regulated BAX/BAD pathway in oxysterol-induced apoptosis of murine macrophage cell lines. Materials—RAW 264.7 cells were purchased from American Type Culture Collection (Manassas, VA). P388D1 cells (MAB variant) were provided by Dr. Edward Dennis (University of California, San Diego, CA) (22.Shinohara H. Balboa M.A. Johnson C.A Balsinde J. Dennis E.A. J. Biol. Chem. 1999; 274: 12263-12268Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar). RPMI 1640 medium and Dulbecco's modified Eagle's medium were from Invitrogen. NovaCell I fetal bovine serum was from Nova-Tech (Grand Island, NE). All other cell culture reagents were obtained from Invitrogen. 5,8,11,14-Eicosatetraynoic acid (ETYA), Ac-DEVD-aldehyde, Ac-DEVD-7-amino-4-trifluoromethyl coumarin, and arachidonyl trifluoromethyl ketone (AACOCF3) were purchased from BIOMOL Research Labs Inc. (Plymouth Meeting, PA). Oxysterols were purchased from STERALOIDS, Inc. (Wilton, NH). All antibodies were purchased from Cell Signaling Technology, Inc. (Beverly, MA), with the exception of anti-AKT1/2 antibody (Santa Cruz Biotechnology, Santa Cruz, CA), anti-Myc antibody (Upstate Biotechnology, Inc., Charlottesville, VA), and anti-HSP70 antibody (Stressgen Biotech Corp., Victoria, British Columbia, Canada). Peroxidase-conjugated secondary antibodies were from Pierce. pEGFP-C3 was from Clontech. Proteasome inhibitor I was from Calbiochem. MitoTracker™ Red was from Molecular Probes, Inc. (Eugene, OR). Cell Culture—All cell lines were maintained in a humidified atmosphere of 5% CO2 and 95% air at 37 °C. RAW 264.7 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 10 mm Hepes buffer (pH 7.4), 2 mm glutamine, 1 mm sodium pyruvate, 100 units/ml penicillin, 100 μg/ml streptomycin, and 50 μm 2-mercaptoethanol. P388D1 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 2 mm glutamine, 1 mm sodium pyruvate, 100 units/ml penicillin, and 100 μg/ml streptomycin. Caspase-3 Assay—P388D1 cells were seeded at 2 × 106/well in 12-well culture plates, and RAW 264.7 cells at 2.5 × 106/well in 6-well culture plates. The medium was supplemented with 25-OHC dissolved in ethanol or an equivalent volume of ethanol alone (control treatments). Inhibitor (ETYA or AACOCF3) was added to the medium 2 h prior to the addition of 25-OHC. Following an 18-h incubation, the adherent and non-adherent cells were collected by scraping and centrifugation at 1000 × g for 5 min. The cells were washed with ice-cold phosphate-buffered saline, resuspended in lysis buffer A (10 mm Tris (pH 7.5), 130 mm NaCl, 1% Triton X-100, 10 mm sodium Pi, and 10 mm sodium PPi), incubated on ice for 10 min, and centrifuged at 12,000 × g for 20 min at 4 °C. The supernatant or extract was assayed for protein using the micro-BCA kit (Pierce) and for caspase-3 activity as follows. Equivalent amounts of each sample were incubated for 2.5 h at 37 °C in caspase assay buffer (20 mm Hepes (pH 7.5), 10% glycerol, and 2 mm dithiothreitol) containing 5 μm caspase-3 substrate (Ac-DEVD-7-amino-4-trifluoromethyl coumarin) in the presence and absence of a caspase-3-specific inhibitor (Ac-DEVD-aldehyde) added at 100 nm 30 min prior to the addition of the substrate. Liberated 7-amino-4-trifluoromethyl coumarin was measured using a spectrofluorometer (FluroMax 3 equipped with a microplate reader, Jobin-Yvon Inc.) with an excitation wavelength of 400 nm and an emission wavelength of 505 nm. For each sample, the net caspase-3 activity was determined by subtracting the relative fluorescent light units obtained in the presence of the inhibitor from the relative fluorescent light units obtained in the absence of the inhibitor and normalizing to the protein content of the sample. Each treatment was performed in triplicate, and the data are presented as the mean ± S.D. BAD-GFP Fusion Protein—The Bad open reading frame was excised from pEBG-mBAD (Cell Signaling Technology, Inc.) with HindIII and NotI and ligated in-frame into pEGFP-C3 after the creation of an appropriate NotI site using the QuikChange kit (Stratagene). The finished construct was confirmed by sequencing and transfected into RAW 264.7 cells using GeneJammer (Stratagene). Detection of BAD-GFP in RAW 264.7 Cells—Transiently transfected RAW 264.7 cells were incubated overnight on glass chambered coverslips. Cells were then washed and incubated with 25-OHC (10 μg/ml) for 6 h. After washing with phosphate-buffered saline, cells were observed live under a fluorescence microscope. In colocalization experiments, mitochondria were also stained with MitoTracker™ Red following the manufacturer's instructions. Confocal images were obtained by digital deconvolution of 10-slice stacks acquired on a Nikon Diaphot 200 equipped with a Photometrics Sensys cooled CCD digital camera or Nikon D100 Oncor Z-drive and Oncor Image software. Bax Gene Suppression—Bax gene suppression was achieved by stably transfecting cells with pSi-Bax, a plasmid that generates small interfering RNAs that target Bax mRNA for degradation. To produce pSi-Bax, the following complementary oligonucleotides were annealed and cloned into ApaI/EcoRI-digested pSilencer (Ambion Inc., Austin, TX): Bax 1, ACTGGTGCTCAGGCCCTGTTCAAGAGACAGGGCCTTGAGCACCAGTTTTTTT; and Bax 2, AATTAAAAAAACTGGTGCTCAAGGCCCTGTCTCTTGAACAGGGCCTTGAGCACCAGTGGCC. The negative control vector pSi-RandomBax was constructed by ligating the following annealed, custom-synthesized oligonucleotides of randomized Bax target sequence into ApaI/EcoRI-digested pSilencer: RandomBax 1, ACCGCTCGAGCGTGCTAGTTTCAAGAGAACTAGCACGCTCGAGCGGTTTTTTT; and RandomBax 2, AATTAAAAAAACCGCTCGAGCGTGCTAGTTCTCTGAAACTAGCACGCTCGAGCGGTGGCC. P388D1 cells (1 × 106) were cotransfected with a plasmid carrying the neomycin gene, pEGFP (Clontech), and either pSi-Bax or pSi-RandomBax using LipofectAMINE Plus (Invitrogen) according to the manufacturer's directions. Stable clones were first selected by infinite dilution in medium containing 1 mg/ml G418 for 7 days, followed by 14 days in 0.25 mg/ml G418. G418-resistant clones were screened by PCR for integration of the pSilencer vector. The PCR positive G418-resistant clones were then subjected to selection in medium containing 10 μg/ml 25-OHC for 68 h. The surviving cells were expanded and maintained in medium containing 500 μg/ml G418. No 25-OHC-resistant clones were obtained from PCR positive G418-resistant pRandomBax clones. The suppression of BAX expression was determined by immunoblotting whole cell lysates prepared from the isolated clones, wild-type cells, and G418-resistant pRandomBax clones using anti-BAX antibody. Expression of Constitutively Active AKT—P388D1 cells were stably transfected with a vector expressing Myc-His-tagged mouse AKT1 (activated) under the control of the cytomegalovirus promoter (Upstate Biotechnology, Inc.) using LipofectAMINE Plus according to the manufacturer's directions. Stable clones were isolated by selection in medium containing 1 mg/ml G418 for 6 days, followed by 10 days in 250 μg/ml G418. The G418-resistant clones were isolated, expanded, and screened for expression of the Myc-AKT fusion protein by immunoblotting with anti-total AKT1/2 antibody (Cell Signaling Technology, Inc.) and anti-Myc antibody. Positive Myc-AKT clones were maintained in medium containing 250 μg/ml G418. For transient transfection experiments, P388D1 cells were seeded at 2 × 106/well in 6-well tissue culture plates. Twenty-four hours later, the cells were rinsed with phosphate-buffered saline, refed standard growth medium, and transfected with pUSEamp or with pUSEamp containing myristoylated (myr) Akt cDNA using Tojene™ transfection reagent (Avanti Polar Lipids, Inc.) according to the manufacturer's directions. Following transfection, expression of the transfected construct was allowed to proceed for 24 h prior to the addition of oxysterol and analysis of caspase-3 activity. Cell Lysis and Immunoblotting—P388D1 cells were grown to a density of 2 × 106/ml in regular growth medium supplemented with either vehicle (ethanol) or increasing amounts of 25-OHC. After different periods of time, cells were spun and treated with lysis buffer B (20 mm Tris (pH 7.5), 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, 1% Triton X-100, 2.5 mm sodium pyrophosphate, 1 mm β-glycerol phosphate, 1 mm Na3VO4, and 1 μg/ml leupeptin) and incubated on ice for 30 min. Insoluble debris was removed from the extracts by centrifugation for 10 min at 10,000 × g, and the protein concentration in the supernatants was determined by micro-BCA assay. Proteins were resolved by SDS-PAGE on 4-12% NuPAGE gels (Invitrogen) and transferred to polyvinylidene difluoride membranes (Immobilon-P, Millipore Corp.). The membranes were stained with SYPRO®Ruby protein stain (Molecular Probes, Inc.) to ascertain equivalent loading of the gel and efficient transfer of proteins to the membranes before immunoblotting. The blots were then processed using antibodies specific for the protein of interest and the appropriate peroxidase-conjugated secondary antibodies following manufacturers' directions. The proteins of interest were visualized by enhanced chemiluminescence using SuperSignal® West Pico chemiluminescent substrate (Pierce) as directed. Pulse-Chase Experiments—P388D1 cells were grown in methionine-deficient medium for 2 h and then pulsed with Tran35S-label (100 μCi/ml; ICN) for 3 h. Cells were then washed and chased for different time periods in regular growth medium containing 1 mm unlabeled methionine and either vehicle (ethanol) or 10 μg/ml 25-OHC. Cells were lysed as described above and subjected to immunoprecipitation with anti-AKT antibodies. Assays were performed using Seize™-coated plate immunoprecipitation kits (Pierce) according to the manufacturer's instructions. After binding, washing, and elution, the presence of radiolabeled AKT in the precipitates was examined by SDS-PAGE and phosphorimaging. AKT Kinase Assay—The active form of AKT was measured using a nonradioactive AKT kinase assay kit (Cell Signaling Technology, Inc.) following the manufacturer's instructions. Essentially, an antibody to AKT was used to selectively immunoprecipitate AKT from cell lysates. The immunoprecipitate was then incubated with glycogen synthase kinase-3β fusion protein in the presence of ATP and kinase buffer, allowing immunoprecipitated AKT to phosphorylate glycogen synthase kinase-3β. Phosphorylation of glycogen synthase kinase-3β was then measured by immunoblotting using anti-phospho-Ser-21/9 glycogen synthase kinase-3α/β antibody and quantitated by phosphorimaging. 25-OHC Induces Apoptosis in P388D1 Cells through a Process Dependent on Arachidonate Metabolism—We have previously characterized oxysterol induction of apoptosis in both a fibroblast cell line (CHO-K1) and a monocyte-macrophage cell line (THP-1) as being dependent on arachidonate release and metabolism (9.Panini S.R. Yang L. Rusiñol A.E. Sinensky M.S. Bonventre J.V. Leslie C.C. J. Lipid Res. 2001; 42: 1678-1686Abstract Full Text Full Text PDF PubMed Google Scholar). Because of difficulties we encountered in transfection of THP-1 cells and the well established use of the murine macrophage P388D1 cells in studies of arachidonate metabolism (22.Shinohara H. Balboa M.A. Johnson C.A Balsinde J. Dennis E.A. J. Biol. Chem. 1999; 274: 12263-12268Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar), we determined whether P388D1 cells undergo apoptosis in response to oxysterols in a similar fashion. We confirmed a prior report (16.Harada K. Ishibashi S. Miyashita T. Osuga J.-I. Yagyu H. Ohashi K. Yazaki Y. Yamada N. FEBS Lett. 1997; 411: 63-66Crossref PubMed Scopus (49) Google Scholar) that 25-OHC induces apoptosis in P388D1 cells and also demonstrated, as was observed for the other cell lines, that the induction of apoptosis was blocked both by the cytosolic phospholipase A2 inhibitor AACOCF3 and by ETYA, an inhibitor of arachidonate metabolism (Fig. 1). 25-OHC Down-regulates AKT in P388D1 Cells—AKT (protein kinase B) has been well characterized as an anti-apoptotic kinase (24.Downward J. Curr. Opin. Cell Biol. 1998; 10: 262-267Crossref PubMed Scopus (1186) Google Scholar) that transduces cellular survival signals in many cell types (25.Nunez G. del Peso L. Curr. Opin. Neurobiol. 1998; 8: 613-618Crossref PubMed Scopus (75) Google Scholar). In particular, a critical role for AKT has been ascribed to the survival of macrophages (26.Liu H. Perlman H. Pagliari L.J. Pope R.M. J. Exp. Med. 2001; 194: 113-126Crossref PubMed Scopus (191) Google Scholar). We therefore examined the effect of overnight treatment with 25-OHC on the activity of AKT in the murine macrophage cell line P388D1. Activity was assayed with glycogen synthase kinase-3β as substrate. The results clearly indicate that AKT activity was down-regulated in P388D1 cells in response to treatment with 25-OHC (Fig. 2A). The mechanism of down-regulation of AKT was explored by immunoblot and radioimmunoprecipitation experiments. Immunoblot analysis demonstrated that oxysterol treatment produced a reduction in the level of total AKT in P388D1 cells (Fig. 2B). Pulse-chase radioimmunoprecipitation studies revealed that 25-OHC treatment greatly enhanced the rate of degradation of AKT (Fig. 2C). Furthermore, the effect was observed with no time lag after 25-OHC addition, suggesting that this is an early signaling event. We also examined the effect of treatment with proteasome inhibitor I on the cellular levels and activity of AKT in 25-OHC-treated cells. This was done to determine whether this enhanced degradation rate was responsible for the decrease in its activity as well as to gain insight into the mechanism of regulated degradation. The results demonstrate that inhibition of the degradation of AKT significantly attenuated the loss of its activity in response to 25-OHC treatment (Fig. 2, A and D). Therefore, the primary mechanism by which 25-OHC down-regulates the activity of AKT appears to be through stimulation of its rate of degradation. This mechanism of degradation is also consistent with an early regulated event. We wanted to confirm this putative critical role for AKT signaling in 25-OHC-induced apoptosis. Therefore, we examined the effect of expression of a constitutively active Myc-tagged form of AKT (myr-AKT) (27.Kohn A.D. Summers S.A. Birnbaum M.J. Roth R.A. J. Biol. Chem. 1996; 271: 31372-31378Abstract Full Text Full Text PDF PubMed Scopus (1089) Google Scholar) on the activation of caspase-3 by 25-OHC treatment. We isolated a clone (clone B) stably expressing transfected myr-AKT (Fig. 3A). AKT activity in clone B cells was shown to be elevated ∼2-fold relative to that in wild-type P388D1 cells as demonstrated in vitro by enzyme assay both in untreated and 25-OHC-treated cells (Fig. 3B). Clone B was also seen to be relatively resistant to induction of apoptosis by 25-OHC or 7-ketocholesterol as measured by caspase-3 activity (Fig. 3, B and C). To guard against the possibility that this result was due to another genetic variation in clone B, the ability of myr-AKT to protect cells from oxysterol-induced caspase-3 activation was also demonstrated by transient transfection with the same construct (Fig. 3D). Effect of 25-OHC Treatment on BH3 Domain-only Proteins: Activation of BAD and Increased Cellular Levels of BIM—A common mechanism by which AKT inactivation is coupled to apoptosis is through the regulation of BAD by AKT (25.Nunez G. del Peso L. Curr. Opin. Neurobiol. 1998; 8: 613-618Crossref PubMed Scopus (75) Google Scholar). AKT phosphorylates BAD at two serine residues, resulting in its sequestration in the cytosol, bound to 14-3-3 (28.Zha J. Harada H. Yang E. Jockel J. Korsmeyer S.J. Cell. 1996; 87: 619-628Abstract Full Text Full Text PDF PubMed Scopus (2253) Google Scholar, 29.del Peso L. Gonzalez-Garcia M. Page C. Herrera R. Nunez G. Science. 1997; 278: 687-689Crossref PubMed Scopus (1985) Google Scholar, 30.Datta S.R. Dudek H. Tao X. Masters S. Fu H. Gotoh Y. Greenberg M.E. Cell. 1997; 91: 231-241Abstract Full Text Full Text PDF PubMed Scopus (4936) Google Scholar). In the absence of ongoing AKT-catalyzed phosphorylation, BAD becomes dephosphorylated by any of several phosphatases (31.Klumpp S. Krieglstein J. Curr. Opin. Pharmacol. 2002; 2: 458-462Crossref PubMed Scopus (128) Google Scholar). This results in its relocalization to the mitochondria (32.Pastorino J.G. Tafani M. Farber J.L. J. Biol. Chem. 1999; 274: 19411-19416Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 33.Wang H.G. Pathan N. Ethell I.M. Krajewski S. Yamaguchi Y. Shibasaki F. McKeon F. Bobo T. Franke T.F. Reed J.C. Science. 1999; 284: 339-343Crossref PubMed Scopus (962) Google Scholar, 34.Cheng E.H. Wei M.C. Weiler S. Flavell R.A. Mak T.W. Lindsten T. Korsmeyer S.J. Mol. Cell. 2001; 8: 705-711Abstract Full Text Full Text PDF PubMed Scopus (1427) Google Scholar), where it heterodimerizes via its BH3 domain (35.Zha J. Harada H. Osipov K. Jockel J. Waksman G. Korsmeyer S.J. J. Biol. Chem. 1997; 272: 24101-24104Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar) with the anti-apoptotic BCL family members BCL-2 and BCL-xL (36.Yang G. Zha J. Jockel J. Boise L.H. Thompson C.B. Korsmeyer S.J. Cell. 1995; 80: 285-291Abstract Full Text PDF PubMed Scopus (1892) Google Scholar). These are critical signaling events in the mitochondrial apoptotic pathway that result in canonical cytochrome c release (37.Wang X. Genes Dev. 2001; 15: 2922-2933Crossref PubMed Scopus (94) Google Scholar). Because we have previously demonstrated that oxysterols mediate cytochrome c release from mitochondria during apoptotic induction in other cell types (19.Yang L. Sinensky M.S. Biochem. Biophys. Res. Commun. 2000; 278: 557-563Crossref PubMed Scopus (43) Google Scholar), we anticipated that a consequence of the observed AKT degradation would be activation of BAD. BAD activation can be detected either through determination of its dephosphorylation or by its relocalization. We examined both processes. The immunoblot of BAD from 25-OHC-treated P388D1 cells with anti-phospho-BAD antibody is consistent with loss of phosphorylation (Fig. 4). In clone B, BAD was observed to be hyperphosphorylated both in untreated and 25-OHC-treated cells (Fig. 4), demonstrating the activity and, in particular, the anti-apoptotic activity of the myr-AKT construct in whole cells. The immunoblots of total mitochondrial BAD were consistent with an increase in the mitochondrial levels of BAD after 25-OHC treatment (data not shown). Relocalization of BAD was also demonstrated by transfection of murine RAW 264.7 macrophages with a BAD-GFP fusion protein. Such a reporter has previously been utilized to demonstrate BAD activation in another system (33.Wang H.G. Pathan N. Ethell I.M. Krajewski S. Yamaguchi Y. Shibasaki F. McKeon F. Bobo T. Franke T.F. Reed J.C. Science. 1999; 284: 339-343Crossref PubMed Scopus (962) Google Scholar). RAW 264.7 cells were used for this experiment because they grow attached and spread out on the surface of a plastic Petri dish, allowing better resolution of the cellular distribution of the fluorescent fusion protein. The results indicate a redistribution of BAD from a diffuse cytosolic localization to a punctate distribution largely colocalized with the mitochondrial marker MitoTracker (Fig. 5). This is precisely the result to be expected for the relocalization of BAD associated with dephosphorylation (33.Wang H.G. Pathan N. Ethell I.M. Krajewski S. Yamaguchi Y. Shibasaki F. McKeon F. Bobo T. Franke T.F. Reed J.C. Science. 1999; 284: 339-343Crossref PubMed Scopus (962) Google Scholar).Fig. 525-OHC induces BAD translocation to the mitochondria. RAW 264.7 cells were transiently transfected with BAD-GFP fusion protein. After 16 h, cells were treated with 10 μg/ml 25-OHC and incubated for 6 h. The localization of the BAD-GFP chimera was determined by fluorescence microscopy as described under “Experimental Procedures.” The same cell is shown before and after treatment. MitoTracker is a fluorescent probe that specifically stains mitochondria.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Korsmeyer and co-workers (38.Letai A. Bassik M.C. Walensky L.D. Sorcinelli M.D. Weiler S. Korsmeyer S.J. Cancer Cell. 2002; 2: 183-192Abstract Full Text Full Text PDF PubMed Scopus (1353) Google Scholar) have presented evidence for two classes of BH3 domain-only proteins. The first category is exemplified by BAD, which functions through “sensitization” toward apoptosis by heterodimerization and inactivation of anti-apoptotic multi-BCL homology domain family members. BH3 domain-only proteins in the second category activate the pro-apoptotic multi-BCL homology domain family members by inducing their oligomerization to release cytochrome c. Expression of one of these proteins (BIM) has been shown to be down-regulated by AKT (39.Dijkers P.F. Birkenkamp K.U. Lam E.W. Thomas N.S. Lammers J.W. Koenderman L. Coffer P.J. J. Cell Biol. 2002; 156: 531-542Crossref PubMed Scopus (318) Google Scholar). We therefore examined P388D1 cells for increased expression of BIM after 25-OHC treatment by immunoblotting. The results are consistent with an increase in BIM levels in cells and in mitochondria (Fig. 6). Role of Multi-BCL Homology Domain Proteins in Induction of Apoptosis by 25-OHC—Release of cytochrome c from mitochondria in response to signaling by the BH3 domain-only proteins would be expe" @default.
• W1974547108 created "2016-06-24" @default.
• W1974547108 creator A5015055428 @default.
• W1974547108 creator A5023557816 @default.
• W1974547108 creator A5050831698 @default.
• W1974547108 creator A5053033763 @default.
• W1974547108 creator A5056556589 @default.
• W1974547108 creator A5078666853 @default.
• W1974547108 date "2004-01-01" @default.
• W1974547108 modified "2023-09-29" @default.
• W1974547108 title "AKT/Protein Kinase B Regulation of BCL Family Members during Oxysterol-induced Apoptosis" @default.
• W1974547108 cites W1488191987 @default.
• W1974547108 cites W1522189944 @default.
• W1974547108 cites W1617532721 @default.
• W1974547108 cites W1862564406 @default.
• W1974547108 cites W1894868403 @default.
• W1974547108 cites W1969439607 @default.
• W1974547108 cites W1976720365 @default.
• W1974547108 cites W1978559408 @default.
• W1974547108 cites W1984547206 @default.
• W1974547108 cites W1987250876 @default.
• W1974547108 cites W1989294105 @default.
• W1974547108 cites W2006897943 @default.
• W1974547108 cites W2007539100 @default.
• W1974547108 cites W2008090773 @default.
• W1974547108 cites W2011502676 @default.
• W1974547108 cites W2018695514 @default.
• W1974547108 cites W2019346242 @default.
• W1974547108 cites W2024880806 @default.
• W1974547108 cites W2028225825 @default.
• W1974547108 cites W2030573603 @default.
• W1974547108 cites W2031552251 @default.
• W1974547108 cites W2036246693 @default.
• W1974547108 cites W2039682492 @default.
• W1974547108 cites W2040478987 @default.
• W1974547108 cites W2046867705 @default.
• W1974547108 cites W2055882175 @default.
• W1974547108 cites W2056641203 @default.
• W1974547108 cites W2057713336 @default.
• W1974547108 cites W2059397915 @default.
• W1974547108 cites W2061690334 @default.
• W1974547108 cites W2068146558 @default.
• W1974547108 cites W2072448568 @default.
• W1974547108 cites W2081547837 @default.
• W1974547108 cites W2086165161 @default.
• W1974547108 cites W2086918192 @default.
• W1974547108 cites W2088074605 @default.
• W1974547108 cites W2091019523 @default.
• W1974547108 cites W2093628776 @default.
• W1974547108 cites W2093973061 @default.
• W1974547108 cites W2097289392 @default.
• W1974547108 cites W2097767970 @default.
• W1974547108 cites W2128738810 @default.
• W1974547108 cites W2133792873 @default.
• W1974547108 cites W2138432486 @default.
• W1974547108 cites W2140187466 @default.
• W1974547108 cites W2142787693 @default.
• W1974547108 cites W2152247516 @default.
• W1974547108 cites W2163034757 @default.
• W1974547108 cites W2397170472 @default.
• W1974547108 cites W2578722813 @default.
• W1974547108 cites W390886120 @default.
• W1974547108 doi "https://doi.org/10.1074/jbc.m308619200" @default.
• W1974547108 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14559920" @default.
• W1974547108 hasPublicationYear "2004" @default.
• W1974547108 type Work @default.
• W1974547108 sameAs 1974547108 @default.
• W1974547108 citedByCount "74" @default.
• W1974547108 countsByYear W19745471082012 @default.
• W1974547108 countsByYear W19745471082013 @default.
• W1974547108 countsByYear W19745471082014 @default.
• W1974547108 countsByYear W19745471082015 @default.
• W1974547108 countsByYear W19745471082016 @default.
• W1974547108 countsByYear W19745471082017 @default.
• W1974547108 countsByYear W19745471082018 @default.
• W1974547108 countsByYear W19745471082019 @default.
• W1974547108 countsByYear W19745471082020 @default.
• W1974547108 countsByYear W19745471082021 @default.
• W1974547108 countsByYear W19745471082022 @default.
• W1974547108 crossrefType "journal-article" @default.
• W1974547108 hasAuthorship W1974547108A5015055428 @default.
• W1974547108 hasAuthorship W1974547108A5023557816 @default.
• W1974547108 hasAuthorship W1974547108A5050831698 @default.
• W1974547108 hasAuthorship W1974547108A5053033763 @default.
• W1974547108 hasAuthorship W1974547108A5056556589 @default.
• W1974547108 hasAuthorship W1974547108A5078666853 @default.
• W1974547108 hasBestOaLocation W19745471081 @default.
• W1974547108 hasConcept C124160383 @default.
• W1974547108 hasConcept C184235292 @default.
• W1974547108 hasConcept C185592680 @default.
• W1974547108 hasConcept C190283241 @default.
• W1974547108 hasConcept C2778111914 @default.
• W1974547108 hasConcept C2778163477 @default.
• W1974547108 hasConcept C55493867 @default.
• W1974547108 hasConcept C75217442 @default.
• W1974547108 hasConcept C86554907 @default.
• W1974547108 hasConcept C86803240 @default.
• W1974547108 hasConcept C90934575 @default.

• next