FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1977251381> ?p ?o ?g. }

• W1977251381 endingPage "30693" @default.
• W1977251381 startingPage "30686" @default.
• W1977251381 abstract "Proprotein convertases (PCs) of the subtilisin/kexin family are responsible for the activation of prohormones, protrophic factors, and their receptors. We sought to determine whether loss of PC-mediated activities might affect the malignant phenotypes of cancer cells. Stable transfectants of α1-antitrypsin Portland (α1-PDX) cDNA, coding for a potent PC inhibitor, were analyzed in model HT-29 cells (HT-29/PDX) and in other cell lines. Expression of α1-PDX resulted in a proinsulin-like growth factor-1 receptor (pro-IGF-1R) processing blockade, hence inhibiting the ability of exogenous IGF-1 to induce tyrosine phosphorylation of its β-subunit and insulin-related substrate-1. Coexpression of IGF-1R with four different PCs or the novel convertase SKI-1 in the furin-defective LoVo-C5 cells demonstrated that pro-IGF-1R (∼200 kDa) cleavage into IGF-1R (β-subunit, ∼105 kDa) can be achieved by furin and PC5A, but not by PACE4, PC7, or SKI-1. Expression of α1-PDX resulted in reduction of DNA synthesis and in anchorage-independent growth. Following serum deprivation, the α1-PDX transfectants exhibited an enhanced apoptotic phenotype and were insensitive to IGF-1-mediated [3H]thymidine incorporation and protection against apoptosis. These cells showed reduced invasiveness that paralleled decreased mRNA levels of urokinase-type plasminogen activator and its receptor, tissue-type plasminogen activator, and plasminogen activator inhibitor-1. Comparative subcutaneous inoculation of cells in nude mice revealed that animals injected with HT-29/PDX cells exhibited delayed and lower incidence of tumor development as well as reduced tumor size. Immunohistochemical analysis of CD31 antigen expression, a marker of endothelial cells, revealed reduced HT-29/PDX tumor vascularization. These findings indicate that PCs actively contribute to the growth and malignant phenotypes of HT-29 tumors, suggesting that PC inhibition strategies may be a useful adduct to the arsenal of colorectal anticancer gene therapies. Proprotein convertases (PCs) of the subtilisin/kexin family are responsible for the activation of prohormones, protrophic factors, and their receptors. We sought to determine whether loss of PC-mediated activities might affect the malignant phenotypes of cancer cells. Stable transfectants of α1-antitrypsin Portland (α1-PDX) cDNA, coding for a potent PC inhibitor, were analyzed in model HT-29 cells (HT-29/PDX) and in other cell lines. Expression of α1-PDX resulted in a proinsulin-like growth factor-1 receptor (pro-IGF-1R) processing blockade, hence inhibiting the ability of exogenous IGF-1 to induce tyrosine phosphorylation of its β-subunit and insulin-related substrate-1. Coexpression of IGF-1R with four different PCs or the novel convertase SKI-1 in the furin-defective LoVo-C5 cells demonstrated that pro-IGF-1R (∼200 kDa) cleavage into IGF-1R (β-subunit, ∼105 kDa) can be achieved by furin and PC5A, but not by PACE4, PC7, or SKI-1. Expression of α1-PDX resulted in reduction of DNA synthesis and in anchorage-independent growth. Following serum deprivation, the α1-PDX transfectants exhibited an enhanced apoptotic phenotype and were insensitive to IGF-1-mediated [3H]thymidine incorporation and protection against apoptosis. These cells showed reduced invasiveness that paralleled decreased mRNA levels of urokinase-type plasminogen activator and its receptor, tissue-type plasminogen activator, and plasminogen activator inhibitor-1. Comparative subcutaneous inoculation of cells in nude mice revealed that animals injected with HT-29/PDX cells exhibited delayed and lower incidence of tumor development as well as reduced tumor size. Immunohistochemical analysis of CD31 antigen expression, a marker of endothelial cells, revealed reduced HT-29/PDX tumor vascularization. These findings indicate that PCs actively contribute to the growth and malignant phenotypes of HT-29 tumors, suggesting that PC inhibition strategies may be a useful adduct to the arsenal of colorectal anticancer gene therapies. proprotein convertases matrix metalloproteinase membrane-type matrix metalloproteinase insulin-like growth factor insulin-like growth factor-1 receptor α1-antitrypsin Portland urokinase-type plasminogen activator urokinase-type plasminogen activator receptor tissue-type plasminogen activator plasminogen activator inhibitor-1 insulin-related substrate-1 fetal calf serum phosphate-buffered saline polymerase chain reaction base pair subtilisin kexin isozyme-1 Proproteins are the fundamental units from which bioactive proteins and peptides are derived by limited proteolysis. Precursors are usually cleaved at the general motif (K/R)X n(K/R)↓, where n = 0, 2, 4, or 6 and X is usually not a Cys. Seven dibasic specific mammalian proprotein convertases (PCs)1 have been identified: furin, PC1/PC3, PC2, PC4, PACE4, PC5/PC6, and PC7/LPC/PC8. Each of these enzymes, either alone or in combination with others, is responsible for the tissue-specific processing of multiple polypeptide precursors. This combinatorial mechanism generates a large diversity of bioactive molecules in an exquisitely regulated manner (1Seidah N.G. Chrétien M. Curr. Opin. Biotechnol. 1997; 8: 602-607Crossref PubMed Scopus (241) Google Scholar, 2Nakayama K. Biochem. J. 1997; 32: 625-635Crossref Scopus (702) Google Scholar, 3Zhou A. Webb G. Zhu X. Steiner D.F. J. Biol. Chem. 1999; 274: 20745-20748Abstract Full Text Full Text PDF PubMed Scopus (411) Google Scholar, 4Seidah N.G. Chrétien M. Brain Res. 1999; 848: 45-62Crossref PubMed Scopus (690) Google Scholar). Some of these precursors include adhesion molecules, e.g. integrin α-subunits (5Lissitzky J.C. Luis J. Munzer J.S. Benjannet S. Parat F. Marvaldi J. Chrétien M. Seidah N.G. Biochem. J. 2000; 346: 133-138Crossref PubMed Scopus (98) Google Scholar); matrix metalloproteinases (MMPs) such as stromelysin-3 and membrane-type MMPs (MT-MMPs) (6Santavicca M. Noel A. Anglikerm H. Stoll I. Segain J.P. Anglard P. Chrétien M. Seidah N.G. Basset P. Biochem. J. 1996; 315: 953-958Crossref PubMed Scopus (73) Google Scholar, 7Yana I. Weiss S.J. Mol. Biol. Cell. 2000; 11: 2387-2401Crossref PubMed Scopus (268) Google Scholar); several growth factor precursors, including transforming growth factor-β (8Dubois C.M. Laprise M.H. Blanchette F. Gentry L.E. Leduc R. J. Biol. Chem. 1995; 270: 10618-10624Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar, 9Dubois C.M. Blanchette F. Laprise M.H. Leduc R. Grondin F. Seidah N.G. Am. J. Pathol. 2001; 158: 305-316Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar), insulin-like growth factor-1 (IGF-1), and IGF-2 (10Duguay S.J. Milewski W.M. Young B.D. Nakayama K. Steiner D.F. J. Biol. Chem. 1997; 272: 6663-6670Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 11Duguay S.J. Jin Y. Stein J. Duguay A.N. Gardner P. Steiner D.F. J. Biol. Chem. 1998; 273: 18443-18451Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 12Duguay S.J. Horm. Metab. Res. 1999; 31: 43-49Crossref PubMed Scopus (37) Google Scholar); and some growth factor proreceptors such as the insulin receptor (13Alarcon C. Cheatham B. Lincoln B. Kahn C.R. Siddle K. Rhodes C.J. Biochem. J. 1994; 301: 257-265Crossref PubMed Scopus (19) Google Scholar) and phosphotyrosine phosphatase µ (14Campan M. Yoshizumi M. Seidah N.G. Lee M.E. Bianchi C. Haber E. Biochemistry. 1996; 35: 3797-3802Crossref PubMed Scopus (58) Google Scholar). Recently, the potential clinical and pharmacological role of the convertases fostered the development of both peptide- and protein-based PC inhibitors (for reviews, see Refs. 1Seidah N.G. Chrétien M. Curr. Opin. Biotechnol. 1997; 8: 602-607Crossref PubMed Scopus (241) Google Scholar, 2Nakayama K. Biochem. J. 1997; 32: 625-635Crossref Scopus (702) Google Scholar, 3Zhou A. Webb G. Zhu X. Steiner D.F. J. Biol. Chem. 1999; 274: 20745-20748Abstract Full Text Full Text PDF PubMed Scopus (411) Google Scholar, 4Seidah N.G. Chrétien M. Brain Res. 1999; 848: 45-62Crossref PubMed Scopus (690) Google Scholar). The most promising protein-based specific inhibitors of PCs is an α1-antitrypsin variant known as α1-antitrypsin Portland (α1-PDX) (15Anderson E.D. Thomas L. Hayflick J.S. Thomas G. J. Biol. Chem. 1993; 268: 24887-24891Abstract Full Text PDF PubMed Google Scholar, 16Benjannet S. Savaria D. Laslop A. Munzer J.C. Chrétien M. Marcinkiewicz M. Seidah N.G. J. Biol. Chem. 1997; 272: 26210-26218Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 17Jean F. Stella K. Thomas L. Liu G. Xiang Y. Reason A.J. Thomas G. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7293-7298Crossref PubMed Scopus (241) Google Scholar) and the individual PC prosegment-based inhibitors (18Zhong M. Munzer J.S. Basak A. Benjannet S. Mowla S.J. Decroly E. Chrétien M. Seidah N.G. J. Biol. Chem. 1999; 274: 33913-33920Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Recent studies showed that inhibition of PCs by α1-PDX reduces the production level of the amyloid precursor α-secretase product β-amyloid precursor protein-α (19Lopez-Perez E. Seidah N.G. Checler F.J. Neurochemistry. 1999; 73: 2056-2062PubMed Google Scholar) and blocks the activation of the pore-forming toxin proaerolysin (20Abrami L. Fivaz M. Decroly E. Seidah N.G. Jean F. Thomas G. Leppla S.H. Buckley J.T. van der Goot F.G. J. Biol. Chem. 1998; 273: 32656-32661Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar), the cleavage of Notch (21Logeat F. Bessia C. Brou C. LeBail O. Jarriault S. Seidah N.G. Israel A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8108-8112Crossref PubMed Scopus (578) Google Scholar), the proteolytic activation of bone morphogenic factor-4 (22Cui Y. Jean F. Thomas G. Christian J.L. EMBO J. 1998; 17: 4735-4743Crossref PubMed Scopus (199) Google Scholar), and the maturation of the surface glycoproteins of infectious viruses (15Anderson E.D. Thomas L. Hayflick J.S. Thomas G. J. Biol. Chem. 1993; 268: 24887-24891Abstract Full Text PDF PubMed Google Scholar,17Jean F. Stella K. Thomas L. Liu G. Xiang Y. Reason A.J. Thomas G. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7293-7298Crossref PubMed Scopus (241) Google Scholar, 23Vollenweider F. Benjannet S. Decroly E. Savaria D. Lazure C. Thomas G. Chretien M. Seidah N.G. Biochem. J. 1996; 314: 521-532Crossref PubMed Scopus (82) Google Scholar). Multiple approaches, e.g. suppression of gene expression or enzyme inhibition, support the hypothesis that PCs play a role in the genesis and progression of different proliferative disorders, including cancer (7Yana I. Weiss S.J. Mol. Biol. Cell. 2000; 11: 2387-2401Crossref PubMed Scopus (268) Google Scholar, 24Mbikay M. Seidah N.G. Chrétien M. Ann. N. Y. Acad. Sci. 1993; 680: 13-19Crossref PubMed Scopus (18) Google Scholar, 25Chrétien M. Mbikay M. Gaspar L. Seidah N.G. Proc. Assoc. Am. Physicians. 1995; 107: 47-66PubMed Google Scholar, 26Vieau D. Seidah N.G. Mbikay M. Chrétien M. Bertagna X. J. Clin. Endocrinol. Metab. 1994; 79: 1503-1506Crossref PubMed Scopus (28) Google Scholar, 27Liu B. Amizuka N. Goltzman D. Rabbani S.A. Int. J. Cancer. 1995; 63: 276-281Crossref PubMed Scopus (33) Google Scholar, 28Mbikay M. Sirois F. Yao J. Seidah N.G. Chrétien M. Br. J. Cancer. 1997; 75: 1509-1514Crossref PubMed Scopus (114) Google Scholar, 29Cheng M. Watson P.H. Paterson J.A. Seidah N.G. Chrétien M. Shiu R.P. C Int. J. Cancer. 1997; 71: 966-971Crossref PubMed Scopus (132) Google Scholar, 30Cheng M. Xu N. Iwasiow B. Seidah N.G. Chrétien Shiu R.P.C. J. Mol. Endocrinol. 2001; 26: 95-105Crossref PubMed Scopus (20) Google Scholar, 31Kayo T. Sawada Y. Suzuki Y. Suda M. Tanaka S. Konda Y. Miyazaki J. Takeuchi T. J. Biol. Chem. 1996; 271: 10731-10737Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar, 32Konda Y. Yokota H. Kayo T. Horiuchi T. Sugiyama N. Tanaka S. Takata K. Takeuchi T. J. Clin. Invest. 1997; 99: 1842-1851Crossref PubMed Scopus (29) Google Scholar, 33Bassi D.E. Mahloogi H. Klein-Szanto A.J. Mol. Carcinog. 2000; 28: 63-69Crossref PubMed Scopus (72) Google Scholar, 34Kayo T. Sawada Y. Suda M. Konda Y. Izumi T. Tanaka S. Shibata H. Takeuchi T. Diabetes. 1997; 46: 1296-1304Crossref PubMed Scopus (35) Google Scholar). We previously reported that elevated expression of some members of the PC family is a characteristic of human breast, lung, and pituitary tumors (26Vieau D. Seidah N.G. Mbikay M. Chrétien M. Bertagna X. J. Clin. Endocrinol. Metab. 1994; 79: 1503-1506Crossref PubMed Scopus (28) Google Scholar, 28Mbikay M. Sirois F. Yao J. Seidah N.G. Chrétien M. Br. J. Cancer. 1997; 75: 1509-1514Crossref PubMed Scopus (114) Google Scholar, 29Cheng M. Watson P.H. Paterson J.A. Seidah N.G. Chrétien M. Shiu R.P. C Int. J. Cancer. 1997; 71: 966-971Crossref PubMed Scopus (132) Google Scholar, 30Cheng M. Xu N. Iwasiow B. Seidah N.G. Chrétien Shiu R.P.C. J. Mol. Endocrinol. 2001; 26: 95-105Crossref PubMed Scopus (20) Google Scholar). The critical nature of the furin processing of various precursors may explain the antiproliferative effect of furin blockade on H-500 rat Leydig tumor cells (27Liu B. Amizuka N. Goltzman D. Rabbani S.A. Int. J. Cancer. 1995; 63: 276-281Crossref PubMed Scopus (33) Google Scholar), GDM6 mouse gastric mucus cells (31Kayo T. Sawada Y. Suzuki Y. Suda M. Tanaka S. Konda Y. Miyazaki J. Takeuchi T. J. Biol. Chem. 1996; 271: 10731-10737Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar), and the pancreatic β-cell line MIN6 (32Konda Y. Yokota H. Kayo T. Horiuchi T. Sugiyama N. Tanaka S. Takata K. Takeuchi T. J. Clin. Invest. 1997; 99: 1842-1851Crossref PubMed Scopus (29) Google Scholar). Kayo et al. (34Kayo T. Sawada Y. Suda M. Konda Y. Izumi T. Tanaka S. Shibata H. Takeuchi T. Diabetes. 1997; 46: 1296-1304Crossref PubMed Scopus (35) Google Scholar) showed that conditioned medium derived from furin-overexpressing MIN6 cells stimulated the growth of their parental control cells, whereas the medium from cells expressing α1-PDX resulted in a lower growth rate. These results suggest that high furin expression stimulates growth through an autocrine/paracrine mechanism. In recent years, IGF-1 and its receptor have emerged as key regulators of mitogenesis and tumorigenicity (35Baserga R. Exp. Cell Res. 1999; 253: 1-6Crossref PubMed Scopus (264) Google Scholar). It is well established that a functional IGF-1R is required for cell growth and plays a crucial role in survival of various transformed cells in vitro andin vivo (35Baserga R. Exp. Cell Res. 1999; 253: 1-6Crossref PubMed Scopus (264) Google Scholar, 36Long L. Rubin R. Brodt P. Exp. Cell Res. 1998; 238: 116-121Crossref PubMed Scopus (69) Google Scholar). In tumor cells, including colorectal cancer cells, IGF-1 alone or in combination with IGF-2 acts as an autocrine/paracrine growth factor (37Lahm H. Amstad P. Wyniger J. Yilmaz A. Fischer J.R. Schreyer M. Givel J.C. Int. J. Cancer. 1994; 58: 452-459Crossref PubMed Scopus (137) Google Scholar) as well as an inhibitor of apoptosis (35Baserga R. Exp. Cell Res. 1999; 253: 1-6Crossref PubMed Scopus (264) Google Scholar, 38Peruzzi F. Prisco M. Dews M. Salomoni P. Grassilli E. Romano G. Calabretta B. Baserga R. Mol. Cell. Biol. 1999; 19: 7203-7215Crossref PubMed Scopus (429) Google Scholar). Defects in IGF-1R expression and/or activation inhibit tumorigenicity, reverse the transformed phenotype, and cause massive apoptosis in vitro and in vivo (35Baserga R. Exp. Cell Res. 1999; 253: 1-6Crossref PubMed Scopus (264) Google Scholar, 36Long L. Rubin R. Brodt P. Exp. Cell Res. 1998; 238: 116-121Crossref PubMed Scopus (69) Google Scholar, 37Lahm H. Amstad P. Wyniger J. Yilmaz A. Fischer J.R. Schreyer M. Givel J.C. Int. J. Cancer. 1994; 58: 452-459Crossref PubMed Scopus (137) Google Scholar, 38Peruzzi F. Prisco M. Dews M. Salomoni P. Grassilli E. Romano G. Calabretta B. Baserga R. Mol. Cell. Biol. 1999; 19: 7203-7215Crossref PubMed Scopus (429) Google Scholar, 39Burfeind P. Chernicky C.L. Rininsland F. Ilan J. Ilan J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7263-7281Crossref PubMed Scopus (227) Google Scholar, 40Long L. Rubin R. Baserga R. Brodt P. Cancer Res. 1995; 55: 1006-1009PubMed Google Scholar). This anti-oncogenic effect of IGF-1R blockade likely involves the modulation of the levels of various effectors that play important roles in tumor growth and metastasis, e.g. urokinase-type plasminogen activator (uPA), tissue-type plasminogen activator (tPA), and plasminogen activator inhibitor-1 (PAI-1) (39Burfeind P. Chernicky C.L. Rininsland F. Ilan J. Ilan J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7263-7281Crossref PubMed Scopus (227) Google Scholar, 41Dunn S.E. Torres J.V. Nihei N. Barrett J.C. Mol. Carcinog. 2000; 27: 10-17Crossref PubMed Scopus (47) Google Scholar). The mature IGF-1R is a transmembrane glycoprotein consisting of two pairs of intramolecularly disulfide-bonded α- and β-chains (α2β2). The latter are generated by intracellular cleavage of IGF-1R at the tetrabasic RKRR740↓ sequence (see Fig. 1 A) (42Ullrich A. Gray A. Tam A.W. Yang-Feng T. Tsubokawa M. Collins C. Henzel W. Le Bon T. Kathuria S. Chen E. Jacobs S. Francke U. Ramachandran J. Fujita-Yamaguchi Y. EMBO J. 1986; 5: 2503-2512Crossref PubMed Scopus (1505) Google Scholar) by one or more undefined processing enzymes, possibly PC-like in nature (43Lehmann M. André F. Bellan C. Remacle-Bonnet M. Garrouste F. Parat F. Lissitsky J.C. Marvaldi J. Pommier G. Endocrinology. 1998; 139: 3763-3771Crossref PubMed Scopus (43) Google Scholar). Activation of IGF-1R induces Tyr phosphorylation of its β-subunit and of its insulin receptor substrate-1 (IRS-1), thereby triggering an intracellular signaling cascade (44Sun X.J. Rothenberg P. Kahn C.R. Backer J.M. Araki E. Wilden P.A. Cahill D.A. Goldstein B.J. White M.F. Nature. 1991; 352: 73-77Crossref PubMed Scopus (1284) Google Scholar). In this report, α1-PDX-producing colorectal tumor cells and other cells allowed us to define the processing enzymes of IGF-1R and to examine the consequences of their inhibition on the physiological functions of IGF-1R. The observed effect of α1-PDX on the reduction of cellular proliferation, invasion, and tumorigenicity in nude mice implicated the PCs in these processes and suggested that their inhibition could form a basis for adjunct gene therapy in cancer. The control (pcDNA3 vector) and stably α1-PDX-transfected Jurkat T human leukemia and AtT20 mouse tumor pituitary cell lines were previously described (16Benjannet S. Savaria D. Laslop A. Munzer J.C. Chrétien M. Marcinkiewicz M. Seidah N.G. J. Biol. Chem. 1997; 272: 26210-26218Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 19Lopez-Perez E. Seidah N.G. Checler F.J. Neurochemistry. 1999; 73: 2056-2062PubMed Google Scholar, 21Logeat F. Bessia C. Brou C. LeBail O. Jarriault S. Seidah N.G. Israel A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8108-8112Crossref PubMed Scopus (578) Google Scholar). The control (pBK-CMV vector; HT-29/CTL) and stably α1-PDX (HT-29/PDX)-transfected HT-29-D4 human colon adenocarcinoma cell lines were derived from a pool of Pseudomonas Exotoxin A-resistant clones as previously described (45Berthet V. Rigot V. Champion S. Secchi J. Fouchier F. Marvaldi J. Luis J. J. Biol. Chem. 2000; 275: 33308-33313Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). LoVo-C5 human colon adenocarcinoma cells were transiently transfected with the empty pIRES2-EGFP vector (CLONTECH, Palo Alto, CA) or with one that expresses full-length human furin, PACE4, SKI-1, mouse PC5A, or rat PC7 (4Seidah N.G. Chrétien M. Brain Res. 1999; 848: 45-62Crossref PubMed Scopus (690) Google Scholar) using Effectene transfection reagent (QIAGEN Inc., Mississauga, Ontario, Canada) as recommended by the manufacturer. Jurkat cells were grown in RPMI 1640 medium, and HT-29, LoVo-C5, and AtT20 cells were grown in Dulbecco's modified Eagle's medium, both supplemented with 10% fetal calf serum (FCS). In both culture media, 100 units/ml penicillin, 100 mg/ml streptomycin (Life Technologies, Inc., Burlington, Ontario), and, for stable transfectants, 200 µg/ml G418 were added. Cells were lysed in phosphate-buffered saline (PBS) containing 2% Nonidet P-40; lysates were subjected to SDS-polyacrylamide gel electrophoresis on 8% gels; and proteins were blotted onto nitrocellulose membranes. The primary antibodies used were rabbit anti-human IGF-1R polyclonal antibody recognizing carboxyl-terminal amino acids 1447–1366 (1:1000 dilution; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and anti-phosphotyrosine (2 µg/ml) and anti-actin (1:1000 dilution) antibodies (Sigma, Oakville, Ontario). Primary antibodies were revealed by horseradish peroxidase-conjugated secondary antibodies (1:10000 dilution; Amersham Pharmacia Biotech, Baie-d'Urfé, Quebec, Canada) and enhanced chemiluminescence (ECL+Plus, Amersham Pharmacia Biotech) according to the manufacturers' instructions. Band intensities of the autoradiographs were quantitated by densitometry. Confluent HT-29/CTL and HT-29/PDX cells grown in 75-cm2 flasks were maintained in serum-free Dulbecco's modified Eagle's medium for 24 h and incubated with or without 50 ng/ml IGF-1 for 2 min at 37 °C. Cells were washed twice in ice-cold PBS and lysed with 500 µl/dish lysis buffer (50 mm HEPES (pH 7.6), 150 mm NaCl, 1% Triton X-100, 2 mm vanadate, 100 mm NaF, and 0.40 mg/ml phenylmethylsulfonyl fluoride). Equal amounts of proteins (1 mg) were immunoprecipitated overnight with anti-IGF-1R or IRS-1 polyclonal antibody (10 µg/ml; Santa Cruz Biotechnology, Inc.), and the whole pellets were analyzed by Western blotting. [3H]Thymidine incorporation in 2 × 104 cells/well in 96-well culture plates was assayed as follows. 24 h hours after plating, cells were incubated in a growth arrest medium (0.5% FCS) for the next 24 h and then incubated for an additional 24 h in fresh medium containing various concentrations of serum or IGF-1. For the last 6 h of incubation, 0.5 µCi/well [3H]methylthymidine (Amersham Pharmacia Biotech) was added. Cells were then harvested onto glass-fiber filters using a cell harvester (Amersham Pharmacia Biotech, Wallac Oy, Turku, Finland) and counted using a Betaplate liquid scintillation counter (Amersham Pharmacia Biotech). Results are expressed as percentages of the values obtained for vector-transfected cells in the absence of serum. Doubling times were assessed by cell counting with a hemocytometer following culture of 10,000 cells/well in 12-well plates for 3 days. To assay anchorage-independent colony formation, 4 × 103 cells were suspended in complete medium containing 0.3% agar and seeded in triplicate in six-well plates onto a base layer of complete medium containing 0.5% agar. Complete medium was added every 3 days. After 14 days, colonies >100 µm in diameter were counted by inverted microscopy. To induce apoptosis, cells grown on 100-mm dishes to 80% confluency were placed in serum-free medium with or without 100 ng/ml IGF-1 for the indicated time periods. Apoptotic cells were analyzed by cell death and DNA ladder assays and propidium iodide staining. For the cell death assay, floating and attached cells were separately resuspended in 0.4% trypan blue (Life Technologies, Inc.), and cells that had taken up this dye were considered nonviable. The percentage of dead cells was calculated as a ratio of floating dead cells to the total of number of cells/culture dish. For the DNA ladder assay, genomic DNA was isolated from attached cells using the apoptotic DNA ladder detection kit (Chemicon International, Inc., Temecula, CA) according to the manufacturer's instructions and analyzed on 2% agarose gels. For propidium iodide cell staining, cells were incubated in propidium iodide for 5 min, and the percentage of stained cells was determined by fluorescence-activated cell sorter analysis (Becton Dickinson Inc., San Jose, CA). At least 10,000 cells were examined for each sample. HT-29/CTL and HT-29/PDX cell invasiveness was assessed in vitro using the reconstituted basement membrane (Matrigel) assay. Matrigel (0.25 mg/ml; Collaborative Research, Bedford, MA) in PBS was used to coat the filter (8-µm pore size), and human fibronectin (5 µg/ml; Sigma) was used as a chemoattractant in the lower chamber (24-well Transwell plate, Corning Inc., Corning, NY). Cells (5 × 104/6.5-mm filter) were incubated for 48 h, and cells that migrated to the underside of the filters were stained and counted using an inverted microscope. Using the Trizol reagent (Life Technologies, Inc.) according to the manufacturer's instructions, total RNA was extracted, and predefined amounts (0.2–4 µg; see below) were reversed-transcribed in a 20-µl reaction mixture containing 50 mm Tris-HCl (pH 8.3), 30 mm KCl, 8 mm MgCl2, 1 mm dNTPs, and 0.2 units of avian myeloblastosis virus reverse transcriptase (Amersham Pharmacia Biotech). In each case, the 3′-antisense oligonucleotide (2 µm) was used to initiate reverse transcription. The mixture was sequentially incubated for 10 min at 25 °C, for 60 min at 37 °C, and for 5 min at 95 °C. cDNAs were amplified by PCR using the following oligonucleotides: uPAR, CCTGGAGCTTGAAAATCTGC and GGTGATGGTGAGGCTGAGAT (352-bp product); uPA, TTGCTGGTTGTCATTTTTGC and CTCCCACATTGGCTAAGCTC (402-bp product); tPA, GAGATCCCGCCTCTTCTTCT and GGAAAGGGGAAGGAGACTTG (504-bp product); PAI-1, TGGAACTACGGGGCTTACAG and AGTGGCTGGACTTCCTGAGA (554-bp product); and glyceraldehyde-3-phosphate dehydrogenase, TGGAAATCCCATCACCATCT and GTCTTCTGGGTGGCAGTGAT (520-bp product). The PCRs (50 µl) included 10 µl of the cDNA sample, 5 µm each primer, 200 µm dNTPs, and 0.2 units of Taq polymerase (Amersham Pharmacia Biotech) in the buffer supplied by the manufacturer. PCR conditions were as follows: 30 s at 94 °C, 30 s at 56 °C, and 30 s at 72 °C for 25 cycles using a PerkinElmer Life Sciences thermocycler. The quantity of total RNA introduced in the reverse transcription reaction was set independently for each gene product to be below the saturation point of the reaction. Amplified PCR products were analyzed on a 1.5% agarose gel. Cells (1 × 106 HT-29/CTL or HT-29/PDX) were injected subcutaneously into 4-week-old male athymic mice. The animals were monitored for tumor formation every 3 days and killed 31 days after injection. Tumor volume was calculated using the formula described by Kyriazis et al. (46Kyriazis A.P. Kyriazis A.A. Scarpelli D.G. Fogh J. Rao M.S. Lepera R. Am. J. Pathol. 1982; 106: 250-260PubMed Google Scholar): tumor volume = (width)2 × length × 0.4. The tumors were removed; embedded in OCT compound; and frozen rapidly in isopentane, which was precooled in liquid nitrogen to −180 °C and stored at −70 °C. 17 days following the subcutaneous injection of HT-29/CTL and HT-29/PDX cells, the developed tumors were frozen, cryosectioned to 10–15 µm at −20 °C, fixed in 4% PBS/paraformaldehyde, and incubated with 0.3% H2O2 in methanol for 20 min at room temperature to block endogenous peroxidase. Slides were rinsed with blocking solution (PBS supplemented with 5% skim milk and 0.1% Tween 20) and then incubated overnight at 4 °C with anti-mouse CD31 monoclonal antibody (Pharmingen, San Diego, CA) at 1:50 dilution. Following washes in PBS, sections were incubated with peroxidase-conjugated goat anti-rat IgG (Chemicon International, Inc.) at 1:100 dilution for 2 h, washed, and incubated with diaminobenzidine substrate. Staining was monitored under a microscope, and the reaction was stopped by washing with PBS. The corresponding frozen tumor sections were also stained with hematoxylin and eosin (Sigma). IGF-1R is processed at the RKRR740↓ site into the α- and membrane-bound β-subunits (Fig. 1 A) (42Ullrich A. Gray A. Tam A.W. Yang-Feng T. Tsubokawa M. Collins C. Henzel W. Le Bon T. Kathuria S. Chen E. Jacobs S. Francke U. Ramachandran J. Fujita-Yamaguchi Y. EMBO J. 1986; 5: 2503-2512Crossref PubMed Scopus (1505) Google Scholar,43Lehmann M. André F. Bellan C. Remacle-Bonnet M. Garrouste F. Parat F. Lissitsky J.C. Marvaldi J. Pommier G. Endocrinology. 1998; 139: 3763-3771Crossref PubMed Scopus (43) Google Scholar). To affirm the involvement of PCs in IGF-1R maturation and to investigate which of them are likely to be the best convertases for this precursor, endogenous IGF-1R processing was examined in furin activity-deficient LoVo-C5 cells (47Takahashi S. Kasai K. Hatsuzawa K. Kitamura N. Misumi Y. Ikehara Y. Murakami K. Nakayama K. Biochem. Biophys. Res. Commun. 1993; 195: 1019-1026Crossref PubMed Scopus (115) Google Scholar). In these cells, the majority of IGF-1R was expressed as an immature ∼200-kDa form, and only a small amount of the receptor was cleaved to generate its β-subunit (apparent molecular mass of ∼105 kDa), suggesting that PCs other than furin may contribute to this processing. LoVo-C5 cells were thus transfected with furin, PC5A, PC7, PACE4, or SKI-1 cDNA-containing vectors (Fig. 1 B). IGF-1R/total signal intensity ratios, calculated as an indication of cleavage, were found to be 63 and 53% for furin and PC5A, respectively, whereas PC7, PACE4, and SKI-1 did not enhance the cleavage of IGF-1R. The processing of IGF-1R was then examined in control (CTL) and α1-PDX (PDX)-expressing HT-29 pool and Jurkat cells (Fig.1 C). In empty vector-transfected cells (CTL), both unprocessed and mature forms of IGF-1R were detected. However, in α1-PDX-transfected cells, the mature β-subunit was barely detectable. In these cells, pro-IGF-1R was also present as a slower migrating species believed to be a trans-Golgi network-associated form of pro-IGF-1R, as reported for transforming growth factor-β (9Dubois C.M. Blanchette F. Laprise M.H. Leduc R. Grondin F. Seidah N.G. Am. J. Pathol. 2001; 158: 305-316Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). Furthermore, only the lower band was observed in the presence of the fungal metabolite brefeldin A (data no" @default.
• W1977251381 created "2016-06-24" @default.
• W1977251381 creator A5000730685 @default.
• W1977251381 creator A5001789482 @default.
• W1977251381 creator A5009035456 @default.
• W1977251381 creator A5017975348 @default.
• W1977251381 creator A5034988767 @default.
• W1977251381 creator A5037386757 @default.
• W1977251381 creator A5090995081 @default.
• W1977251381 date "2001-08-01" @default.
• W1977251381 modified "2023-09-27" @default.
• W1977251381 title "Inhibition of Proprotein Convertases Is Associated with Loss of Growth and Tumorigenicity of HT-29 Human Colon Carcinoma Cells" @default.
• W1977251381 cites W1569326224 @default.
• W1977251381 cites W1681257257 @default.
• W1977251381 cites W1812255132 @default.
• W1977251381 cites W1885047062 @default.
• W1977251381 cites W1931843124 @default.
• W1977251381 cites W1956084877 @default.
• W1977251381 cites W1968099238 @default.
• W1977251381 cites W1968774879 @default.
• W1977251381 cites W1968953041 @default.
• W1977251381 cites W1973372369 @default.
• W1977251381 cites W1973901159 @default.
• W1977251381 cites W1981718544 @default.
• W1977251381 cites W1983336935 @default.
• W1977251381 cites W1990530426 @default.
• W1977251381 cites W1991263759 @default.
• W1977251381 cites W1991576220 @default.
• W1977251381 cites W1993531220 @default.
• W1977251381 cites W2004593684 @default.
• W1977251381 cites W2005413045 @default.
• W1977251381 cites W2005873549 @default.
• W1977251381 cites W2009451560 @default.
• W1977251381 cites W2014329048 @default.
• W1977251381 cites W2023374250 @default.
• W1977251381 cites W2028792580 @default.
• W1977251381 cites W2037838520 @default.
• W1977251381 cites W2040252771 @default.
• W1977251381 cites W2042427553 @default.
• W1977251381 cites W2043231137 @default.
• W1977251381 cites W2045267752 @default.
• W1977251381 cites W2046820814 @default.
• W1977251381 cites W2055360422 @default.
• W1977251381 cites W2060650125 @default.
• W1977251381 cites W2061260000 @default.
• W1977251381 cites W2062808764 @default.
• W1977251381 cites W2063563601 @default.
• W1977251381 cites W2064801081 @default.
• W1977251381 cites W2068955281 @default.
• W1977251381 cites W2077163123 @default.
• W1977251381 cites W2077408893 @default.
• W1977251381 cites W2082195162 @default.
• W1977251381 cites W2082528610 @default.
• W1977251381 cites W2083354235 @default.
• W1977251381 cites W2090602673 @default.
• W1977251381 cites W2091347532 @default.
• W1977251381 cites W2094958641 @default.
• W1977251381 cites W2095419805 @default.
• W1977251381 cites W2096470048 @default.
• W1977251381 cites W2101015327 @default.
• W1977251381 cites W2115207115 @default.
• W1977251381 cites W2116189789 @default.
• W1977251381 cites W2118817852 @default.
• W1977251381 cites W2121513486 @default.
• W1977251381 cites W2122256029 @default.
• W1977251381 cites W2132764202 @default.
• W1977251381 cites W2138762676 @default.
• W1977251381 cites W2141972226 @default.
• W1977251381 cites W2142527893 @default.
• W1977251381 cites W2162700552 @default.
• W1977251381 cites W4242883014 @default.
• W1977251381 cites W53883515 @default.
• W1977251381 cites W8879375 @default.
• W1977251381 doi "https://doi.org/10.1074/jbc.m101725200" @default.
• W1977251381 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11402025" @default.
• W1977251381 hasPublicationYear "2001" @default.
• W1977251381 type Work @default.
• W1977251381 sameAs 1977251381 @default.
• W1977251381 citedByCount "161" @default.
• W1977251381 countsByYear W19772513812012 @default.
• W1977251381 countsByYear W19772513812013 @default.
• W1977251381 countsByYear W19772513812014 @default.
• W1977251381 countsByYear W19772513812015 @default.
• W1977251381 countsByYear W19772513812016 @default.
• W1977251381 countsByYear W19772513812017 @default.
• W1977251381 countsByYear W19772513812018 @default.
• W1977251381 countsByYear W19772513812019 @default.
• W1977251381 countsByYear W19772513812020 @default.
• W1977251381 countsByYear W19772513812021 @default.
• W1977251381 countsByYear W19772513812022 @default.
• W1977251381 countsByYear W19772513812023 @default.
• W1977251381 crossrefType "journal-article" @default.
• W1977251381 hasAuthorship W1977251381A5000730685 @default.
• W1977251381 hasAuthorship W1977251381A5001789482 @default.
• W1977251381 hasAuthorship W1977251381A5009035456 @default.
• W1977251381 hasAuthorship W1977251381A5017975348 @default.
• W1977251381 hasAuthorship W1977251381A5034988767 @default.
• W1977251381 hasAuthorship W1977251381A5037386757 @default.

• next