FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1975017167> ?p ?o ?g. }

• W1975017167 endingPage "29512" @default.
• W1975017167 startingPage "29501" @default.
• W1975017167 abstract "Phospholipase Cϵ (PLCϵ) is a newly described effector of the small GTP-binding protein H-Ras. Utilizing H-Ras effector mutants, we show that mutants H-Ras(G12V/E37G) and H-Ras(G12V/D38N) suppressed integrin activation in an ERK-independent manner. H-Ras(G12V/D38N) specifically activated the PLCϵ effector pathway and suppressed integrin activation. Inhibition of PLCϵ activation with a kinase-dead PLCϵ mutant prevented H-Ras(G12V/D38N) from suppressing integrin activation, and low level expression of H-Ras(G12V/D38N) could synergize with wild-type PLCϵ to suppress integrins. In addition, knockdown of endogenous PLCϵ with small interfering RNA blocked H-Ras(G12V/D38N)-mediated integrin suppression. Suppressing integrin function with the H-Ras(G12V/D38N) mutant reduced cell adhesion to von Willebrand factor and fibronectin; this reduction in cell adhesion was blocked by coexpression of the kinase-dead PLCϵ mutant. These results show that H-Ras suppresses integrin affinity via independent Raf and PLCϵ signaling pathways and demonstrate a new physiological function for PLCϵ in the regulation of integrin activation. Phospholipase Cϵ (PLCϵ) is a newly described effector of the small GTP-binding protein H-Ras. Utilizing H-Ras effector mutants, we show that mutants H-Ras(G12V/E37G) and H-Ras(G12V/D38N) suppressed integrin activation in an ERK-independent manner. H-Ras(G12V/D38N) specifically activated the PLCϵ effector pathway and suppressed integrin activation. Inhibition of PLCϵ activation with a kinase-dead PLCϵ mutant prevented H-Ras(G12V/D38N) from suppressing integrin activation, and low level expression of H-Ras(G12V/D38N) could synergize with wild-type PLCϵ to suppress integrins. In addition, knockdown of endogenous PLCϵ with small interfering RNA blocked H-Ras(G12V/D38N)-mediated integrin suppression. Suppressing integrin function with the H-Ras(G12V/D38N) mutant reduced cell adhesion to von Willebrand factor and fibronectin; this reduction in cell adhesion was blocked by coexpression of the kinase-dead PLCϵ mutant. These results show that H-Ras suppresses integrin affinity via independent Raf and PLCϵ signaling pathways and demonstrate a new physiological function for PLCϵ in the regulation of integrin activation. Integrins are heterodimeric glycoproteins that control cell-cell and cell-substratum adhesion and that regulate cell survival, proliferation, and migration (1Hynes R.O. Cell. 1992; 69: 11-25Abstract Full Text PDF PubMed Scopus (9014) Google Scholar). An essential feature of integrins is their ability to regulate the strength of ligand binding, a process termed affinity modulation (2Hughes P.E. Pfaff M. Trends Cell Biol. 1998; 8: 359-364Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar). Various intracellular signals can induce a conformational change in the integrin heterodimer, activating or suppressing ligand binding. Members of the Ras family of small GTP-binding proteins have been shown to modulate integrin affinity (2Hughes P.E. Pfaff M. Trends Cell Biol. 1998; 8: 359-364Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar). Expression of a constitutively active mutant of H-Ras, H-Ras(G12V), in Chinese hamster ovary (CHO) 5The abbreviations used are: CHO, Chinese hamster ovary; ERK, extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinase; MKP, MAPK phosphatase; GEFs, guanine exchange factors; GAP, GTPase-activating protein; PLCϵ, phospholipase Cϵ; PI-PLC, phosphoinositide-specific phospholipase C; IP3, inositol 1,4,5-trisphosphate; PH, pleckstrin homology; SH, Src homology; RA, H-Ras/Rap1-associating; HA, hemagglutinin; DMEM, Dulbecco's modified Eagle's medium; siRNA, small interfering RNA; GST, glutathione S-transferase; FN, fibronectin; PBS, phosphate-buffered saline; AI, activation index; vWF, von Willebrand factor; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase. cells suppresses integrin activation (3Hughes P.E. Renshaw M.W. Pfaff M. Forsyth J. Keivens V.M. Schwartz M.A. Ginsberg M.H. Cell. 1997; 88: 521-530Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar). In addition, activation of the H-Ras downstream effector Raf also suppresses integrin activation in CHO cells (3Hughes P.E. Renshaw M.W. Pfaff M. Forsyth J. Keivens V.M. Schwartz M.A. Ginsberg M.H. Cell. 1997; 88: 521-530Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar, 4Sethi T. Ginsberg M.H. Downward J. Hughes P.E. Mol. Biol. Cell. 1999; 10: 1799-1809Crossref PubMed Scopus (87) Google Scholar). In contrast, R-Ras, a closely related member of the Ras superfamily, activates integrins and reverses H-Ras-mediated suppression of integrin affinity (4Sethi T. Ginsberg M.H. Downward J. Hughes P.E. Mol. Biol. Cell. 1999; 10: 1799-1809Crossref PubMed Scopus (87) Google Scholar, 5Zhang Z. Vuori K. Wang H. Reed J.C. Ruoslahti E. Cell. 1996; 85: 61-69Abstract Full Text Full Text PDF PubMed Scopus (378) Google Scholar). Activation of Raf by H-Ras leads to the phosphorylation and activation of ERK1/2. H-Ras-mediated suppression of integrin affinity can be reversed by expression of MAPK phosphatase-1 (MKP-1), which can dephosphorylate and inactivate ERK1/2 (3Hughes P.E. Renshaw M.W. Pfaff M. Forsyth J. Keivens V.M. Schwartz M.A. Ginsberg M.H. Cell. 1997; 88: 521-530Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar). However, studies using H-Ras/R-Ras chimeras have revealed that integrin affinity modulation does not precisely correlate with ERK1/2 activation (6Hansen M. Rusyn E.V. Hughes P.E. Ginsberg M.H. Cox A.D. Willumsen B.M. Oncogene. 2002; 21: 4448-4461Crossref PubMed Scopus (16) Google Scholar, 7Hughes P.E. Oertli B. Hansen M. Chou F.-L. Willumsen B.M. Ginsberg M.H. Mol. Biol. Cell. 2002; 13: 2256-2265Crossref PubMed Scopus (41) Google Scholar). Remarkably, although targeting of ERK1 to the plasma membrane has been shown to be sufficient to suppress integrins (8Chou F.-L. Hill J.M. Hsieh J.-C. Pouyssegur J. Brunet A. Glading A. Überall F. Ramos J.W. Werner M.H. Ginsberg M.H. J. Biol. Chem. 2003; 278: 52587-52597Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar), inhibition of ERK1/2 activation with either MKP-3 or U0126 fails to affect integrin suppression by H-Ras (7Hughes P.E. Oertli B. Hansen M. Chou F.-L. Willumsen B.M. Ginsberg M.H. Mol. Biol. Cell. 2002; 13: 2256-2265Crossref PubMed Scopus (41) Google Scholar). This discrepancy in the current data might therefore be explained by the demonstration of an alternative pathway for integrin suppression that does not rely on ERK1/2 activation. Several effector pathways are activated by H-Ras in addition to Raf, including phosphatidylinositol 3-kinase and Ral guanine exchange factors (GEFs). Amino acid substitution mutants of H-Ras have been extensively utilized in dissecting its downstream effector pathways. The effector mutant T35S retains its ability to activate Raf, whereas mutants E37G and Y40C are Raf-independent and activate Ral GEFs and phosphatidylinositol 3-kinase, respectively (9White M.A. Nicolette C. Minden A. Polverino A. Van A. Karin M. Wigler M.H. Cell. 1995; 80: 533-541Abstract Full Text PDF PubMed Scopus (628) Google Scholar, 10Rodriguez-Viciana P. Warne P.H. Khwaja A. Marte B.M. Pappin D. Das P. Waterfield M.D. Ridley A. Downward J. Cell. 1997; 89: 457-467Abstract Full Text Full Text PDF PubMed Scopus (960) Google Scholar). These H-Ras mutants also display differential action upon other H-Ras effectors, including Rin-1, AF-6, protein kinase Cϵ, p120 GTPase-activating protein (GAP) (11Diaz-Meco M.T. Lozano J. Municio M.M. Berra E. Frutos S. Sanz L. Moscat J. J. Biol. Chem. 1994; 269: 31706-31710Abstract Full Text PDF PubMed Google Scholar, 12Han L. Colicelli J. Mol. Cell. Biol. 1995; 15: 1318-1323Crossref PubMed Google Scholar, 13Kuriyama M. Harada N. Kuroda S. Yamamoto T. Nakafuku M. Iwamatsu A. Yamamoto D. Prasad R. Croce C. Canaani E. Kaibuchi K. J. Biol. Chem. 1996; 271: 607-610Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar, 14Leblanc V. Tocque B. Delumeau I. Mol. Cell. Biol. 1998; 18: 5567-5578Crossref PubMed Scopus (62) Google Scholar), and, recently, phospholipase Cϵ (PLCϵ) (15Kelley G.G. Reks S.E. Ondrako J.M. Smrcka A.V. EMBO J. 2001; 20: 743-754Crossref PubMed Scopus (302) Google Scholar, 16Song C. Hu C.-D. Masago M. Kariya K.-I. Yamawaki-Kataoka Y. Shibatohge M. Wu D. Satoh T. Kataoka T. J. Biol. Chem. 2001; 276: 2752-2757Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar, 17Lopez I. Mak E.C. Ding J. Hamm H.E. Lomasney J.W. J. Biol. Chem. 2001; 276: 2758-2765Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar). Phosphoinositide-specific phospholipase C (PI-PLC) catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate into the second messengers diacylglycerol and inositol 1,4,5-trisphosphate (IP3). Diacylglycerol stimulates protein kinase C activation, and IP3 mobilizes intracellular Ca2+ (18Berridge M.J. Irvine R.F. Nature. 1989; 341: 197-205Crossref PubMed Scopus (3312) Google Scholar). Three major classes of PI-PLC have previously been identified: PLCβ, PLCγ, and PLCδ (19Majerus P.W. Ross T.S. Cunningham T.W. Caldwell K.K. Jefferson A.B. Bansal V.S. Cell. 1990; 63: 459-465Abstract Full Text PDF PubMed Scopus (204) Google Scholar). They contain an N-terminal pleckstrin homology (PH) domain, an EF-hand domain, catalytic X and Y domains, and the regulatory C2 domain. PLCγ contains another PH domain, which is split by two SH2 domains and one SH3 domain. These PI-PLC classes are activated by distinct signaling mechanisms (20Rhee S.G. Annu. Rev. Biochem. 2001; 70: 281-312Crossref PubMed Scopus (1220) Google Scholar). PLCβ is activated by the α subunit (Gα) or βγ subunits (Gβγ) of heterotrimeric G proteins. PLCγ is activated by tyrosine phosphorylation following binding to tyrosine kinases of receptor or non-receptor types through its SH2 domain. PLCδ is activated by the high molecular weight G protein Gh and/or by an increase in the concentration of intracellular Ca2+. Recently, a fourth class of PI-PLC was identified, PLCϵ (15Kelley G.G. Reks S.E. Ondrako J.M. Smrcka A.V. EMBO J. 2001; 20: 743-754Crossref PubMed Scopus (302) Google Scholar, 16Song C. Hu C.-D. Masago M. Kariya K.-I. Yamawaki-Kataoka Y. Shibatohge M. Wu D. Satoh T. Kataoka T. J. Biol. Chem. 2001; 276: 2752-2757Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar, 17Lopez I. Mak E.C. Ding J. Hamm H.E. Lomasney J.W. J. Biol. Chem. 2001; 276: 2758-2765Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar, 21Shibatohge M. Kariya K.-I. Liao Y. Hu C.-D. Watari Y. Goshima M. Shima F. Kataoka T. J. Biol. Chem. 1998; 273: 6218-6222Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). PLCϵ shares the typical X, Y, and C2 domains with the other PI-PLC classes. PLCϵ also contains putative PH and EF-hand domains and is activated by Gβγ subunits (22Wing M.R. Houston D. Kelley G.G. Der C.J. Siderovski D.P. Harden T.K. J. Biol. Chem. 2001; 276: 48257-48261Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). Furthermore, PLCϵ is unique in that it possesses two types of functional domains not seen in other classes. At its N terminus, PLCϵ possesses a CDC25 homology domain (a GEF domain for the Ras family of small G proteins), which exhibits GEF activity toward Rap1 and H-Ras (17Lopez I. Mak E.C. Ding J. Hamm H.E. Lomasney J.W. J. Biol. Chem. 2001; 276: 2758-2765Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar, 23Boguski M.S. McCormick F. Nature. 1993; 366: 643-654Crossref PubMed Scopus (1761) Google Scholar, 24Jin T.-G. Satoh T. Liao Y. Song C. Gao X. Kariya K.-I. Hu C.-D. Kataoka T. J. Biol. Chem. 2001; 276: 30301-30307Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). At its C terminus, PLCϵ possesses two H-Ras/Rap1-associating (RA) domains, RA1 and RA2. H-Ras binds to PLCϵ in a GTP-dependent manner through its RA2 domain to stimulate the hydrolysis of phosphatidylinositol 4,5-bisphosphate into the secondary messengers IP3 and diacylglycerol, suggesting that PLCϵ may be a downstream effector of H-Ras and Rap1 (15Kelley G.G. Reks S.E. Ondrako J.M. Smrcka A.V. EMBO J. 2001; 20: 743-754Crossref PubMed Scopus (302) Google Scholar, 16Song C. Hu C.-D. Masago M. Kariya K.-I. Yamawaki-Kataoka Y. Shibatohge M. Wu D. Satoh T. Kataoka T. J. Biol. Chem. 2001; 276: 2752-2757Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar, 17Lopez I. Mak E.C. Ding J. Hamm H.E. Lomasney J.W. J. Biol. Chem. 2001; 276: 2758-2765Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar). Despite the characterization of these domains within PLCϵ, its physiological function remains unknown. However, given the signaling attributes and wide tissue distribution of PLCϵ, it is likely that this protein has a critical role in mammalian physiology. We therefore examined whether H-Ras utilizes PLCϵ to suppress integrins in cells and thus modulate cell adhesion to the extracellular matrix. Antibodies—Antibodies were obtained from the indicated sources: antibody PAC-1 (activation-specific αIIbβ3) from BD Biosciences (Oxford, UK); R-phycoerythrin-conjugated anti-Tac antibody (ACT-1) and all horseradish peroxidase-conjugated species-specific antibodies from Dako (Cambridgeshire, UK); fluorescein isothiocyanate-conjugated anti-mouse IgM from BIOSOURCE (Nivelles, Belgium); anti-hemagglutinin (HA) (Y-11), anti-Myc (9E10), anti-ERK2 (C-14), and anti-PLCϵ (V-20) antibodies from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); anti-phospho-Thr115 ERK1/2, anti-actin (AC-40), and anti-FLAG (M2) antibodies from Sigma (Dorset, UK); and anti-RalA antibody from BD Transduction Laboratories. DNA Constructs—Tac-α5 (the extracellular domain of the interleukin-2 receptor fused to the intracellular domain of α5 integrin) was obtained from Susan E. LaFlamme (Center for Cell Biology and Cancer Research, Albany, NY), and pDCR-H-Ras (G12V and effector mutants) was obtained from Michael H. Wigler (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). Johannes L. Bos (University of Utrecht, Utrecht, The Netherlands) provided pMT2-RalA (wild-type, G23V, and S28N), which was subsequently subcloned into pcDNA3.1 (Invitrogen, Paisley, UK), and pGEX-RalBD. Jean de Gunzburg (INSERM U-528, Paris, France) provided pRK-Rap1A(S17N). Alfred Wittinghofer (Max-Planck-Institut, Dortmund, Germany) donated pGEX-Rap1GAP-(75–415). The Rap1GAP-(75–415) insert was subcloned into pCMV-Tag-3B (Stratagene) to incorporate an N-terminal Myc tag. pCMV-Script-PLCϵ (wild-type and kinase-dead (H1433L)) was provided by Grant G. Kelley (State University of New York Upstate Medical University, Syracuse, NY). pEGFP-C3 was purchased from Clontech (Basingstoke, UK). The D38N mutation was introduced into pDCR-H-Ras(G12V) by site-directed mutagenesis. Cell Lines and Transfection—The CHO(αβ-py) cell line stably expresses a chimeric integrin composed of αIIbα6Aβ3β1 (3Hughes P.E. Renshaw M.W. Pfaff M. Forsyth J. Keivens V.M. Schwartz M.A. Ginsberg M.H. Cell. 1997; 88: 521-530Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar, 4Sethi T. Ginsberg M.H. Downward J. Hughes P.E. Mol. Biol. Cell. 1999; 10: 1799-1809Crossref PubMed Scopus (87) Google Scholar). CHO-K1 cells were obtained from American Type Culture Collection. Cells were maintained in Dulbecco's modified Eagle's medium (DMEM; Sigma) supplemented with 10% (v/v) fetal bovine serum, 1% l-glutamine, 1% penicillin/streptomycin, and 1% nonessential amino acids. CHO(αβ-py) cells were also maintained in G418 antibiotic at 400 μg/ml (Invitrogen). Serum-free medium was used to quiesce cells. Transient transfection of cells with plasmid DNA was performed with Lipofectamine™ Plus reagent (Invitrogen) following the manufacturer's instructions. Twenty-four hours after transfection, the medium containing DNA-Lipofectamine complexes was removed and replaced with fresh complete medium. For experiments when protein activity was to be assessed, the transfection medium was replaced with quiescent medium. Forty-eight hours after transfection, cells were either lysed for SDS-PAGE analyses or used for integrin affinity determination. Small Interfering RNA (siRNA) of PLCϵ—Kelley et al. (25Kelley G.G. Kaproth-Joslin K.A. Reks S.E. Smrcka A.V. Wojcikiewicz R.J. J. Biol. Chem. 2006; 281: 2639-2648Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar) have previously described rat PLCϵ-specific siRNA oligonucleotides that effectively knock down PLCϵ in rat cells and scrambled non-targeting controls. To assess the whether these siRNA oligonucleotides could be used in CHO cells, we amplified the corresponding regions of siRNAPLCϵ#3 and siR-NAPLCϵ#5 from CHO cDNA by reverse transcription-PCR using primers based on consensus rat/mouse PLCϵ sequence. The respective 616- and 380-bp products were gel-purified and sequenced. We confirmed that the region targeted by siR-NAPLCϵ#3 and siRNAPLCϵ#5 was 100% conserved in CHO cells. Thus, we used these siRNA oligonucleotides to knock down PLCϵ in CHO cells. Transient transfection of cells with siRNA was performed with Oligofectamine (Invitrogen) following the manufacturer's instructions. Twenty-four hours after transfection, the medium containing siRNA-Oligofectamine complexes was removed and replaced with fresh complete medium. Cells were then transfected with plasmid constructs using Lipofectamine as indicated below. Seventy-two hours after siRNA transfection, cells were either lysed for RNA extraction or protein analysis or used for integrin affinity determination. Fibronectin Type III Repeat 9–11 Fragment—The soluble type III repeats 9–11 of fibronectin (referred to as FN9–11), which contain the RGD domain responsible for integrin binding, were expressed as a glutathione S-transferase (GST) fusion protein in Escherichia coli BL21 cells from the pGEX-4T2 vector and biotinylated as described previously (7Hughes P.E. Oertli B. Hansen M. Chou F.-L. Willumsen B.M. Ginsberg M.H. Mol. Biol. Cell. 2002; 13: 2256-2265Crossref PubMed Scopus (41) Google Scholar, 26Ramos J.W. DeSimone D.W. J. Cell Biol. 1996; 134: 227-240Crossref PubMed Scopus (99) Google Scholar). Flow Cytometry—Integrin affinity in transfected cells was analyzed by three-color flow cytometry. Cells were transfected with test DNA (as stated) together with 0.75 μg of Tac-α5 transfection reporter construct. Single cell suspensions of trypsinized cells were resuspended in a total volume of 50 μl containing either PAC-1 (5 μg/ml) or FN9–11 for 30 min at room temperature in 20 mm HEPES, 140 mm NaCl, 1.8 mm CaCl2, 1 mm MgCl2, and 2 mg/ml glucose (pH 7.4). Internal controls containing either 5 mm EDTA or 100 μm MnCl2 were performed for each sample. Cells were washed with cold phosphate-buffered saline (PBS) and incubated on ice with 50 μlof DMEM containing 1:25 fluorescein isothiocyanate-conjugated anti-mouse IgM (for PAC-1) or fluorescein isothiocyanate-conjugated streptavidin (for FN9–11) for 30 min in the dark. Cells were washed again and incubated on ice for an additional 30 min with 50 μl of DMEM containing 1:50 (v/v) R-phycoerythrin-conjugated anti-Tac antibody (ACT-1). Cells were finally washed and resuspended in cold PBS. Immediately prior to analysis on a FACSCalibur (BD Biosciences, Erembodegem, Belgium), TO-PRO-3 (Molecular Probes, Leiden, The Netherlands) at a final concentration of 1 μm (in PBS) was added to each sample. PAC-1/FN9–11 binding was determined by gating for live and highly transfected cells (TO-PRO-3-negative and high Tac binding, respectively). To obtain numerical estimates of integrin activation, an integrin activation index (AI) was calculated, where AI = ((FN – FI)/(FA – FI)) × 100 and percent inhibition = ((AI0 – AI)/AI0) × 100. FN is the geometric mean fluorescence intensity of PAC-1/FN9–11 binding of the native integrin, FI is the mean fluorescence intensity of PAC-1/FN9–11 binding in the presence of 5 mm EDTA, and FA is the mean fluorescence intensity of PAC-1/FN9–11 binding in the presence of 100 μm Mn2+, AI0 is the activation index with the control vector, and AI is the activation index with the DNA under testing. Gel Electrophoresis and Western Blotting—Cell lysates were resuspended in Laemmli sample buffer, separated on 10–12% SDS-polyacrylamide gels, and transferred onto Hybond-C nitrocellulose (Amersham Biosciences, Buckinghamshire, UK). Immunoblotting was performed with appropriate antibodies diluted in 5% nonfat dried milk powder and detected by chemiluminescence (ECL, Amersham Biosciences) following the manufacturer's instructions. Relative protein expression was quantified using ImageJ software. RNA Extraction and Reverse Transcription-PCR—Total RNA was extracted from 1 × 106 cells using an RNeasy kit (Qiagen Inc.) according to the manufacturer's instructions. Contaminating DNA was removed by treatment with RQ1 DNase (Promega Corp.), and the RNA was quantified using a spectrophotometer and then stored at –80 °C. cDNAs were generated by reverse transcription of 400 ng of RNA using TaqMan reverse transcription reagents (Applied Biosystems) according to the manufacturer's instructions and stored at –20 °C. All reagents for PCR were obtained from Promega Corp. The reaction contained 2.5 μlof10× buffer, 0.25 μlof Taq polymerase, 1 μlof dNTP (10 mm), 0.5 μm forward and reverse primers, 17.25 μlof nuclease-free water, and 2 μl of cDNA. The PCR program was as follows: 95 °C for 2 min; 35 cycles at 95 °C for 45 s, 56 °C for 45 s, and 72 °C for 45 s; and a final extension at 72 °C for 5 min. The primers used were PLCϵfor (GGCTACGTAGGCAGGATTGTCTTA), PLCϵrev (TTTCCCTGCACCCTTCCACTTGC), β-actin-for (CCACCAACTGGGACGACATG), and β-actin-rev (GTCTCAAACATGATCTGGGTCATC). PCR products were resolved on a 2% agarose gel, purified using a gel extraction kit (Qiagen Inc.), and sequenced on both strands (MWG Biotech). Ral Activity Assay—Cells were transfected with Myc-tagged Ral constructs as described above and quiesced 24 h prior to lysis. Cells were lysed in 450 μl of Ral lysis buffer (50 mm Tris-HCl (pH 7.4), 200 mm NaCl, 2.5 mm MgCl2, 1% (v/v) Nonidet P-40, 15% (v/v) glycerol, and one Complete™ protease inhibitor tablet). Lysates were clarified by centrifugation at 13,000 rpm for 10 min at 4 °C, and the protein concentration estimated. Protein concentrations were normalized, and equal volumes were incubated with 50 μl of the Ral-binding domain of RLIP76 coupled to GST-agarose beads (28Wolthuis R.M. Franke B. van Triest M. Bauer B. Cool R.H. Camonis J.H. Akkerman J.W. Bos J.L. Mol. Cell. Biol. 1998; 18: 2486-2491Crossref PubMed Scopus (130) Google Scholar) for 60 min at 4 °C. Samples of whole cell lysates were taken for loading controls of Ral proteins. Agarose beads were washed four times with Ral lysis buffer and finally resuspended in Laemmli sample buffer. Whole cell lysates and Ral-binding domain-bound samples (20 μl) were analyzed by SDS-PAGE on a 15% gel, and Western blots were probed with anti-Ral antibody. PLC Activity Assay—CHO-K1 cells were maintained in inositol-free DMEM (ICN Biochemicals, Basingstoke) supplemented with dialyzed 10% (v/v) fetal bovine serum (Labtech International, East Sussex, UK). Cells were transfected as described above and quiesced 24 h prior to lysis in serum-free DMEM containing 5 μCi of myo-[3H]inositol (Amersham Biosciences). Cells were then incubated with 20 mm lithium chloride for 60 min, washed, and lysed with 500 μlof0.5 m trichloroacetic acid. Lysates were clarified at 13,000 × g for 10 min, and the supernatant (400 μl) was neutralized by addition to a 50:50 mixture of 1,1,2-trichlorotrifluoroethane/tri-n-octylamine (750 μl). The mixture was vortexed and separated by centrifugation at 13,000 × g for 5 min. The aqueous phase was collected (300 μl), diluted by the addition of 10 ml of ice-cold distilled H2O, and loaded onto an AG 1-X8 200–400 mesh formate form column (Bio-Rad, Hertfordshire, UK). Following a column wash with 10 ml of 60 mm ammonium formate and 5 mm sodium tetraborate, [3H]IP1–3 was eluted with 5 ml of 1.2 m ammonium formate and 0.1 m formic acid and measured by liquid scintillation counting. Cell Adhesion Assay—Cells were transfected with test DNA, and CHO(αβ-py) cells were also transfected with 2 μg of pEGFP-C3. Cells were harvested after 48 h and resuspended at 1 × 106 cells/ml in DMEM. 96-Well cell culture cluster plates were coated with 5 μg/ml von Willebrand factor (vWF) (CHO(αβ-py) cells) or 10 μg/ml fibronectin (CHO-K1 cells) in PBS for 60 min at 37 °C and blocked with 2% (w/v) bovine serum albumin in PBS for 60 min at room temperature. The cell suspension (200 μl) was added to each well and allowed to adhere for 15 min at 37 °C. Unattached cells were removed by gentle shaking for 3 × 10 s. Total cell adhesion was assessed by centrifugation of the plate at 1000 rpm for 5 min. For CHO(αβ-py) cells, adhesion was quantified on a fluorescence plate reader. For CHO-K1 cells, adhesion was quantified by staining adherent cells with methylene blue (0.4%) for 5 min, three washes with PBS, and elution of stain with 0.1 m HCl. The absorbance of each sample was read at 640 nm on an optical plate reader. Adhesion was expressed as a percentage compared with total cell adhesion with background cell adhesion to plastic subtracted against all values. The data represented are shown as the percent change in cell adhesion with values normalized against control cell adhesion to the extracellular matrix. Statistical Analysis—Data were analyzed by one-way analysis of variance, and the appropriate post-test analyses were applied. p values <0.05 were considered to be significant. Integrin Suppression by H-Ras(G12V) Effector Mutants T35S and E37G—It has previously been reported that a constitutively active mutant of H-Ras (H-Ras(G12V)) suppresses integrin function (3Hughes P.E. Renshaw M.W. Pfaff M. Forsyth J. Keivens V.M. Schwartz M.A. Ginsberg M.H. Cell. 1997; 88: 521-530Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar). However, the signaling pathways downstream of H-Ras are still poorly understood. To examine the role of downstream effectors of H-Ras in integrin suppression, we utilized the CHO(αβ-py) cell line, a CHO cell line stably expressing a chimeric integrin that contains the extracellular and transmembrane domains of αIIbβ3 fused to the cytoplasmic domains of α6Aβ1 (3Hughes P.E. Renshaw M.W. Pfaff M. Forsyth J. Keivens V.M. Schwartz M.A. Ginsberg M.H. Cell. 1997; 88: 521-530Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar, 4Sethi T. Ginsberg M.H. Downward J. Hughes P.E. Mol. Biol. Cell. 1999; 10: 1799-1809Crossref PubMed Scopus (87) Google Scholar). H-Ras(G12V) effector mutants were transfected into CHO(αβ-py) cells, and their effect upon integrin affinity modulation was assessed. The integrin AI was quantified from changes in the binding levels of the αIIbβ3 ligand-mimetic monoclonal antibody PAC-1, detected by flow cytometry as described under “Experimental Procedures.” Fig. 1A shows that the H-Ras(G12V) effector mutants E37G (25.3 ± 14.6%) and T35S (27.9 ± 6.6%) both induced a significant reduction in the AI compared with control vector-transfected cells (70.6 ± 8.5%, p < 0.01). This was comparable with H-Ras(G12V)-induced reduction in the integrin AI (23.1 ± 4.3%). In contrast, effector mutant Y40C (59.0 ± 15%) did not significantly reduce the AI in our system. Furthermore, we confirmed previous results (3Hughes P.E. Renshaw M.W. Pfaff M. Forsyth J. Keivens V.M. Schwartz M.A. Ginsberg M.H. Cell. 1997; 88: 521-530Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar) that inhibition of phosphatidylinositol 3-kinase activity with LY294002 (10 μm) does not affect H-Ras(G12V)-mediated integrin suppression in CHO(αβ-py) cells (data not shown), in agreement with the inability of H-Ras(G12V/Y40C) to suppress integrins. Each mutant was expressed at similar levels in the transfected CHO(αβ-py) cells (Fig. 1B). H-Ras(G12V) and the effector mutant T35S both stimulated ERK1/2 phosphorylation as detected by anti-phospho-ERK1/2 antibody (clone MAPK-YT; 4.6 ± 0.6- and 3.2 ± 0.5-fold increase (mean ± S.E.) compared with vector, respectively; n = three independent experiments) (Fig. 1B). As expected, the effector mutants E37G and Y40C did not stimulate ERK1/2 phosphorylation above that in control transfected cells (0.9 ± 0.2- and 1.1 ± 0.2-fold change, respectively). Transfection of the H-Ras mutants did not alter the level of ERK2 expression in these transfected cells. Fig. 1C shows the effect of H-Ras(G12V/E37G) expression in the CHO(αβ-py) cell assay. Expression of H-Ras(G12V/E37G) caused a marked reduction in PAC-1 binding, resulting in a leftward shift in the highly transfected cell population (Fig. 1C, upper quadrants). The untransfected/poorly transfected cell population (Fig. 1C, lower quadrants) did not display any significant change in PAC-1 binding. PAC-1 binding to the chimeric integrin in CHO(αβ-py) cells was inhibited by EDTA (Fig. 1C, left panel). In contrast, H-Ras(G12V/E37G)-transfected cells in the presence of Mn2+ displayed a slight rightward shift in the whole cell population as a result of increased PAC-1 binding (Fig. 1C, right panel). The ability of Mn2+ to override H-Ras(G12V/E37G) suppression of PAC-1 binding by activating integrins indicates that the effect of H-Ras is not due to changes in integrin expression in this system, but rather to suppression of integrin activity. These results suggest that H-Ras(G12V) mediates integrin suppression by two separate effector pathways: a Raf/ERK-dependent signaling pathway utilized by T35S and a Raf/ERK-independent pathway utilized by E37G. Integrin Suppression by H-Ras(G12V/E37G) Is Not Mediated by RalA—The small GTP-binding protein Ral is a downstream effector of" @default.
• W1975017167 created "2016-06-24" @default.
• W1975017167 creator A5004578414 @default.
• W1975017167 creator A5011577349 @default.
• W1975017167 creator A5014396745 @default.
• W1975017167 creator A5026803305 @default.
• W1975017167 creator A5032907445 @default.
• W1975017167 creator A5050990362 @default.
• W1975017167 creator A5071446755 @default.
• W1975017167 date "2006-10-01" @default.
• W1975017167 modified "2023-09-30" @default.
• W1975017167 title "Phospholipase Cϵ Suppresses Integrin Activation" @default.
• W1975017167 cites W103445271 @default.
• W1975017167 cites W1486102976 @default.
• W1975017167 cites W1522933979 @default.
• W1975017167 cites W1604015258 @default.
• W1975017167 cites W1820462433 @default.
• W1975017167 cites W1884928912 @default.
• W1975017167 cites W1895802579 @default.
• W1975017167 cites W1958742527 @default.
• W1975017167 cites W1969771018 @default.
• W1975017167 cites W1979027806 @default.
• W1975017167 cites W1980952363 @default.
• W1975017167 cites W1982760675 @default.
• W1975017167 cites W1991321737 @default.
• W1975017167 cites W1993163893 @default.
• W1975017167 cites W1994811935 @default.
• W1975017167 cites W1997093700 @default.
• W1975017167 cites W2001916228 @default.
• W1975017167 cites W2005963663 @default.
• W1975017167 cites W2010547112 @default.
• W1975017167 cites W2017550542 @default.
• W1975017167 cites W2020674613 @default.
• W1975017167 cites W2029231027 @default.
• W1975017167 cites W2033924774 @default.
• W1975017167 cites W2035554173 @default.
• W1975017167 cites W2036286128 @default.
• W1975017167 cites W2040379229 @default.
• W1975017167 cites W2041534105 @default.
• W1975017167 cites W2063912602 @default.
• W1975017167 cites W2068032848 @default.
• W1975017167 cites W2068344246 @default.
• W1975017167 cites W2068842251 @default.
• W1975017167 cites W2073816668 @default.
• W1975017167 cites W2079892535 @default.
• W1975017167 cites W2083260280 @default.
• W1975017167 cites W2083965774 @default.
• W1975017167 cites W2087519729 @default.
• W1975017167 cites W2088544660 @default.
• W1975017167 cites W2089562291 @default.
• W1975017167 cites W2100669756 @default.
• W1975017167 cites W2102324547 @default.
• W1975017167 cites W2114934533 @default.
• W1975017167 cites W2123122700 @default.
• W1975017167 cites W2127144515 @default.
• W1975017167 cites W2127170661 @default.
• W1975017167 cites W2128063036 @default.
• W1975017167 cites W2131000203 @default.
• W1975017167 cites W2133757455 @default.
• W1975017167 cites W2147438402 @default.
• W1975017167 cites W2151726169 @default.
• W1975017167 cites W2155849087 @default.
• W1975017167 cites W2156875265 @default.
• W1975017167 cites W2324943279 @default.
• W1975017167 doi "https://doi.org/10.1074/jbc.m513471200" @default.
• W1975017167 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16895916" @default.
• W1975017167 hasPublicationYear "2006" @default.
• W1975017167 type Work @default.
• W1975017167 sameAs 1975017167 @default.
• W1975017167 citedByCount "13" @default.
• W1975017167 countsByYear W19750171672014 @default.
• W1975017167 countsByYear W19750171672019 @default.
• W1975017167 countsByYear W19750171672020 @default.
• W1975017167 countsByYear W19750171672021 @default.
• W1975017167 countsByYear W19750171672022 @default.
• W1975017167 crossrefType "journal-article" @default.
• W1975017167 hasAuthorship W1975017167A5004578414 @default.
• W1975017167 hasAuthorship W1975017167A5011577349 @default.
• W1975017167 hasAuthorship W1975017167A5014396745 @default.
• W1975017167 hasAuthorship W1975017167A5026803305 @default.
• W1975017167 hasAuthorship W1975017167A5032907445 @default.
• W1975017167 hasAuthorship W1975017167A5050990362 @default.
• W1975017167 hasAuthorship W1975017167A5071446755 @default.
• W1975017167 hasBestOaLocation W19750171671 @default.
• W1975017167 hasConcept C170493617 @default.
• W1975017167 hasConcept C185592680 @default.
• W1975017167 hasConcept C195687474 @default.
• W1975017167 hasConcept C55493867 @default.
• W1975017167 hasConcept C86803240 @default.
• W1975017167 hasConcept C95444343 @default.
• W1975017167 hasConceptScore W1975017167C170493617 @default.
• W1975017167 hasConceptScore W1975017167C185592680 @default.
• W1975017167 hasConceptScore W1975017167C195687474 @default.
• W1975017167 hasConceptScore W1975017167C55493867 @default.
• W1975017167 hasConceptScore W1975017167C86803240 @default.
• W1975017167 hasConceptScore W1975017167C95444343 @default.
• W1975017167 hasIssue "40" @default.
• W1975017167 hasLocation W19750171671 @default.

• next