FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1976622956> ?p ?o ?g. }

• W1976622956 endingPage "43023" @default.
• W1976622956 startingPage "43017" @default.
• W1976622956 abstract "CTC-binding factor (CTCF) is a DNA-binding protein of vertebrates that plays essential roles in regulating genome activity through its capacity to act as an enhancer blocker. We performed a yeast two-hybrid screen to identify protein partners of CTCF that could regulate its activity. Using full-length CTCF as bait we recovered Kaiso, a POZ-zinc finger transcription factor, as a specific binding partner. The interaction occurs through a C-terminal region of CTCF and the POZ domain of Kaiso. CTCF and Kaiso are co-expressed in many tissues, and CTCF was specifically co-immunoprecipitated by several Kaiso monoclonal antibodies from nuclear lysates. Kaiso is a bimodal transcription factor that recognizes methylated CpG dinucleotides or a conserved unmethylated sequence (TNGCAGGA, the Kaiso binding site). We identified one consensus unmethylated Kaiso binding site in close proximity to the CTCF binding site in the human 5′ β-globin insulator. We found, in an insulation assay, that the presence of this Kaiso binding site reduced the enhancer-blocking activity of CTCF. These data suggest that the Kaiso-CTCF interaction negatively regulates CTCF insulator activity. CTC-binding factor (CTCF) is a DNA-binding protein of vertebrates that plays essential roles in regulating genome activity through its capacity to act as an enhancer blocker. We performed a yeast two-hybrid screen to identify protein partners of CTCF that could regulate its activity. Using full-length CTCF as bait we recovered Kaiso, a POZ-zinc finger transcription factor, as a specific binding partner. The interaction occurs through a C-terminal region of CTCF and the POZ domain of Kaiso. CTCF and Kaiso are co-expressed in many tissues, and CTCF was specifically co-immunoprecipitated by several Kaiso monoclonal antibodies from nuclear lysates. Kaiso is a bimodal transcription factor that recognizes methylated CpG dinucleotides or a conserved unmethylated sequence (TNGCAGGA, the Kaiso binding site). We identified one consensus unmethylated Kaiso binding site in close proximity to the CTCF binding site in the human 5′ β-globin insulator. We found, in an insulation assay, that the presence of this Kaiso binding site reduced the enhancer-blocking activity of CTCF. These data suggest that the Kaiso-CTCF interaction negatively regulates CTCF insulator activity. The genome of eukaryotes is partitioned into transcriptionally active and transcriptionally inactive domains (1Labrador M. Corces V.G. Cell. 2002; 111: 151-154Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar). Insulators are DNA elements that maintain this partition, and they can be subdivided into two functional classes: barrier elements, which stop the spread of heterochromatin, and enhancer blockers, which prevent an enhancer from activating transcription in a neighboring repressed region (2West A.G. Gaszner M. Felsenfeld G. Genes Dev. 2002; 16: 271-288Crossref PubMed Scopus (505) Google Scholar). One of the best studied loci regarding long-range transcriptional regulation is the β-globin locus of vertebrates (3Li Q. Peterson K.R. Fang X. Stamatoyannopoulos G. Blood. 2002; 100: 3077-3086Crossref PubMed Scopus (338) Google Scholar). This locus contains an enhancer, the LCR (locus control region), which acts on the globin genes. The activity of the LCR is confined by two insulators, one at the 5′ boundary of the locus and another at the 3′ boundary. Both insulators depend on the same protein, CTCF 5The abbreviations used are: CTCFCTC-binding factorPOZpoxvirus and zinc fingerZFzinc fingerTBSTris-buffered salineGSTglutathione S-transferase.5The abbreviations used are: CTCFCTC-binding factorPOZpoxvirus and zinc fingerZFzinc fingerTBSTris-buffered salineGSTglutathione S-transferase. (4Burgess-Beusse B. Farrell C. Gaszner M. Litt M. Mutskov V. Recillas-Targa F. Simpson M. West A. Felsenfeld G. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 16433-16437Crossref PubMed Scopus (224) Google Scholar, 5Farrell C.M. West A.G. Felsenfeld G. Mol. Cell. Biol. 2002; 22: 3820-3831Crossref PubMed Scopus (144) Google Scholar). CTC-binding factor poxvirus and zinc finger zinc finger Tris-buffered saline glutathione S-transferase. CTC-binding factor poxvirus and zinc finger zinc finger Tris-buffered saline glutathione S-transferase. CTCF was originally isolated as a zinc-finger transcription factor that recognized a CTC-rich sequence in the c-myc promoter (6Klenova E.M. Nicolas R.H. Paterson H.F. Carne A.F. Heath C.M. Goodwin G.H. Neiman P.E. Lobanenkov V.V. Mol. Cell. Biol. 1993; 13: 7612-7624Crossref PubMed Scopus (226) Google Scholar). Over the years, CTCF has been shown to have complex and important roles in the control of gene expression (7Ohlsson R. Renkawitz R. Lobanenkov V. Trends Genet. 2001; 17: 520-527Abstract Full Text Full Text PDF PubMed Scopus (472) Google Scholar). CTCF binds many different DNA target sequences through the combinatorial use of its 11 zinc fingers, and it is capable of both activating and repressing gene transcription. An additional role of CTCF is to act as an enhancer blocker that prevents communication between an enhancer and a target gene. This process is known as transcriptional insulation. CTCF and YY1 (8Kim J. Kollhoff A. Bergmann A. Stubbs L. Hum. Mol. Genet. 2003; 12: 233-245Crossref PubMed Scopus (159) Google Scholar) are the only two vertebrate proteins known to act as enhancer blockers. CTCF exerts this critical function at many loci (2West A.G. Gaszner M. Felsenfeld G. Genes Dev. 2002; 16: 271-288Crossref PubMed Scopus (505) Google Scholar). For example, enhancer blocking by CTCF permits correct expression of the imprinted genes H19 and IGF2. At this locus, CTCF is only active on the maternal chromosome. The CTCF target sites on the paternal chromosome are methylated, and this modification completely precludes CTCF binding (9Bell A.C. Felsenfeld G. Nature. 2000; 405: 482-485Crossref PubMed Scopus (1348) Google Scholar, 10Hark A.T. Schoenherr C.J. Katz D.J. Ingram R.S. Levorse J.M. Tilghman S.M. Nature. 2000; 405: 486-489Crossref PubMed Scopus (1202) Google Scholar, 11Kanduri C. Pant V. Loukinov D. Pugacheva E. Qi C.F. Wolffe A. Ohlsson R. Lobanenkov V.V. Curr. Biol. 2000; 10: 853-856Abstract Full Text Full Text PDF PubMed Scopus (380) Google Scholar). Recently, significant advances were made in our understanding of how CTCF functions as an enhancer blocker at the 5′ chicken β-globin insulator (12Yusufzai T.M. Felsenfeld G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 8620-8624Crossref PubMed Scopus (132) Google Scholar, 13Yusufzai T.M. Tagami H. Nakatani Y. Felsenfeld G. Mol Cell. 2004; 13: 291-298Abstract Full Text Full Text PDF PubMed Scopus (390) Google Scholar). At this insulator site, CTCF interacts with nucleophosmin, a nuclear matrix protein that is concentrated at the surface of the nucleolus. This is thought to result in the formation of physically separated DNA loops, which would then prevent an enhancer element in one chromatin loop from acting on a gene in the neighboring chromatin loop. Interestingly, this finding is consistent with results obtained in Drosophila, where a crucial link between nuclear architecture and transcriptional insulation was discovered (1Labrador M. Corces V.G. Cell. 2002; 111: 151-154Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar). It is likely that this model also accounts for CTCF action at other insulators, and yet alternative mechanisms cannot be ruled out at this point. The activity of enhancer blockers is not static but can turned on and off. Recent experiments with CTCF have shown that post-translational modification of the protein plays an important regulatory role (14Yu W. Ginjala V. Pant V. Chernukhin I. Whitehead J. Docquier F. Farrar D. Tavoosidana G. Mukhopadhyay R. Kanduri C. Oshimura M. Feinberg A.P. Lobanenkov V. Klenova E. Ohlsson R. Nat. Genet. 2004; 36: 1105-1110Crossref PubMed Scopus (205) Google Scholar). In addition, the function of CTCF can also be regulated through interacting proteins (15Lutz M. Burke L.J. LeFevre P. Myers F.A. Thorne A.W. Crane-Robinson C. Bonifer C. Filippova G.N. Lobanenkov V. Renkawitz R. EMBO J. 2003; 22: 1579-1587Crossref PubMed Scopus (73) Google Scholar). In this study, we sought to identify binding partners of CTCF that could influence its activity as an enhancer blocker. We report the identification of the protein Kaiso as a specific binding partner for CTCF. Kaiso is a member of the POZ (pox virus and zinc finger) family of zinc finger (ZF) transcription factors that are implicated in cancer and development (16Daniel J.M. Reynolds A.B. Mol. Cell. Biol. 1999; 19: 3614-3623Crossref PubMed Scopus (333) Google Scholar). To date, Kaiso is the only POZ-ZF protein that has been shown to have dual specificity DNA binding; it can bind methylated CpG dinucleotides (17Prokhortchouk A. Hendrich B. Jorgensen H. Ruzov A. Wilm M. Georgiev G. Bird A. Prokhortchouk E. Genes Dev. 2001; 15: 1613-1618Crossref PubMed Scopus (371) Google Scholar) or a specific nonmethylated DNA sequence (TNGCAGGA) (18Daniel J.M. Spring C.M. Crawford H.C. Reynolds A.B. Baig A. Nucleic Acids Res. 2002; 30: 2911-2919Crossref PubMed Scopus (195) Google Scholar). Indeed, we identified one nonmethylated Kaiso consensus site near the CTCF binding site on the human 5′ β-globin insulator. We show that the presence of an intact Kaiso binding site near the CTCF binding site on the 5′ β-globin insulator inhibits the enhancer-blocking activity of CTCF. This raises the possibility that Kaiso is a negative regulator of CTCF enhancer-blocking activity. Plasmids—The two-hybrid bait plasmid was constructed by cloning the full-length chicken CTCF cDNA (provided by Rainer Renkawitz) between the EcoRI and BglII sites of vector pGBDU-C (1Labrador M. Corces V.G. Cell. 2002; 111: 151-154Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar) (URA3-marked, multicopy, ADH1 promoter driving expression of the bait fused to GAL4p1–147) (19James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar). The Gal4-CTCF deletion constructs used in Fig. 3 have been described previously (20Defossez P.A. Gilson E. Nucleic Acids Res. 2002; 23: 5136-5141Crossref Scopus (19) Google Scholar). To construct the insulation reporters described in Fig. 4, we first cloned the relevant oligonucleotides into the EcoRV site of pBluescriptII KS. They were then PCR-amplified with primers containing MluI sites, digested with MluI, and inserted into the AscI site of pNI (21Bell A.C. West A.G. Felsenfeld G. Cell. 1999; 98: 387-396Abstract Full Text Full Text PDF PubMed Scopus (850) Google Scholar). All constructs were sequenced.FIGURE 4A Kaiso binding site at the β-globin insulator regulates enhancer blocking by CTCF. A, structure of the human globin gene locus (not to scale). A consensus Kaiso binding site is present next to the CTCF binding site in the 5′-HS5 insulator. B, activity of wild-type and mutant sequences in a mammalian insulation assay. Human K562 cells were transfected with the indicated constructs and seeded in soft agar in the presence of neomycin. The number of colonies was recorded 3 weeks after transformation. C, model explaining the behavior of the different constructs. Enh, enhancer.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Two-hybrid Screen—We used the two-hybrid strain PJ69–4a (19James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar). The strain was first transformed with the bait plasmid and then with a library of cDNAs from 6.5–9.5 days post-coitum mouse embryos cloned into the pASV3 vector (LEU2 marker, multicopy, PGK1 promoter driving the expression of peptides fused to the VP16 activation domain) (22Le Douarin B. Pierrat B. vom Baur E. Chambon P. Losson R. Nucleic Acids Res. 1995; 23: 876-878Crossref PubMed Scopus (71) Google Scholar). The library was a kind gift from Régine Losson. Yeast transformation was done using lithium acetate (23Gietz R.D. Woods R.A. Methods Enzymol. 2002; 350: 87-96Crossref PubMed Scopus (2008) Google Scholar). Transformation efficiency was calculated by plating an aliquot of the cells on plates lacking uracil and leucine. Interactors were selected on plates lacking uracil, leucine, and histidine and containing 5 mm 3-aminotriazole. We then tested whether growth on plates lacking histidine was dependent on the bait plasmid. Finally, cells containing the candidate interactors were mated to PJ69–4α containing different bait plasmids to test the specificity of the interaction. Only two clones passed all of the screening procedures. Cell and Tissue Culture—Mammalian cells used in this study were the human cervical carcinoma cell line HeLa and the human erythroleukemia K562 cells. HeLa cells were grown at 37 °C in 5% CO2 in Dulbecco's minimal essential medium supplemented with 10% fetal bovine serum, 4 mm l-glutamine, penicillin (100 units/ml), streptomycin (100 μg/ml), and fungizone (0.5 μg/ml). K562 cells were grown in RPMI 1640 medium with 10% fetal bovine serum, penicillin (100 units/ml), and streptomycin (100 μg/ml). Co-immunoprecipitation and Immunoblot Analysis—HeLa cells were washed once with 5 ml PBS (pH 7.4) prior to the preparation of cytoplasmic and nuclear fractions (24Klenova E. Chernukhin I. Inoue T. Shamsuddin S. Norton J. Methods. 2002; 26: 254-259Crossref PubMed Scopus (48) Google Scholar). Nuclear lysates were quantified by Bradford assay, and equal amounts of total protein were used for immunoprecipitation with anti-Kaiso monoclonal antibodies 6F, 2G, 12H, 12G, and 11D (25Daniel J.M. Ireton R.C. Reynolds A.B. Hybridoma. 2001; 20: 159-166Crossref PubMed Scopus (20) Google Scholar) or with rabbit anti-CTCF polyclonal antibody (Upstate Biotechnology, catalog no. 06-917). The immune complexes were then subjected to SDS-PAGE as described previously (16Daniel J.M. Reynolds A.B. Mol. Cell. Biol. 1999; 19: 3614-3623Crossref PubMed Scopus (333) Google Scholar). After electrophoresis, the proteins were transferred to a nitrocellulose membrane. The membrane was briefly blocked at room temperature with 3% skimmed milk powder in TBS (pH 7.4) before incubating at 4 °C overnight with rabbit anti-Kaiso polyclonal antibody at 1/12,000 dilution or rabbit anti-CTCF polyclonal antibody at 1/500 dilution in 3% milk/TBS. The primary antibodies were removed by rinsing the membranes five times with water and then once with TBS for 5 min each. The membranes were then incubated for 2 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody, diluted 1:40,000 in 3% milk/TBS. Membranes were finally rinsed five times with water and once with TBS (pH 7.4) for 5 min each and processed using the enhanced chemiluminescence system (ECL, Amersham Biosciences) according to the manufacturer's protocols. The in vitro interaction between GST-Kaiso and CTCF was tested as described previously (26Kelly K.F. Spring C.M. Otchere A.A. Daniel J.M. J. Cell Sci. 2004; 117: 2675-2686Crossref PubMed Scopus (88) Google Scholar). Insulation Assay—We used the method developed in the Felsenfeld laboratory (21Bell A.C. West A.G. Felsenfeld G. Cell. 1999; 98: 387-396Abstract Full Text Full Text PDF PubMed Scopus (850) Google Scholar). The various reporters were linearized with SalI, and DNA was quantified by both UV spectrophotometry and analysis on an agarose gel. One hundred nanograms of each linearized plasmid was then electroporated into 1 × 107 K562 cells by electroporation. After 24 h of recovery, the cells were plated in 0.35% agar medium with 750 μg/ml Geneticin (active concentration) in two 150-mm dishes. Colonies were counted after 3 weeks. Each construct was tested in duplicate in at least three separate experiments, using a different DNA preparation each time. Statistical analysis of the results was done using Student's t test. Immunoprecipitation of Chromatin—HeLa cells were fixed with 1% formaldehyde for 60 min at room temperature. The cells were lysed, and the chromatin was sonicated to an average size of 600 base pairs. For each experiment the chromatin prepared from 107 cells was immunoprecipitated with 4 μg of the relevant antibody, using a previously described protocol (27Rodova M. Kelly K.F. VanSaun M. Daniel J.M. Werle M.J. Mol. Cell. Biol. 2004; 24: 7188-7196Crossref PubMed Scopus (88) Google Scholar). The primers used to amplify the human β-globin region are TGAGGATGCCTCCTTCTCTG and CAGCAGCTTCAGCTACCTCTC. Biochemical approaches have been used to seek CTCF interactors (28Chernukhin I.V. Shamsuddin S. Robinson A.F. Carne A.F. Paul A. El-Kady A.I. Lobanenkov V.V. Klenova E.M. J. Biol. Chem. 2000; 275: 29915-29921Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). To identify additional interactors and potential regulators of CTCF function, we performed a yeast two-hybrid screen using a mouse embryo cDNA library and full-length CTCF as the bait. From 2 million transformants, we obtained only two positive clones, clones 1 and 88. The two clones contained overlapping fragments of the same cDNA, encoding a fraction of the transcription factor Kaiso (Fig. 1A). Both clones possessed 237 nucleotides upstream of the reported Kaiso ATG, which are translated in-frame with the rest of the cDNA, and generate a 79-amino acid extension not normally present in Kaiso. The clones differed by the fact that clone 1 encoded the first 217 amino acids of Kaiso, whereas clone 88 encoded the first 200 amino acids. This N-terminal region of Kaiso contains the POZ domain, which is known to mediate homo- and heterodimerization with other POZ family proteins or non-POZ domain proteins (29Bardwell V.J. Treisman R. Genes Dev. 1994; 8: 1664-1677Crossref PubMed Scopus (653) Google Scholar, 30Collins T. Stone J.R. Williams A.J. Mol. Cell. Biol. 2001; 21: 3609-3615Crossref PubMed Scopus (287) Google Scholar). This strongly suggested that the Kaiso POZ domain was involved in mediating the CTCF interaction. In fact, in an independent study, the Daniel laboratory identified CTCF as a Kaiso-specific binding partner using the Kaiso POZ domain as bait. 6J. M. Daniel, personal communication. As seen in Fig. 1B, we found that CTCF interacted with the full-length Kaiso protein and also with the isolated Kaiso POZ domain. When the POZ domain was deleted from Kaiso, interaction with CTCF was lost (Fig. 1B). This indicates that the POZ domain is both necessary and sufficient for the CTCF-Kaiso interaction. Because POZ domains are highly conserved and are present in a large number of transcription factors (30Collins T. Stone J.R. Williams A.J. Mol. Cell. Biol. 2001; 21: 3609-3615Crossref PubMed Scopus (287) Google Scholar), we tested the specificity of the interaction by asking whether CTCF would interact with the POZ domain of four other POZ-ZF proteins (BCL-6, PLZF, HIC-1, FAZF). As seen in Fig. 1B and 1C, CTCF interacted specifically with the Kaiso POZ domain and with no other POZ domain tested. We conclude that CTCF recognizes a specific feature in the POZ domain of Kaiso. To determine whether CTCF and Kaiso interact in vivo in vertebrate cells, we performed co-immunoprecipitation experiments using human cervical carcinoma (HeLa) cells, which express both CTCF and Kaiso endogenously at high to moderate levels. We prepared nuclear extracts and immunoprecipitated Kaiso using five different Kaiso-specific monoclonal antibodies that have been characterized previously (25Daniel J.M. Ireton R.C. Reynolds A.B. Hybridoma. 2001; 20: 159-166Crossref PubMed Scopus (20) Google Scholar). The immunoprecipitates were subjected to SDS-PAGE and Western blot analysis using CTCF-specific antibodies. As seen in Fig. 2, endogenous CTCF was specifically co-precipitated by the various Kaiso-specific monoclonal antibodies. In contrast, the preimmune serum failed to precipitate any CTCF-containing material. We thus conclude that CTCF and Kaiso exist in a complex in vertebrate cells. To further verify the interaction, we performed the reciprocal experiment by immunoprecipitating CTCF and Western blotting with a Kaiso-specific rabbit polyclonal antibody. However we failed to detect Kaiso co-precipitating with CTCF in this reciprocal situation. This may be due to the fact that the CTCF antiserum was raised against a region of CTCF that contains the Kaiso interaction domain (see “Discussion”). The CTCF antibody may recognize only uncomplexed CTCF, or the antibody may perturb the native CTCF-Kaiso interaction. An alternative explanation for the failure of the CTCF antiserum to co-immunoprecipitate Kaiso could be stoichiometry; CTCF protein may be in large excess relative to Kaiso, with only a minor subpopulation of CTCF molecules bound to Kaiso at steady state. To determine whether the interaction between CTCF and Kaiso is direct, we used an in vitro interaction assay. Radioactively labeled CTCF was produced by in vitro transcription and translation and was incubated with bacterially expressed glutathione S-transferase (GST) or with GST fused to full-length Kaiso (GST-Kaiso). No CTCF was retained after incubation with GST, whereas CTCF bound the GST-Kaiso protein (Fig. 2B). From this we conclude that Kaiso and CTCF interact directly, without the involvement of a bridging factor. To delineate the region of CTCF that interacts with Kaiso, we tested a series of CTCF deletion mutants for their ability to bind the Kaiso POZ domain in a yeast two-hybrid assay (Fig. 3A). We delineated the binding domain of Kaiso to a C-terminal region encoding amino acids 641–728 of CTCF. This domain proved necessary and sufficient for the CTCF-Kaiso interaction. Because previous studies have demonstrated that specific highly conserved POZ domain residues of BCL-6 and PLZF are crucial for mediating the homo- and heterodimerization capabilities of these transcription factors (31Melnick A. Carlile G. Ahmad K.F. Kiang C.L. Corcoran C. Bardwell V. Prive G.G. Licht J.D. Mol. Cell. Biol. 2002; 22: 1804-1818Crossref PubMed Scopus (171) Google Scholar), we questioned whether the equivalent residues in Kaiso were crucial for the Kaiso-CTCF interaction. Hence, to more precisely define the Kaiso binding site, we generated point mutations in the Kaiso POZ domain (D33N, K47Q, K47R, Y86A, and D33N/K47Q) and tested the capacity of these mutants to interact with CTCF in the yeast two-hybrid assay (Fig. 3B). The lysine residue at position 47 (present in human Kaiso) could be substituted with arginine (present in murine Kaiso) with no apparent loss of activity. However, less conservative substitutions caused partial loss of interaction (lysine to glutamine) or totally abrogated the interaction (lysine to a proline). We also tested two other highly conserved amino acid residues that have been implicated as key determinants in POZ domain function (31Melnick A. Carlile G. Ahmad K.F. Kiang C.L. Corcoran C. Bardwell V. Prive G.G. Licht J.D. Mol. Cell. Biol. 2002; 22: 1804-1818Crossref PubMed Scopus (171) Google Scholar, 32Melnick A. Ahmad K.F. Arai S. Polinger A. Ball H. Borden K.L. Carlile G.W. Prive G.G. Licht J.D. Mol. Cell. Biol. 2000; 20: 6550-6567Crossref PubMed Scopus (149) Google Scholar). We found that substituting the highly conserved aspartic acid 33 with an asparagine or tyrosine 86 with alanine also disrupted the Kaiso-CTCF interaction. Kaiso is a unique POZ-zinc finger protein with bimodal DNA-binding properties. It can recognize methyl-CpGs (17Prokhortchouk A. Hendrich B. Jorgensen H. Ruzov A. Wilm M. Georgiev G. Bird A. Prokhortchouk E. Genes Dev. 2001; 15: 1613-1618Crossref PubMed Scopus (371) Google Scholar), or sequence-specific nonmethylated DNA (18Daniel J.M. Spring C.M. Crawford H.C. Reynolds A.B. Baig A. Nucleic Acids Res. 2002; 30: 2911-2919Crossref PubMed Scopus (195) Google Scholar). In site selection experiments, the preferred nonmethylated target of Kaiso is the sequence TNGCAGGA (18Daniel J.M. Spring C.M. Crawford H.C. Reynolds A.B. Baig A. Nucleic Acids Res. 2002; 30: 2911-2919Crossref PubMed Scopus (195) Google Scholar). In vitro, Kaiso binds this sequence with higher affinity than methylated DNA, but it is not known whether this preference also exists in vivo (18Daniel J.M. Spring C.M. Crawford H.C. Reynolds A.B. Baig A. Nucleic Acids Res. 2002; 30: 2911-2919Crossref PubMed Scopus (195) Google Scholar). If Kaiso is a bona fide binding partner of CTCF, we postulated that Kaiso may cooperate with, or antagonize, CTCF regulation of target genes. Because CTCF binding to DNA is abrogated by DNA methylation (9Bell A.C. Felsenfeld G. Nature. 2000; 405: 482-485Crossref PubMed Scopus (1348) Google Scholar, 10Hark A.T. Schoenherr C.J. Katz D.J. Ingram R.S. Levorse J.M. Tilghman S.M. Nature. 2000; 405: 486-489Crossref PubMed Scopus (1202) Google Scholar, 11Kanduri C. Pant V. Loukinov D. Pugacheva E. Qi C.F. Wolffe A. Ohlsson R. Lobanenkov V.V. Curr. Biol. 2000; 10: 853-856Abstract Full Text Full Text PDF PubMed Scopus (380) Google Scholar), we focused our search on the nonmethylated sequence-specific Kaiso binding sites. We examined known insulator regions for the presence of this consensus site and found one Kaiso binding site 34 nucleotides upstream of the CTCF binding site in the human 5′-HS5 β-globin insulator (Fig. 4A). Of note, this region does not contain any CpG dinucleotides and therefore cannot undergo DNA methylation. To test whether the presence of this Kaiso binding site affected insulation by CTCF, we performed an insulation assay using a characterized reporter construct, pNI (21Bell A.C. West A.G. Felsenfeld G. Cell. 1999; 98: 387-396Abstract Full Text Full Text PDF PubMed Scopus (850) Google Scholar). This plasmid contains three relevant elements: an enhancer (mouse β-globin HS2); a reporter gene, NeoR, that renders cells resistant to neomycin; and a cloning site between the enhancer and the reporter where test sequences can be inserted. After linearization the plasmid is used to stably transform mammalian cells that are then subjected to neomycin selection. If the test sequence has no enhancer-blocking activity, NeoR is fully activated and many neomycin-resistant colonies grow during the selection. In contrast, if the test sequence harbors an enhancer blocker, NeoR is shielded from the enhancer, and few neomycin-resistant colonies appear. We tested four different sequences derived from the human 5′-HS5 insulator. All are 102 nucleotides in length. The first sequence simply reproduces a portion of the insulator containing both the CTCF and Kaiso binding sites. The sites are placed in the same orientation as in the endogenous locus: Kaiso is upstream on the enhancer side, and CTCF is on the target gene side. The second sequence differs in that it bears two point mutations in the Kaiso binding site. Previous studies have shown that these mutations totally abrogate Kaiso binding in vitro (18Daniel J.M. Spring C.M. Crawford H.C. Reynolds A.B. Baig A. Nucleic Acids Res. 2002; 30: 2911-2919Crossref PubMed Scopus (195) Google Scholar). The third sequence contains two mutations that have been shown to prevent CTCF binding to its target site (5Farrell C.M. West A.G. Felsenfeld G. Mol. Cell. Biol. 2002; 22: 3820-3831Crossref PubMed Scopus (144) Google Scholar). Finally, the fourth sequence contains the mutant form of both the CTCF and the Kaiso binding site. All four sequences were inserted into pNI and used for stable transformation, and the neomycin-resistant colonies were counted after selection (Fig. 4A). The experiments were performed in the human erythroleukemia cell line K562 where the HS2 enhancer is functional and CTCF is present and active. We verified by Western blotting that K562 cells also express Kaiso (data not shown). The number of colonies obtained by transfection of unmodified pNI was the reference point of each experiment and was set at 100%. When cells were transfected with an equivalent amount of pNI containing a known CTCF-dependent insulator, chicken 5′-HS4, the number of neomycin-resistant colonies was greatly decreased, to approximately only 30% of that of pNI. This is in good agreement with published values (21Bell A.C. West A.G. Felsenfeld G. Cell. 1999; 98: 387-396Abstract Full Text Full Text PDF PubMed Scopus (850) Google Scholar) and establishes that our test conditions are within the expected optimal parameters. The construct containing mutations in both the CTCF and Kaiso binding sites yielded a high number of neomycin-resistant colonies, about 80% that of empty pNI. This suggests that there is minimal enhancer-blocking activity in this test sequence. The construct containing a wild-type Kaiso binding site next to an inactivated CTCF binding site also produced a high number of neomycin-resistant colonies (80%). This shows that the Kaiso binding site on its own does not have enhancer-blocking potential. The construct containing a wild-type CTCF binding site and a mutant Kaiso site decreased the number of colonies to about 35% that of pNI. This reflects the known enhancer-blocking activity of CTCF in this sequence. Again, the effect is of the same magnitude as the published data (5Farrell C.M. West A.G. Felsenfeld G. Mol. Cell. Biol. 2002; 22: 3820-3831Crossref PubMed Scopus (144) Google Scholar). Finally we tested the unmodified sequence, bearing functional CTCF and Kaiso binding sites. Strikingly this sequence had little or no enhancer-blocking potential and yielded the same proportion (∼75%) of neomycin-resistant colonies as the constructs lacking an intact CTCF binding site (∼80%). By comparing these results with those of the other constructs, we conclude that the presence of an intact Kaiso binding site greatly inhibits the enhancer-blocking activity of CTCF" @default.
• W1976622956 created "2016-06-24" @default.
• W1976622956 creator A5008550296 @default.
• W1976622956 creator A5024930888 @default.
• W1976622956 creator A5030612899 @default.
• W1976622956 creator A5045577595 @default.
• W1976622956 creator A5049978831 @default.
• W1976622956 creator A5058162477 @default.
• W1976622956 creator A5060629623 @default.
• W1976622956 creator A5061000332 @default.
• W1976622956 creator A5080765625 @default.
• W1976622956 date "2005-12-01" @default.
• W1976622956 modified "2023-10-11" @default.
• W1976622956 title "The Human Enhancer Blocker CTC-binding Factor Interacts with the Transcription Factor Kaiso" @default.
• W1976622956 cites W1483456869 @default.
• W1976622956 cites W1643500256 @default.
• W1976622956 cites W1669374546 @default.
• W1976622956 cites W1903792504 @default.
• W1976622956 cites W1951809136 @default.
• W1976622956 cites W1971389840 @default.
• W1976622956 cites W1971723950 @default.
• W1976622956 cites W1976943899 @default.
• W1976622956 cites W1977286350 @default.
• W1976622956 cites W1990926713 @default.
• W1976622956 cites W2006061308 @default.
• W1976622956 cites W2011633097 @default.
• W1976622956 cites W2016056829 @default.
• W1976622956 cites W2019937806 @default.
• W1976622956 cites W2021080331 @default.
• W1976622956 cites W2035357407 @default.
• W1976622956 cites W2035507354 @default.
• W1976622956 cites W2047219476 @default.
• W1976622956 cites W2069169033 @default.
• W1976622956 cites W2074906225 @default.
• W1976622956 cites W2083414728 @default.
• W1976622956 cites W2085995080 @default.
• W1976622956 cites W2087243573 @default.
• W1976622956 cites W2088661602 @default.
• W1976622956 cites W2099104943 @default.
• W1976622956 cites W2101143531 @default.
• W1976622956 cites W2105427468 @default.
• W1976622956 cites W2108166446 @default.
• W1976622956 cites W2111045993 @default.
• W1976622956 cites W2131324791 @default.
• W1976622956 cites W2133064391 @default.
• W1976622956 cites W2136656087 @default.
• W1976622956 cites W2136932227 @default.
• W1976622956 cites W2141340108 @default.
• W1976622956 cites W2141759421 @default.
• W1976622956 cites W2142184151 @default.
• W1976622956 cites W2142362473 @default.
• W1976622956 cites W2144050547 @default.
• W1976622956 cites W2148760132 @default.
• W1976622956 cites W2157796706 @default.
• W1976622956 cites W2157873533 @default.
• W1976622956 cites W2158130734 @default.
• W1976622956 cites W2163311832 @default.
• W1976622956 cites W2172174991 @default.
• W1976622956 doi "https://doi.org/10.1074/jbc.m510802200" @default.
• W1976622956 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16230345" @default.
• W1976622956 hasPublicationYear "2005" @default.
• W1976622956 type Work @default.
• W1976622956 sameAs 1976622956 @default.
• W1976622956 citedByCount "86" @default.
• W1976622956 countsByYear W19766229562012 @default.
• W1976622956 countsByYear W19766229562013 @default.
• W1976622956 countsByYear W19766229562014 @default.
• W1976622956 countsByYear W19766229562015 @default.
• W1976622956 countsByYear W19766229562016 @default.
• W1976622956 countsByYear W19766229562017 @default.
• W1976622956 countsByYear W19766229562018 @default.
• W1976622956 countsByYear W19766229562019 @default.
• W1976622956 countsByYear W19766229562020 @default.
• W1976622956 countsByYear W19766229562021 @default.
• W1976622956 countsByYear W19766229562022 @default.
• W1976622956 countsByYear W19766229562023 @default.
• W1976622956 crossrefType "journal-article" @default.
• W1976622956 hasAuthorship W1976622956A5008550296 @default.
• W1976622956 hasAuthorship W1976622956A5024930888 @default.
• W1976622956 hasAuthorship W1976622956A5030612899 @default.
• W1976622956 hasAuthorship W1976622956A5045577595 @default.
• W1976622956 hasAuthorship W1976622956A5049978831 @default.
• W1976622956 hasAuthorship W1976622956A5058162477 @default.
• W1976622956 hasAuthorship W1976622956A5060629623 @default.
• W1976622956 hasAuthorship W1976622956A5061000332 @default.
• W1976622956 hasAuthorship W1976622956A5080765625 @default.
• W1976622956 hasBestOaLocation W19766229561 @default.
• W1976622956 hasConcept C104317684 @default.
• W1976622956 hasConcept C111936080 @default.
• W1976622956 hasConcept C185592680 @default.
• W1976622956 hasConcept C502942594 @default.
• W1976622956 hasConcept C55493867 @default.
• W1976622956 hasConcept C69053785 @default.
• W1976622956 hasConcept C86339819 @default.
• W1976622956 hasConcept C86803240 @default.
• W1976622956 hasConcept C95444343 @default.
• W1976622956 hasConceptScore W1976622956C104317684 @default.
• W1976622956 hasConceptScore W1976622956C111936080 @default.

• next