FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1974846879> ?p ?o ?g. }

• W1974846879 endingPage "40" @default.
• W1974846879 startingPage "32" @default.
• W1974846879 abstract "Anti-graft antibodies are often associated with graft rejection. Under special conditions, grafts continue to function normally even in the presence of anti-graft antibodies and complement. This condition is termed accommodation. We developed a xenograft accommodation model in which baby Lewis rat hearts are transplanted into Rag/GT-deficient mice, and accommodation is induced by repeated i.v. injections of low-dose anti-α-Gal IgG1. The accommodated grafts survived a bolus dose of anti-α-Gal IgG1, while freshly transplanted second grafts were rejected. To study the mechanism of anti-α-Gal IgG1-mediated accommodation, both real-time PCR and immunohistochemical staining revealed elevated expression of DAF, Crry and CD59 in the accommodated grafts. In vitro exposure of rat endothelial cells to anti-α-Gal IgG1 also induced the up-regulation of DAF, Crry and CD59, as revealed by Western blot analyses, and was associated with an acquired resistance to antibody and complement-mediated lysis in vitro. Collectively, these studies suggest that the up-regulation of complement regulatory proteins may abrogate complement-mediated rejection and permit the development of xenograft accommodation. Anti-graft antibodies are often associated with graft rejection. Under special conditions, grafts continue to function normally even in the presence of anti-graft antibodies and complement. This condition is termed accommodation. We developed a xenograft accommodation model in which baby Lewis rat hearts are transplanted into Rag/GT-deficient mice, and accommodation is induced by repeated i.v. injections of low-dose anti-α-Gal IgG1. The accommodated grafts survived a bolus dose of anti-α-Gal IgG1, while freshly transplanted second grafts were rejected. To study the mechanism of anti-α-Gal IgG1-mediated accommodation, both real-time PCR and immunohistochemical staining revealed elevated expression of DAF, Crry and CD59 in the accommodated grafts. In vitro exposure of rat endothelial cells to anti-α-Gal IgG1 also induced the up-regulation of DAF, Crry and CD59, as revealed by Western blot analyses, and was associated with an acquired resistance to antibody and complement-mediated lysis in vitro. Collectively, these studies suggest that the up-regulation of complement regulatory proteins may abrogate complement-mediated rejection and permit the development of xenograft accommodation. The pathogenic activities of graft-reactive antibodies are illustrated by their ability to induce hyperacute, acute and chronic rejection of xenografts and allografts. Paradoxically, the presence of graft-reactive antibodies does not invariably lead to graft rejection, and under special circumstances, grafts have been observed to function normally despite the return of high titers of graft-reactive antibodies (1Palmer A Taube D Welsh K Bewick M Gjorstrup P Thick M Removal of anti-HLA antibodies by extracorporeal immunoadsorption to enable renal transplantation.Lancet. 1989; 1: 10-12Abstract PubMed Scopus (182) Google Scholar, 2Ross CN Gaskin G Gregor-Macgregor S et al.Renal transplantation following immunoadsorption in highly sensitized recipients.Transplantation. 1993; 55: 785-789Crossref PubMed Scopus (67) Google Scholar, 3Bach FH Ferran C Hechenleitner P et al.Accommodation of vascularized xenografts: Expression of “protective genes” by donor endothelial cells in a host Th2 cytokine environment..Nat Med. 1997; 3: 196-204Crossref PubMed Scopus (381) Google Scholar). Graft accommodation has been reported to occur in both xenografts and allografts (4Semiletova NV Shen XD Baibakov B et al.Inhibition of chronic rejection by antibody induced vascular accommodation in fully allogeneic heart allografts.Transplantation. 2005; 80: 1535-1540Crossref PubMed Scopus (13) Google Scholar, 5Wang N Lee JM Tobiasch E et al.Induction of xenograft accommodation by modulation of elicited antibody responses1 2.Transplantation. 2002; 74: 334-345Crossref PubMed Scopus (30) Google Scholar, 6Lin Y Soares MP Sato K et al.Accommodated xenografts survive in the presence of anti-donor antibodies and complement that precipitate rejection of naive xenografts.J Immunol. 1999; 163: 2850-2857Crossref PubMed Google Scholar). The mechanism underlying accommodation is unknown, however, changes in the function of antibodies, in the expression of target antigen, and in the graft, which imparts resistance to injury, have been implicated (7Park WD Grande JP Ninova D et al.Accommodation in ABO-incompatible kidney allografts, a novel mechanism of self-protection against antibody-mediated injury.Am J Transplant. 2003; 3: 952-960Crossref PubMed Scopus (171) Google Scholar, 8Platt JL Vercellotti GM Dalmasso AP et al.Transplantation of discordant xenografts: A review of progress.Immunol Today. 1990; 11 (discussion 456–457): 450-456Abstract Full Text PDF PubMed Scopus (502) Google Scholar). Attempts have been made to understand the biochemical basis for accommodation. Early studies by Dalmasso et al. indicated that human xenoreactive IgM was able to induce porcine endothelial resistance to complement-mediated injury (9Dalmasso APHT Benson BA Human IgM xenoreactive natural antibodies can induce resistance of porcine endothelial cells to complement-mediated injury.Xenotransplantation. 1996; 3: 54-62Crossref Scopus (54) Google Scholar). Williams et al. reported that xenograft accommodation in a pig-to-baboon model was associated with a premature interruption of the complement cascade and heightened expression of heparan sulfate and syndecan-4-phosphate (10Williams JM Holzknecht ZE Plummer TB Lin SS Brunn GJ Platt JL Acute vascular rejection and accommodation: Divergent outcomes of the humoral response to organ transplantation.Transplantation. 2004; 78: 1471-1478Crossref PubMed Scopus (77) Google Scholar). In the hamster-to-rat model, in which xenograft rejection is controlled by cobra venom factor (CVF) and cyclosporine A, accommodation to T-cell-independent antibodies was postulated to be mediated by an elevated expression of HO-1 and the anti-apoptotic genes, A-20, Bcl-xL and Bcl-2 (3Bach FH Ferran C Hechenleitner P et al.Accommodation of vascularized xenografts: Expression of “protective genes” by donor endothelial cells in a host Th2 cytokine environment..Nat Med. 1997; 3: 196-204Crossref PubMed Scopus (381) Google Scholar, 6Lin Y Soares MP Sato K et al.Accommodated xenografts survive in the presence of anti-donor antibodies and complement that precipitate rejection of naive xenografts.J Immunol. 1999; 163: 2850-2857Crossref PubMed Google Scholar). A role of Bcl-2 and Bcl-xL, nitric oxide and adenosine A2 receptors has also been implicated in the acquired resistance of endothelial cells to antibody-mediated lysis (11Delikouras A Fairbanks LD Simmonds AH Lechler RI Dorling A Endothelial cell cytoprotection induced in vitro by allo- or xenoreactive antibodies is mediated by signaling through adenosine A2 receptors.Eur J Immunol. 2003; 33: 3127-3135Crossref PubMed Scopus (30) Google Scholar, 12Delikouras A Hayes M Malde P Lechler RI Dorling A Nitric oxide-mediated expression of Bcl-2 and Bcl-xl and protection from tumor necrosis factor-alpha-mediated apoptosis in porcine endothelial cells after exposure to low concentrations of xenoreactive natural antibody.Transplantation. 2001; 71: 599-605Crossref PubMed Scopus (41) Google Scholar). More recently, specific upregulation of cytoprotective genes such as nitric oxide synthase, BclXL and indoleamine 2,3 dioxygenase, and a poor in situ expression of immunoglobulin chain gene has been reported for long-term tolerated allografts induced by a 20-day treatment with a deoxyspergualin (DSG) analogue, LF15–0195 (13Heslan JM Renaudin K Thebault P Josien R Cuturi MC Chiffoleau E New evidence for a role of allograft accommodation in long-term tolerance.Transplantation. 2006; 82: 1185-1193Crossref PubMed Scopus (31) Google Scholar). Up-regulation of CD59 in pig endothelial cells after exposure to α-Gal binding lectins has also been reported to confer partial protection against complement-mediated endothelial lysis (14Dalmasso AP Benson BA Johnson JS Lancto C Abrahamsen MS Resistance against the membrane attack complex of complement induced in porcine endothelial cells with a Gal alpha(1–3)Gal binding lectin: up-regulation of CD59 expression.J Immunol. 2000; 164: 3764-3773Crossref PubMed Scopus (80) Google Scholar, 15Grubbs BC Benson BA Dalmasso AP Characteristics of CD59 up-regulation induced in porcine endothelial cells by alphaGal ligation and its association with protection from complement.Xenotransplantation. 2003; 10: 387-397Crossref PubMed Scopus (25) Google Scholar). Microarray studies of accommodated ABO-incompatible renal grafts reported an up-regulation of a different set of genes, including SMADs, protein tyrosine kinases, TNF-alpha and mucin 1 (7Park WD Grande JP Ninova D et al.Accommodation in ABO-incompatible kidney allografts, a novel mechanism of self-protection against antibody-mediated injury.Am J Transplant. 2003; 3: 952-960Crossref PubMed Scopus (171) Google Scholar). It is unclear whether these different gene associations with graft accommodation reflect fundamentally different accommodated states or differences resulting from different analytical approaches. Furthermore, in some of the studies involving human or nonhuman primate tissues, it is unclear whether differences in expression levels were functional or simply served as markers of the accommodated state. To prevent by-stander cells from the deleterious effects of autologous complement activation, endothelial cells express a number of complement regulatory proteins, including the decay accelerating factor (DAF), membrane cofactor protein (MCP) and CD59. In rodent endothelial cells, MCP is replaced by complement receptor-related protein y (Crry), which has overlapping functional features with DAF and MCP (16Colvin RB Smith RN Antibody-mediated organ-allograft rejection.Nat Rev Immunol. 2005; 5: 807-817Crossref PubMed Scopus (399) Google Scholar). Thus, DAF and Crry inhibit complement activation at the C3 and C5 convertase level of both classical and alternative pathways, while CD59 prevents the formation of the membrane attack complex (MAC) (17Baldwin WM Ota H Rodriguez ER Complement in transplant rejection: Diagnostic and mechanistic considerations.Springer Semin Immunopathol. 2003; 25: 181-197Crossref PubMed Scopus (44) Google Scholar, 18Miwa T Zhou L Hilliard B Molina H Song WC Crry, but not CD59 and DAF, is indispensable for murine erythrocyte protection in vivo from spontaneous complement attack.Blood. 2002; 99: 3707-3716Crossref PubMed Scopus (73) Google Scholar, 19Molina H The murine complement regulator Crry: New insights into the immunobiology of complement regulation.Cell Mol Life Sci. 2002; 59: 220-229Crossref PubMed Scopus (45) Google Scholar, 20Lazzeri M Mora M Mulder LC et al.Kidneys derived from mice transgenic for human complement blockers are protected in an in vivo model of hyperacute rejection.J Urol. 1998; 159: 1364-1369Crossref PubMed Scopus (6) Google Scholar, 21McCurry KR Kooyman DL Diamond LE Byrne GW Logan JS Platt JL Transgenic expression of human complement regulatory proteins in mice results in diminished complement deposition during organ xenoperfusion.Transplantation. 1995; 59: 1177-1182Crossref PubMed Scopus (47) Google Scholar). In a porcine-to-primate xenotransplantation model, hyperacute rejection (HAR) is mediated by the binding of xenoreactive natural anti-α-Gal antibodies to galactose α-1,3 galactose (α-Gal) epitopes expressed on endothelial cells (22Oriol R Ye Y Koren E Cooper DK Carbohydrate antigens of pig tissues reacting with human natural antibodies as potential targets for hyperacute vascular rejection in pig-to-man organ xenotransplantation.Transplantation. 1993; 56: 1433-1442Crossref PubMed Scopus (358) Google Scholar). The binding results in the activation of the complement cascade, the destruction of the endothelial cells and thrombus formation in the donor organ vasculature. The transgenic expression of complement regulatory proteins, DAF, MCP and CD59, has been shown to effectively inhibit HAR (23Shimizu I Smith NR Zhao G Medof E Sykes M Decay-accelerating factor prevents acute humoral rejection induced by anti-alpha Gal natura antibodies.Transplantation. 2006; 81: 95-100Crossref PubMed Scopus (30) Google Scholar, 24Luo Y Levy G Ding J et al.HDAF transgenic pig livers are protected from hyperacute rejection during ex vivo perfusion with human blood.Xenotransplantation. 2002; 9: 36-44Crossref PubMed Scopus (17) Google Scholar, 25Mora M Lazzer M Marsicano G et al.An in vivo model of hyperacute rejection: Characterization and evaluation of the effect of transgenic human complement inhibitors.Transgenic Res. 2000; 9: 205-213Crossref PubMed Scopus (1) Google Scholar, 26Verbakel CA Van Duikeren S De Bruin RW Marquet RL JN IJ Human decay-accelerating factor expressed on rat hearts inhibits leukocyte adhesion.Transpl Int. 2003; 16: 168-172Crossref PubMed Scopus (8) Google Scholar, 27Fisicaro N Aminian A Hinchliffe SJ et al.The pig analogue of CD59 protects transgenic mouse hearts from injury by human complement.Transplantation. 2000; 70: 963-968Crossref PubMed Scopus (23) Google Scholar). Thus, we have hypothesized that graft accommodation to pathogenic titers of anti-α-Gal antibodies may be due to the enhanced expression of complement regulatory proteins. We have developed a xenograft accommodation model by transplanting baby Lewis rat hearts into Rag/Galactosyltransferase-deficient mice (Rag/GT dKO mice), and inducing graft accommodation with repeated administrations of low doses of anti-α-Gal IgG1. Graft accommodation induced by anti-α-Gal IgG1 was associated with an increased expression of the protective complement regulatory proteins, DAF, Crry and CD59 on the xenograft endothelium. The protective properties of these regulatory proteins were confirmed with in vitro assays. Rag/GT dKO mice on C57BL/6 background, a gift from Dr. Roland Beulow (Sangstat, Menlo Park, CA), were bred and maintained at The University of Chicago, an AAALAC-accredited facility. Hearts from 10- to 16-day-old Lewis rats (Harlan, Walkersville, MD) were transplanted heterotopically into the abdomen or the cervical area of Rag/GT dKO mice as previously described (28Yin D Zeng H Ma L et al.Cutting Edge: NK cells mediate IgG1-dependent hyperacute rejection of xenografts.J Immunol. 2004; 172: 7235-7238Crossref PubMed Scopus (54) Google Scholar). Xenograft accommodation was induced by i.v. administration of anti-α-Gal IgG1 mAb (150–200 μg/mouse), every other day for 14 days, starting 1 week after the heterotopic cardiac transplantation. The same dose of irrelevant mAb mouse IgG1 (Rockland Immunochemicals, Gilbertsville, PA) was given as negative control. For testing if xenografts were accommodated, mice were given an i.v. challenge of anti-α-Gal IgG1 mAb (300 μg/mouse) or anti-α-Gal IgG3 mAb (250 μg/mouse) on day 22 posttransplant. Anti-α-Gal IgG1 and IgG3-producing hybridoma clones were developed by Xu et al. (29Xu H Sharma A Chen L et al.The structure of anti-Gal immunoglobulin genes in naive and stimulated Gal knockout mice.Transplantation. 2001; 72: 1817-1825Crossref PubMed Scopus (25) Google Scholar) and were grown in protein-free hybridoma medium (Invitrogen, Carlsbad, CA) and purified by saturated ammonium sulfate precipitation, as previously described (30Coligan JE Antibody detection and preparation.in: Coligan JE Kruisbeck AM Margulies DH Shevach EM Shober W Current protocols in immunology. John Wiley & Sons, Hoboken, NJ1995Google Scholar). Both saturated ammonium sulfate and phosphate buffered saline (PBS) for dialysis were made in lipopolysaccharide (endotoxin)-free water. After precipitation of hybridoma culture supernatant with saturated ammonia sulfate overnight at 4◦C, the monoclonal antibodies (mAbs) were collected by centrifugation at 20 000 ×g for 60 min at 4◦C. The purity and the isotype of the anti-Gal mAbs were examined by SDS-PAGE gel and by IsoStrip (Roche, Indianapolis, IN). The protein concentration was determined by a GeneSys spectrophotometer at 280 nm (Thermo Electron Corporation, Milford, MA). Endotoxin level in anti-α-Gal IgG1 was <1 EU/mL as determined by chromogenic end-point LAL assay (QCL-1000) (Cambrex, East Rutherford, NJ). Total cardiac graft RNA was isolated with Trizol reagent (Invitrogen), and 2 μg RNA was digested with 10 U of RNase-free DNase I (Roche) prior to reverse transcription using Omniscript RT kit (Qiagen, Valencia, CA). Quantitative PCR was performed using TaqMan Universal PCR Master. Mix (Applied Biosystems, Foster City, CA), with 40 cycles of amplification (Stratagene MX3000P, La Jolla, CA). Primers and Probes for rat CD59, Crry and GAPDH were designed using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). Primers and probes for rat DAF were designed using ProbeFinder 2.04 at http://www.UniversalProbelibrary.com (Roche Applied Science, Indianapolis, IN). The primers and probes shown below were synthesized by Integrated DNA Technologies (IDT, Coralville, IA) or purchased from Roche). DAF forward primer 5´-CACACCACAGTTAATGTTCCAAG-3´; reverse primer 5´-AACCATGCTGGGTTTCTGAG-3´; rat probe #43 for DAF detection (Roche); Crry forward primer 5´-ATTGGTTCCTCCTCTGCTATGTGC-3; reverse primer 5´-GCATCAGTGTTGCACTGGTAGGTA-3´; Crry probe 5´-56 FAMTGCTGGT GACCT CGGTTCTGGCGGCCATTT36-TAMSp-3´; CD59 forward primer 5´-TGAGCCGACTAGAAATCGCAAACG-3´; reverse primer 5´-AAGAAAGGAGGCATCGGGAGCTTA-3´, and CD59 probe 5´-56-FAMAGCGTTGCCT GGGATGCCGAGGCACCTATT36-TAMSp-3´. GAPDH forward primer 5´- AATATGGCTACAGCAACAGGGTGG-3´; reverse primer 5´-TCTGGGATGGAATTGTGAGGGAGA-3´, and GAPDH probe 5´-56 FAMAAACCCTGGA CCACCCAGCCCAGCAAGGAT36-TAMSp-3´. The real-time PCR results were analyzed using the sequence detection system software version 2.0 (Stratagene) and RNA expression levels were calculated using the comparative Ct method (∆∆Ct) (31Overbergh L Giulietti A Valckx D Decallonne R Bouillon R Mathieu C The use of real-time reverse transcriptase PCR for the quantification of cytokine gene expression.J Biomol Tech. 2003; 14: 33-43PubMed Google Scholar). The ∆∆Ct validation experiments showed similar amplification efficiency for all templates used (difference between line slopes for all templates <0.1). Rat glomerular endothelial cells (RGE) (a kind gift from Dr. Richard J. Quigg, The University of Chicago) (32Laulajainen T Julkunen I Haltia A Knuutila S Miettinen A Holthofer H Establishment and characterization of a rat glomerular endothelial cell line.Lab Invest. 1993; 69: 183-192PubMed Google Scholar) were cultured in endotoxin-free RPMI1640 containing 10% fetal bovine serum and 10% Nuserum (BD Bioscience, La Jolla, CA) at 37◦C with 5% CO2. To mimic the in vivo accommodation regimen, RGE were treated with 30 μg/mL of anti-α Gal IgG1 for the time points as indicated. RGE were washed twice with cold PBS prior to recovering in RIPA buffer containing 1 mM Na3VO4, 1 mM PMSF, and 1 μg/mL of aprotinin, leupeptin each, respectively. RGE lysate was collected after centrifugation at 12 000 ×g for 15 min at 4◦C, and was electrophoresed in 6–12% SDS PAGE gel, followed by protein transfer to PVC membrane (Immobilon-P, Millipore, Bedford, MA). The membranes were immunoblotted with anti-rat DAF or anti-rat CD59 (Santa Cruz Biotechnologies, Santa Cruz, CA) and anti-rat Crry (BD Bioscience) overnight at 4◦C, and were detected with HRP-conjugated secondary antibodies (Santa Cruz). Chemiluminescence was developed by incubating the membrane with SuperSignal Pico West substrate (Pierce, Rockford, IL), and exposing to Kodak x-ray film (Rochester, NY). Anti-α-Gal IgG1 treated for 24 h or nontreated RGE in 96 well plates were washed twice with Hank’s buffer salt solution (HBSS), and were then incubated in RPMI1640 containing 5% human serum for 60 min at 37◦C. In other experiments, anti-α-Gal IgG1-treated RGE were incubated with 50 μg/mL of anti-α-Gal IgG3 mAb plus 5% baby rabbit serum (Cedarlane Laboratories, Hornby, Ontario, Canada), as complement source for 60 min at 37◦C. The RGE culture supernatants were then transferred to a new 96 well plate and the degree of cell lysis was quantitated by a lactic dehydrogenase (LDH) assay (Sigma Chemical Co., St. Louis, MO) following the manufacturer’s instruction. RGE cultured in 96 well plates were treated with 30 μg/mL of anti-α-Gal IgG1 for 24 h. After two washes with HBSS, 50 μg/mL of biotinylated anti-α-Gal IgG3 was added followed by streptavidin-HRP (BD Bioscience). After the addition of the HRP substrate, ABTS solution (KPL, Gaithersburg, MD), the O.D. was read at 410 nm. Immunohistochemistry was performed with a modified avidin-biotin peroxidase method as described previously (33Xu H Sharma A Lei Y et al.Development and characterization of anti-Gal B cell receptor transgenic Gal-/- mice.Transplantation. 2002; 73: 1549-1557Crossref PubMed Scopus (10) Google Scholar). The antibodies used were: goat anti-C3 and anti-C5 and rabbit anti-von Willibrand factor (vWF) polyclonal antibodies from DAKO (Carpinteria, CA), mouse anti-rat DAF and CD59 (kind gifts from Dr. B Paul Morgan, University of Wales College of Medicine, Cardiff, UK), anti-Crry (BD Bioscience), biotinylated rabbit anti-goat IgG (Vector Laboratories, Burlingame, CA), biotinylated goat anti-rabbit IgG (BD Bioscience), and HRP-streptavidin (Zymed Laboratories, South San Francisco, CA). Both anti-rat DAF and anti-rat CD59 mAbs were biotinylated using a Fluo-Reporter-Mini-Biotin-XX kit from Molecular Probes (BD Bioscience). The data were presented as mean ± standard deviation of the mean (SD). The DAF, Crry and CD59 data were analyzed with a Student’s t-test (GraphPad Prism 4, GraphPad Software, Inc, San Diego, CA). We have reported that a single high-dose of anti-α-Gal IgG1 mAb (≤250 μg/mouse) can induce the HAR of rat hearts in a complement- and FcγR/NK-dependent manner (28Yin D Zeng H Ma L et al.Cutting Edge: NK cells mediate IgG1-dependent hyperacute rejection of xenografts.J Immunol. 2004; 172: 7235-7238Crossref PubMed Scopus (54) Google Scholar). Numerous reports have suggested that a gradual increase in the titers of anti-graft antibodies, as a result of immunosuppression alone or in combination with plasmapheresis, can result in graft accommodation (6Lin Y Soares MP Sato K et al.Accommodated xenografts survive in the presence of anti-donor antibodies and complement that precipitate rejection of naive xenografts.J Immunol. 1999; 163: 2850-2857Crossref PubMed Google Scholar, 7Park WD Grande JP Ninova D et al.Accommodation in ABO-incompatible kidney allografts, a novel mechanism of self-protection against antibody-mediated injury.Am J Transplant. 2003; 3: 952-960Crossref PubMed Scopus (171) Google Scholar, 34Norden G Briggs D Cockwell P et al.ABO-incompatible live donor renal transplantation using blood group A/B carbohydrate antigen immunoadsorption and anti-CD20 antibody treatment.Xenotransplantation. 2006; 13: 148-153Crossref PubMed Scopus (45) Google Scholar). We treated recipients of rat cardiac xenografts with seven repeated i.v. injections of low-dose anti-α-Gal IgG1 mAb (150–200 μg/mouse). Seventy-five percent of the xenografts survived this regimen for ≥15 days, and continued to survive ≥100 days if the experiment was not terminated (data not shown) (Figure 1A). This regimen of repeated anti-α-Gal IgG1 mAb administration resulted in a significant elevation in circulating anti-α-Gal IgG1 titers (Figure 1B), reaching levels higher than those capable of inducing HAR if the anti-α-Gal IgG1 mAb was administered as a single bolus dose (500 μg/mouse). We therefore hypothesized from these observations that the grafts had achieved an accommodated state. We had previously reported that anti-α-Gal IgG1-mediated HAR is dependent on FcγR-mediated events (28Yin D Zeng H Ma L et al.Cutting Edge: NK cells mediate IgG1-dependent hyperacute rejection of xenografts.J Immunol. 2004; 172: 7235-7238Crossref PubMed Scopus (54) Google Scholar), raising the possibility that these events may be desensitized by the circulating anti-α-Gal IgG1. To investigate whether the resistance to rejection, despite high titers of circulating anti-α-Gal IgG1, was due to alterations in the xenograft or desensitization of FcγR-mediated events, a second baby Lewis rat cardiac graft was transplanted to the cervical area of the mouse bearing the first (accommodated) cardiac graft (Figure 1D). The freshly-transplanted, second graft succumbed to HAR induced by the high titers of circulating anti-α-Gal IgG1 mAbs, while the first graft continued to function normally (Figures 1D and 2). These results suggested that alterations in the xenograft but not desensitization of FcγR-mediated events are the basis for normal xenograft function in the face of high titers of anti-α-Gal IgG1. To further confirm the successful induction of xenograft accommodation, the mice bearing the accommodated grafts were challenged with a rejection dose of 300 μg/mouse of anti-α-Gal IgG1. All xenografts preexposed to repeated anti-α-Gal IgG1 treatment continued to function normally, whereas xenografts that received either repeated saline or mouse mAb control IgG1 injections succumbed to HAR (Figure 1C). Mouse mAb control IgG1 and saline-treated control grafts demonstrated typical signs of HAR, including edema and thrombosis (20–30 min after anti-α-Gal IgG1 administration; data not shown). In contrast, accommodated grafts at 20–30 min after the administration of the 300 μg/mouse of anti-α-Gal IgG1 revealed normal histology without thrombus formation, as demonstrated by vWF staining, despite significant levels of IgG1 deposition on graft endothelial cells (Figure 2). These experiments confirm, at the histo-pathological level, that repeated administration of anti-α-Gal IgG1 induces xenograft accommodation. Next, we tested whether xenograft accommodation by anti-α-Gal IgG1 mAb also protected against rejection induced by anti-α-Gal IgG3 mAb, which has a comparable, but not identical, fine epitope-specificity. When accommodated grafts were treated with a lower dose (50 μg/mouse) of anti-α-Gal IgG3 mAb, all grafts survived. Nonaccommodated grafts, however, were all rejected by the same low dose of anti-α-Gal IgG3 mAb (Figure 1E). When the accommodated xenografts were challenged with a bolus injection of high-dose anti-α-Gal IgG3 mAb (Figure 1F), the accommodated xenografts succumbed to HAR. These latter observations suggest that the Gal-epitope is still retained by the accommodated xenografts, which is consistent with previous reports arguing against the loss of endothelial cell antigen in models of rejection and accommodation (35Parker W Holzknecht ZE Song A et al.Fate of antigen in xenotransplantation: Implications for acute vascular rejection and accommodation.Am J Pathol. 1998; 152: 829-839PubMed Google Scholar). We have previously reported that anti-α-Gal IgG1-mediated HAR is dependent on both complement activation and FcγR/NK-dependent events, and that blocking of either event is sufficient to inhibit IgG1-mediated HAR (28Yin D Zeng H Ma L et al.Cutting Edge: NK cells mediate IgG1-dependent hyperacute rejection of xenografts.J Immunol. 2004; 172: 7235-7238Crossref PubMed Scopus (54) Google Scholar). This dependence on both complement and FcγR is in contrast to IgG3-mediated HAR, which is only dependent on complement HAR (28Yin D Zeng H Ma L et al.Cutting Edge: NK cells mediate IgG1-dependent hyperacute rejection of xenografts.J Immunol. 2004; 172: 7235-7238Crossref PubMed Scopus (54) Google Scholar). We, therefore, set out to test the hypothesis that xenograft accommodation induced by the repeated administration of anti-α-Gal IgG1 could be a result of the inhibition of complement regulation by increased expression of complement regulatory proteins. We examined the gene expression of DAF, Crry and CD59 in anti-α-Gal IgG1-treated versus saline-treated xenografts by quantitative real-time PCR. The gene expression of DAF, Crry and CD59 increased by 15 (p = 0.00127), 13.6 (p = 0.0011) and 2.3 (p = 0.0988) fold, respectively, in IgG1-accommodated xenografts (n = 8) above the level of normal cardiac tissues (not treated), whereas the expression of these complement regulatory protein genes remained at baseline levels in saline-treated controls (n = 5) (Figure 3). Immunohistochemical analyses confirmed increased DAF, Crry and CD59 staining on the endothelium of the accommodated grafts (Figure 4A). Collectively, these data suggest that the up-regulation of DAF and Crry, and to a lesser extent CD59 is associated with anti-α-Gal IgG1-mediated xenograft accommodation. Functional DAF and Crry in tissues should prevent the assembly of C3 and C5 convertases, leading to higher amount of C3d but minimal or no deposition of C3 and C5. Immunohistochemical staining showed prominent IgG1- (Figure 2) and C3d-deposition, but minimal or no detectable C3 and C5 in the accommodated grafts (Figure 4B). In contrast, second hearts which underwent anti-α-Gal IgG1-mediated rejection stained strongly for C3-, C3d-, C5- deposition on the graft endothelium, and had comparable levels of IgG1 deposition as in the accommodated grafts.Figure 4Immunohistochemical staining of DAF, Crry and CD59. (A) Accommodated grafts expressed higher levels of DAF, Crry and CD59 compared to saline-treated grafts. (B) Accommodated grafts C3d deposition showed C3d deposition but minimal or no C3, C3d and C5 deposition in endothelial cells. Rejected second grafts exhibited increased C3, C3d and C5 deposition. These are representative images from at least four grafts/treatment group.View Large Image Figure ViewerDownload Hi-res image" @default.
• W1974846879 created "2016-06-24" @default.
• W1974846879 creator A5004584175 @default.
• W1974846879 creator A5027563261 @default.
• W1974846879 creator A5031470939 @default.
• W1974846879 creator A5031937707 @default.
• W1974846879 creator A5037968723 @default.
• W1974846879 creator A5058436123 @default.
• W1974846879 creator A5074701713 @default.
• W1974846879 creator A5090706571 @default.
• W1974846879 creator A5091360661 @default.
• W1974846879 date "2008-01-01" @default.
• W1974846879 modified "2023-10-18" @default.
• W1974846879 title "Expression of Complement Regulatory Proteins in Accommodated Xenografts Induced by Anti-α-Gal IgG1 in a Rat-to-Mouse Model" @default.
• W1974846879 cites W1520421562 @default.
• W1974846879 cites W1537865643 @default.
• W1974846879 cites W1622626646 @default.
• W1974846879 cites W1969225807 @default.
• W1974846879 cites W1975434993 @default.
• W1974846879 cites W1994844958 @default.
• W1974846879 cites W1998499070 @default.
• W1974846879 cites W1999142150 @default.
• W1974846879 cites W2004900499 @default.
• W1974846879 cites W2004933260 @default.
• W1974846879 cites W2006244866 @default.
• W1974846879 cites W2016221128 @default.
• W1974846879 cites W2039035169 @default.
• W1974846879 cites W2041288261 @default.
• W1974846879 cites W2045533937 @default.
• W1974846879 cites W2051629198 @default.
• W1974846879 cites W2052938585 @default.
• W1974846879 cites W2057629807 @default.
• W1974846879 cites W2060109555 @default.
• W1974846879 cites W2063137496 @default.
• W1974846879 cites W2065472938 @default.
• W1974846879 cites W2070935688 @default.
• W1974846879 cites W2078170761 @default.
• W1974846879 cites W2081126815 @default.
• W1974846879 cites W2084976001 @default.
• W1974846879 cites W2085403237 @default.
• W1974846879 cites W2086073247 @default.
• W1974846879 cites W2087821203 @default.
• W1974846879 cites W2109226017 @default.
• W1974846879 cites W2118408297 @default.
• W1974846879 cites W2122208438 @default.
• W1974846879 cites W2139077483 @default.
• W1974846879 cites W2150495666 @default.
• W1974846879 cites W2170231805 @default.
• W1974846879 cites W221749636 @default.
• W1974846879 cites W4234127884 @default.
• W1974846879 doi "https://doi.org/10.1111/j.1600-6143.2007.02016.x" @default.
• W1974846879 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17973967" @default.
• W1974846879 hasPublicationYear "2008" @default.
• W1974846879 type Work @default.
• W1974846879 sameAs 1974846879 @default.
• W1974846879 citedByCount "29" @default.
• W1974846879 countsByYear W19748468792012 @default.
• W1974846879 countsByYear W19748468792013 @default.
• W1974846879 countsByYear W19748468792014 @default.
• W1974846879 countsByYear W19748468792017 @default.
• W1974846879 countsByYear W19748468792018 @default.
• W1974846879 countsByYear W19748468792019 @default.
• W1974846879 countsByYear W19748468792020 @default.
• W1974846879 countsByYear W19748468792022 @default.
• W1974846879 countsByYear W19748468792023 @default.
• W1974846879 crossrefType "journal-article" @default.
• W1974846879 hasAuthorship W1974846879A5004584175 @default.
• W1974846879 hasAuthorship W1974846879A5027563261 @default.
• W1974846879 hasAuthorship W1974846879A5031470939 @default.
• W1974846879 hasAuthorship W1974846879A5031937707 @default.
• W1974846879 hasAuthorship W1974846879A5037968723 @default.
• W1974846879 hasAuthorship W1974846879A5058436123 @default.
• W1974846879 hasAuthorship W1974846879A5074701713 @default.
• W1974846879 hasAuthorship W1974846879A5090706571 @default.
• W1974846879 hasAuthorship W1974846879A5091360661 @default.
• W1974846879 hasBestOaLocation W19748468791 @default.
• W1974846879 hasConcept C104317684 @default.
• W1974846879 hasConcept C111684460 @default.
• W1974846879 hasConcept C112313634 @default.
• W1974846879 hasConcept C127716648 @default.
• W1974846879 hasConcept C159654299 @default.
• W1974846879 hasConcept C188082640 @default.
• W1974846879 hasConcept C203014093 @default.
• W1974846879 hasConcept C54355233 @default.
• W1974846879 hasConcept C71924100 @default.
• W1974846879 hasConcept C86803240 @default.
• W1974846879 hasConcept C95444343 @default.
• W1974846879 hasConceptScore W1974846879C104317684 @default.
• W1974846879 hasConceptScore W1974846879C111684460 @default.
• W1974846879 hasConceptScore W1974846879C112313634 @default.
• W1974846879 hasConceptScore W1974846879C127716648 @default.
• W1974846879 hasConceptScore W1974846879C159654299 @default.
• W1974846879 hasConceptScore W1974846879C188082640 @default.
• W1974846879 hasConceptScore W1974846879C203014093 @default.
• W1974846879 hasConceptScore W1974846879C54355233 @default.
• W1974846879 hasConceptScore W1974846879C71924100 @default.
• W1974846879 hasConceptScore W1974846879C86803240 @default.
• W1974846879 hasConceptScore W1974846879C95444343 @default.

• next