FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1977795985> ?p ?o ?g. }

• W1977795985 endingPage "13015" @default.
• W1977795985 startingPage "13007" @default.
• W1977795985 abstract "Ikaros is essential for the normal development and regulated proliferation of lymphoid cells. In lymphocytes, Ikaros exists as an integral component of chromatin-remodeling complexes, including the Mi-2β/nucleosome remodeling and deacetylation complex (NuRD) complex. It is expected that Ikaros, together with these associated activities effects repression, but here we show that they may also potentiate gene expression in cycling cells. Ikaros cannot activate transcription by itself; instead, it enhances the activity of both weak and strong activators. For this role in potentiation, Ikaros requires its DNA binding and dimerization domains. The DNA binding and dimerization properties of Ikaros are also responsible for its targeting to pericentromeric heterochromatin (PC-HC). Significantly, Ikaros mutants with altered specificity for DNA binding that are unable to localize to PC-HC are incapable of stimulating transcription from reporters bearing their cognate sites. Thus, potentiation of gene expression by Ikaros correlates strongly with its ability to localize to PC-HC in combination with the chromatin remodeler Mi-2β. Ikaros is essential for the normal development and regulated proliferation of lymphoid cells. In lymphocytes, Ikaros exists as an integral component of chromatin-remodeling complexes, including the Mi-2β/nucleosome remodeling and deacetylation complex (NuRD) complex. It is expected that Ikaros, together with these associated activities effects repression, but here we show that they may also potentiate gene expression in cycling cells. Ikaros cannot activate transcription by itself; instead, it enhances the activity of both weak and strong activators. For this role in potentiation, Ikaros requires its DNA binding and dimerization domains. The DNA binding and dimerization properties of Ikaros are also responsible for its targeting to pericentromeric heterochromatin (PC-HC). Significantly, Ikaros mutants with altered specificity for DNA binding that are unable to localize to PC-HC are incapable of stimulating transcription from reporters bearing their cognate sites. Thus, potentiation of gene expression by Ikaros correlates strongly with its ability to localize to PC-HC in combination with the chromatin remodeler Mi-2β. nucleosome remodeling and deacetylation complex pericentromeric heterochromatin DNA binding domain chloramphenicol acetyl transferase Ikaros growth hormone CCAAT-binding factor Lineage commitment and differentiation along the hemolymphoid pathway rely heavily on Ikaros, which encodes a number of Krüppel-type zinc finger proteins (1.Georgopoulos K. Moore D. Derfler B. Science. 1992; 258: 808-812Crossref PubMed Scopus (378) Google Scholar, 2.Georgopoulos K. Winandy S. Avitahl N. Annu. Rev. Immunol. 1997; 15: 155-176Crossref PubMed Scopus (213) Google Scholar, 3.Cortes, M., Wong, E., Koipally, J., and Georgopoulos, K. (1999)Curr. Opin. Immunol.Google Scholar, 4.Koipally J. Kim J. Jones B. Jackson A. Avitahl N. Winandy S. Trevisan M. Nichogiannopoulou A. Kelley C. Georgopoulos K. Cold Spring Harbor Symposia on Quantitative Biology. LXIV. Cold Spring Harbor Laboratory Press, NY2000: 1-8Google Scholar). Ikaroscontains seven coding exons, four of which can be alternatively utilized to generate a number of isoforms (5.Molnár Á. Georgopoulos K. Mol. Cell. Biol. 1994; 14: 785-794Google Scholar, 6.Hahm K. Ernst P. Lo K. Kim G.S. Turck C. Smale S.T. Mol. Cell. Biol. 1994; 14: 7111-7123Crossref PubMed Scopus (198) Google Scholar). These Ikaros proteins differ in the number of N-terminal zinc fingers that constitute their DNA binding domain. Ikaros isoforms with at least three N-terminal zinc fingers (i.e. Ik-1, Ik-2 and Ik-3) are capable of binding a high affinity Ikaros site that contains the GGGAA core motif, whereas all other isoforms cannot bind this site (5.Molnár Á. Georgopoulos K. Mol. Cell. Biol. 1994; 14: 785-794Google Scholar). Nonetheless, all of the Ikaros isoforms share two hunchback-related zinc fingers at their C terminus, which are necessary for dimerization between Ikaros proteins and family members (7.Sun L. Liu A. Georgopoulos K. EMBO J. 1996; 15: 5358-5369Crossref PubMed Scopus (307) Google Scholar). Interactions between Ikaros isoforms that can and cannot bind DNA compromise the ability of the resulting complex to bind DNA (7.Sun L. Liu A. Georgopoulos K. EMBO J. 1996; 15: 5358-5369Crossref PubMed Scopus (307) Google Scholar, 8.Georgopoulos K. Bigby M. Wang J.-H. Molnár Á. Wu P. Winandy S. Sharpe A. Cell. 1994; 79: 143-156Abstract Full Text PDF PubMed Scopus (792) Google Scholar). This indicates that the non-DNA binding Ikaros isoforms can act as naturally occurring dominant negative factors to regulate the activity of the DNA binding isoforms. A role for Ikaros is manifested from the earliest steps of the hemopoietic pathway. Lack of Ikaros causes a significant reduction (30–40-fold) in hemopoietic stem cell activity that is made more severe (>100-fold) by the increased expression of its dominant negative isoforms (9.Nichogiannopoulou A. Trevisan M. Naben S. Friedrich C. Georgopoulos K. J. Exp. Med. 1999; 190: 1201-1214Crossref PubMed Scopus (184) Google Scholar). Lineage restriction of multipotent hemopoietic progenitors toward the lymphoid pathways is severely affected in the absence of Ikaros. Mice homozygous for an Ikaros null mutation lack all B, natural killer, and fetal T cells as well as the earliest described lymphoid progenitor (10.Wang J. Nichogiannopoulou A. Wu L. Sun L. Sharpe A. Bigby M. Georgopoulos K. Immunity. 1996; 5: 537-549Abstract Full Text PDF PubMed Scopus (505) Google Scholar). Nonetheless, some postnatal T cell precursors are generated in these mice, though they display skewing in their differentiation toward the CD4/TCRαβ lineage (10.Wang J. Nichogiannopoulou A. Wu L. Sun L. Sharpe A. Bigby M. Georgopoulos K. Immunity. 1996; 5: 537-549Abstract Full Text PDF PubMed Scopus (505) Google Scholar). The limited number of Ikaros-deficient thymocytes and mature T cells display a T cell receptor-mediated hyperproliferative phenotype in vitro and undergo rapid clonal expansions in vivo (10.Wang J. Nichogiannopoulou A. Wu L. Sun L. Sharpe A. Bigby M. Georgopoulos K. Immunity. 1996; 5: 537-549Abstract Full Text PDF PubMed Scopus (505) Google Scholar). Mice homozygous for a mutation that generates only dominant negative Ikaros isoforms display similar but more severe defects (8.Georgopoulos K. Bigby M. Wang J.-H. Molnár Á. Wu P. Winandy S. Sharpe A. Cell. 1994; 79: 143-156Abstract Full Text PDF PubMed Scopus (792) Google Scholar). In addition to the B and natural killer cell deficiency, they lack all fetal and adult T cells. Mice heterozygous for this mutation have lymphocyte populations that appear normal; however, their T cells display augmented T cell receptor-mediated proliferative responses, and they rapidly develop leukemias and lymphomas (11.Winandy S. Wu P. Georgopoulos K. Cell. 1995; 83: 289-299Abstract Full Text PDF PubMed Scopus (362) Google Scholar, 12.Avitahl N. Winandy S. Friedrich C. Jones B. Ge Y. Georgopoulos K. Immunity. 1999; 10: 333-343Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 13.Winandy S. Wu L. Wang J.H. Georgopoulos K. J. Exp. Med. 1999; 190: 1039-1048Crossref PubMed Scopus (134) Google Scholar). The more severe phenotype of the dominant negative compared with the null mice suggested the presence of family members whose activity was affected by this mutation. Consistent with this hypothesis, three family members were identified (Aiolos (14.Morgan B. Sun L. Avitahl N. Andrikopoulos K. Gonzales E. Nichogiannopoulou A. Wu P. Neben S. Georgopoulos K. EMBO J. 1997; 16: 2004-2013Crossref PubMed Scopus (293) Google Scholar), Helios (15.Hahm K. Cobb B.S. McCarty A.S. Brown K.E. Klug C.A. Lee R. Akashi K. Weissman I.L. Fisher A.G. Smale S.T. Genes Dev. 1998; 12: 782-796Crossref PubMed Scopus (209) Google Scholar, 16.Kelley C.M. Ikeda T. Koipally J. Avitahl N. Georgopoulos K. Morgan B.A. Curr. Biol. 1998; 8: 508-515Abstract Full Text Full Text PDF PubMed Google Scholar), and Eos/Daedalus (17.Honma Y. Kiyosawa H. Mori T. Oguri A. Nikaido T. Kanazawa K. Tojo M. Takeda J. Tanno Y. Yokoya S. Kawabata I. Ikeda H. Wanaka A. FEBS Lett. 1999; 447: 76-80Crossref PubMed Scopus (54) Google Scholar, 18.Perdomo J. Holmes M. Chong B. Crossley M. J. Biol. Chem. 2000; 275: 38347-38354Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar)) that are more restricted in hemopoietic expression relative to Ikaros. The aforementioned studies identify Ikaros as an important regulator of several steps in the hemolymphoid pathways (2.Georgopoulos K. Winandy S. Avitahl N. Annu. Rev. Immunol. 1997; 15: 155-176Crossref PubMed Scopus (213) Google Scholar, 3.Cortes, M., Wong, E., Koipally, J., and Georgopoulos, K. (1999)Curr. Opin. Immunol.Google Scholar, 4.Koipally J. Kim J. Jones B. Jackson A. Avitahl N. Winandy S. Trevisan M. Nichogiannopoulou A. Kelley C. Georgopoulos K. Cold Spring Harbor Symposia on Quantitative Biology. LXIV. Cold Spring Harbor Laboratory Press, NY2000: 1-8Google Scholar, 19.Georgopoulos K. Curr. Opin. Immunol. 1997; 9: 228-232Crossref PubMed Scopus (64) Google Scholar). The mechanisms by which Ikaros operates along this pathway have been the focus of diverse studies, some of which implicate it as a repressor of gene expression for the following reasons. First, in actively cycling primary lymphocytes, Ikaros concentrates in distinctive toroidal structures, which are found in apposition to pericentromeric heterochromatin and a variety of transcriptionally silent genes (20.Brown K.E. Guest S.S. Smale S.T. Hahm K. Merkenschlager M. Fisher A.G. Cell. 1997; 91: 845-854Abstract Full Text Full Text PDF PubMed Scopus (658) Google Scholar). Second, in late S phase, some of the Ikaros toroids become coincident with clusters of DNA replication origins, which presumably are sites of replicating heterochromatin (12.Avitahl N. Winandy S. Friedrich C. Jones B. Ge Y. Georgopoulos K. Immunity. 1999; 10: 333-343Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). Third, a biochemical purification of Ikaros from lymphocytes has determined that the majority of Ikaros exists within a stable 2MD complex containing components of the NuRD1 complex that includes the ATPase, Mi-2β, and Class I histone deacetylases that are presumed to play a role in repression (21.Kim J. Sif S. Jones B. Jackson A. Koipally J. Heller B. Winandy S. Veil A. Sawyer A. Ikeda T. Kingston R. Georgopoulos K. Immunity. 1999; 10: 345-355Abstract Full Text Full Text PDF PubMed Scopus (483) Google Scholar), while a smaller fraction of Ikaros also interacts with the putative co-repressors Sin3 and C-terminal binding protein (22.Koipally J. Renold A. Kim J. Georgopoulos K. EMBO J. 1999; 18: 3090-3100Crossref PubMed Scopus (257) Google Scholar, 23.Koipally J. Georgopoulos K. J. B. Chem. 2000; 275: 19594-19602Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). Fourth, heterologous fusions of Ikaros to the Gal4 DNA binding domain behave as potent transcriptional repressors (22.Koipally J. Renold A. Kim J. Georgopoulos K. EMBO J. 1999; 18: 3090-3100Crossref PubMed Scopus (257) Google Scholar). Furthermore, recent studies have suggested that Ikaros may be involved in the repression of the λ5 and terminal deoxynucleotidyl transferase genes (24.Sabbattini P. Lundgren M. Georgiou A. Chow C. Warnes G. Dillon N. EMBO J. 2001; 20: 2812-2822Crossref PubMed Scopus (122) Google Scholar, 25.Trinh L.A. Ferrini R. Cobb B.S. Weinmann A.S. Hahm K. Ernst P. Garraway I.P. Merkenschlager M. Smale S.T. Genes Dev. 2001; 15: 1817-1832Crossref PubMed Scopus (125) Google Scholar). Ikaros has also been reported to function as an activator of transcription. Ectopic expression of Ikaros with reporters containing engineered Ikaros sites in non-lymphoid cells results in gene activation (1.Georgopoulos K. Moore D. Derfler B. Science. 1992; 258: 808-812Crossref PubMed Scopus (378) Google Scholar, 5.Molnár Á. Georgopoulos K. Mol. Cell. Biol. 1994; 14: 785-794Google Scholar, 7.Sun L. Liu A. Georgopoulos K. EMBO J. 1996; 15: 5358-5369Crossref PubMed Scopus (307) Google Scholar). Gene expression-profiling experiments in Ikaros-deficient hemopoietic precursors further support such a role; expression of the tyrosine kinase receptors flk-2 and c-kit in early hemopoietic progenitors is reduced in the absence of Ikaros (9.Nichogiannopoulou A. Trevisan M. Naben S. Friedrich C. Georgopoulos K. J. Exp. Med. 1999; 190: 1201-1214Crossref PubMed Scopus (184) Google Scholar). Ikaros has also been reported to activate from the enhancer of a mink cell focus-inducing virus (26.DiFronzo N.L. Leung C.T. Mammel M.K. Georgopoulos K. Taylor B.J. Pham Q.N. J. Virol. 2002; 76: 78-87Crossref PubMed Scopus (10) Google Scholar). Additionally, Ikaros functions as a suppressor of variegation for regulatory elements of the CD8 locus. 2D. Kioussis, personal communication. Ikaros' potential to function as a repressor and activator of gene expression may provide a molecular basis for its diverse effects in the hemolymphoid system. To gain further insight into this important problem in lymphocyte biology, we have undertaken a comprehensive analysis of the transcriptional properties of Ikaros. Here we report that Ikaros is indeed capable of enhancing gene expression as a potentiator of bona fide transcriptional activators and not by functioning as a classical activator. Potentiation by Ikaros requires its intact DNA binding and dimerization domains, both of which are necessary for its recruitment into a PC-HC-associated nuclear compartment in cycling cells. We show that there is an unexpected correlation between Ikaros localization to these heterochromatin-associated sites and its ability to activate gene expression. These studies also indicate that the presence of Ikaros in this nuclear compartment provide a “landing pad” for its chromatin remodeling partner Mi-2β and presumably the NuRD complex. Two models are proposed to explain these findings. 4X IkBS2tkCAT and tkCAT have been previously described (5.Molnár Á. Georgopoulos K. Mol. Cell. Biol. 1994; 14: 785-794Google Scholar). 4XIKAS1tkCAT were constructed by cloning ligated oligonucleotides containing the corresponding sites into the tkCAT reporter by standard cloning methods. 4XSp1E1BCAT, G5E1BCAT, CMV2Flag, CMV2Flag-Ik1, CMV2Flag-Ik1M, BXG1, and BXG1-Ik1 have been described previously (22.Koipally J. Renold A. Kim J. Georgopoulos K. EMBO J. 1999; 18: 3090-3100Crossref PubMed Scopus (257) Google Scholar, 23.Koipally J. Georgopoulos K. J. B. Chem. 2000; 275: 19594-19602Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). CMV2Flag-Ikaros and BXG1-Ikaros DBD and activation domain mutants described in this paper were constructed using the Stratagene mutagenesis kit. 293T and NIH-3T3 cell lines were maintained in Dulbecco's modified Eagle's medium with 10% fetal bovine serum (Hyclone). Transfections of these cell lines were carried out using the HBS-CaP04 method. For repression assays, 1 μg of the Gal4 fusion plasmid, 10 μg of the Gal4 reporter plasmid, and 0.5 μg of the pXGH5 growth hormone control plasmid were used. For activation assays, typically 1.5 μg of the reporter, 0.25 μg of Ikaros expression plasmid, and 0.5 μg of the GH plasmid were used. 24 h after transfection, cells were fed with fresh media, and 18–24 h later cells were harvested and processed for CAT assays as described (22.Koipally J. Renold A. Kim J. Georgopoulos K. EMBO J. 1999; 18: 3090-3100Crossref PubMed Scopus (257) Google Scholar). Growth hormone assays were done as recommended by the manufacturer (Nichols Institute). Transfections were typically performed in duplicate and repeated between three to six times. For interaction experiments, 293T cells were transfected with 1–2 μg of the CMV2Flag vector expressing the Ikaros protein of choice. 24 h later, cells were fed with fresh media, and 48 h later cells were harvested to prepare nuclear or whole cell extracts. For immunofluorescence studies, NIH-3T3 cells were transfected with 9 μg of expression plasmid and 1 μg of GH plasmid using ProVera TransIT-L1 transfection reagent. 36 h after transfection, cells were harvested for fixation and staining as described below. Whole-cell extracts from 293T cells transfected with the relevant plasmids were prepared as previously described (7.Sun L. Liu A. Georgopoulos K. EMBO J. 1996; 15: 5358-5369Crossref PubMed Scopus (307) Google Scholar) and precleared using protein-G-agarose beads (Roche Molecular Biochemicals). The precleared extracts were incubated with the antibody of interest or the relevant isotype control on ice for 1 h. 30 μl of protein-G beads were then added to the extract, and the extracts were rotated overnight. The beads were collected by centrifugation and washed four times with TS buffer (20 mm Tris pH 7.5, 150 mmNaCl) (7.Sun L. Liu A. Georgopoulos K. EMBO J. 1996; 15: 5358-5369Crossref PubMed Scopus (307) Google Scholar). The beads obtained after this procedure were treated with SDS sample buffer, boiled at 95 °C for 15 min, and loaded on an SDS-polyacrylamide gel along with 8–10% of the cell extract used for the immunoprecipitation. The proteins were transferred to a nitrocellulose membrane, probed with the relevant antibody, and examined by autoradiography with ECL (Amersham Biosciences). Antibodies used were: FLAG M2 (Sigma), Gal4 (Santa Cruz), HDAC2 (Zymed Laboratories Inc.), and anti-Ikaros and Mi-2, which have been previously described (21.Kim J. Sif S. Jones B. Jackson A. Koipally J. Heller B. Winandy S. Veil A. Sawyer A. Ikeda T. Kingston R. Georgopoulos K. Immunity. 1999; 10: 345-355Abstract Full Text Full Text PDF PubMed Scopus (483) Google Scholar). Nuclear extracts were prepared from 293T cells transfected with the Ikaros constructs in either CDM8-flag or CMV-2-flag expression vectors as previously described (23.Koipally J. Georgopoulos K. J. B. Chem. 2000; 275: 19594-19602Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). The relative amount of each Ikaros protein was determined by Western blotting using the Ikaros monoclonal antibody, 8H2, and roughly normalized. DNA mobility shift assays were performed as previously described (7.Sun L. Liu A. Georgopoulos K. EMBO J. 1996; 15: 5358-5369Crossref PubMed Scopus (307) Google Scholar). The IKBS1 oligonucleotide TCAGCTTTTGGGAATACCCTGTTCA, containing a high affinity Ikaros binding site, was used as well as an oligonucleotide designed for the altered site specificity Ikaros constructs f2s1 and f2s6, IKAS1, TCAGCTTTTGGGAGTACCCTGTTCA. Radiolabeled oligonucleotides were prepared by end labeling with [32P]dATP 6000 Ci/mmol (NEN Life Science Products) and then annealed to their complement. A cold competitor oligonucleotide, without an Ikaros binding site, TCAGCTTTTGAAAATACCCTGTTCA, IKm, was added to all reactions to reduce background. A mix of three Ikaros monoclonal antibodies, 4E9A4, 8H2, IK14, was used for the supershift experiments. Cells were transfected as described above, cytospun onto Superfrost Plus slides (Fisher), fixed, permeabilized in phosphate-buffered saline with 2% paraformaldehyde and 0.1% Triton X-100 for 20 min on ice, and washed repeatedly. Slides were blocked in phosphate-buffered saline with 3% bovine serum albumin and 1% normal donkey serum for 1 h at room temperature and stained with a 1:200-dilution of anti-Ikaros antibody 4E9-A4 overnight at 4 °C. Slides were washed and incubated with a 1:200-dilution of fluorescein isothiocyanate-conjugated donkey anti-mouse IgG for 45 min at room temperature. Slides were counterstained with 1 μg/ml Hoechst 33342 (Molecular Probes, Eugene, OR) and mounted with Vectashield (Vector, Burlingame, CA). Control staining was performed with an isotype-matched primary antibody; immunoreagents were obtained from Jackson ImmunoResearch (West Grove, PA). Images were obtained with an Olympus BX50 (Tokyo, Japan) fluorescent microscope with blue and UV filter modules. We have previously shown that ectopic expression of Ikaros and its family members can transactivate reporter genes (5.Molnár Á. Georgopoulos K. Mol. Cell. Biol. 1994; 14: 785-794Google Scholar, 7.Sun L. Liu A. Georgopoulos K. EMBO J. 1996; 15: 5358-5369Crossref PubMed Scopus (307) Google Scholar). However, the localization of Ikaros in nuclear structures that are in apposition to centromeric heterochromatin and silent genes, coupled with molecular data showing that it can repress transcription, has called into question its function as an activator (12.Avitahl N. Winandy S. Friedrich C. Jones B. Ge Y. Georgopoulos K. Immunity. 1999; 10: 333-343Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 20.Brown K.E. Guest S.S. Smale S.T. Hahm K. Merkenschlager M. Fisher A.G. Cell. 1997; 91: 845-854Abstract Full Text Full Text PDF PubMed Scopus (658) Google Scholar, 21.Kim J. Sif S. Jones B. Jackson A. Koipally J. Heller B. Winandy S. Veil A. Sawyer A. Ikeda T. Kingston R. Georgopoulos K. Immunity. 1999; 10: 345-355Abstract Full Text Full Text PDF PubMed Scopus (483) Google Scholar, 22.Koipally J. Renold A. Kim J. Georgopoulos K. EMBO J. 1999; 18: 3090-3100Crossref PubMed Scopus (257) Google Scholar). Transcriptional activators typically contain at least one module, termed an activation domain, which is required to enable their interaction with co-activators and the RNA polymerase II complex. Using a yeast one-hybrid assay, a single bipartite activation domain was identified in Ikaros (7.Sun L. Liu A. Georgopoulos K. EMBO J. 1996; 15: 5358-5369Crossref PubMed Scopus (307) Google Scholar). This domain is present at the very N-terminal region of the last exon of Ikaros and is comprised of a putative α helical region followed by a β sheet, both of which are required for maximal activation in Gal4-tethering assays in mammalian cells. The activation domain is highly conserved between the Ikaros family members, Aiolos and Helios, and to a lesser extent in Eos/Daedalus; heterologous fusions of this domain from all Ikaros family members are capable of similar levels of activation (data not shown). The functional importance of this domain was examined in the context of the full-length Ikaros protein. Several different mutations were generated in this region and tested for their effect on Ikaros' transactivation function on an Ikaros binding site-driven reporter (Fig. 1A, 4XIKBS2tkCAT). Testing of Ikaros and its mutant variants was performed in NIH-3T3 fibroblasts for the following reasons. First, neither Ikaros nor any of its family members are expressed in this cell line. Second, ectopic expression of Ikaros and family members in these cells recapitulates their nuclear compartmentalization (i.e. localization in heterochromatin-associated toroidal structures) observed in cycling primary lymphocytes (27.Cobb B.S. Morales-Alcelay S. Kleiger G. Brown K.E. Fisher A.G. Smale S.T. Genes Dev. 2000; 14: 2146-2160Crossref PubMed Scopus (210) Google Scholar). Third, these cells are not grossly transformed and are amenable to growth controls. The first class of activation domain mutants we tested consisted of several proline point mutations in the α helical and β sheet domains of Ikaros. None of these mutants had any effect on the ability of Ikaros to transactivate the reporter (data not shown). The helical (-Ah) and β sheet (-Ab) regions of the activation domain were then respectively deleted in the context of full-length Ik1. These deletion mutations also had no effect on transactivation by Ikaros (Fig. 1A). Finally, an Ikaros mutant with the entire activation domain deleted was tested. Surprisingly, this mutant was fully capable of activation (Fig. 1A). These findings argue that the previously identified transactivation domain is not required for the activation properties of the full-length protein. However, we cannot rule out the possibility that this domain is utilized in a cell- and context-specific manner. Nevertheless, in the context of our experiments, activation occurs through other means. Since no other domain of Ikaros was capable of supporting activation in detailed dissections by one-hybrid assays in mammalian cells, 3J. Koipally, unpublished observations. Ikaros may not contain a classical activation domain. Alternatively, other Ikaros activation domains, if they exist, may not be able to be identified by such assays. How might Ikaros turn on gene expression in the absence of a canonical activation domain? Our studies thus far were done using reporters containing the thymidine kinase promoter that contains binding sites for the transcription factors, Sp1 and CTF. Activation by Ikaros on these reporters may result from its cooperation (direct or indirect) with these factors. To examine whether Ikaros could transactivate in the absence of other transcriptional activators, we made use of reporters containing the TATA box from the adenovirus E1B gene (Fig. 1B, E1B TATA). We also introduced three high affinity Ikaros sites or, as a control, four Sp1 sites upstream of the E1B TATA box. These reporters were cotransfected with the Ikaros expression vector into NIH-3T3 cells and assayed for CAT activity. Ikaros did not activate from either the E1B-CAT or the Ikaros binding site-containing variant (Fig. 1B). Thus, Ikaros cannot activate a minimal promoter that consists of only a TATA box. On the other hand, the NFκB subunit p65, which can also bind to the Ikaros site, strongly activated the latter (data not shown). In striking contrast, Ikaros strongly transactivated the Sp1 E1B CAT reporter (Fig. 1B, roughly 18-fold), which has not been engineered to contain any Ikaros binding sites in the vicinity of the promoter. In addition, Ikaros was also capable of stimulating transcription of the Sp1 site-containing promoter of the tkCAT reporter even in the absence of any introduced Ikaros sites (data not shown). Two Ikaros family members, Aiolos and Helios, were also capable of similar increases in activity from these reporters (data not shown). The stimulatory effect Ikaros (and family members) has on the activity of basal transcription factors (i.e. Sp1) in the absence of any engineered binding sites can be explained in three ways. (a) Ikaros may activate transcription without binding DNA (indirect recruitment) as has been reported in some instances of activation by BRCA1 (28.Nadeau G. Boufaied N. Moisan A. Lemieux K. Cayanan C. Monteiro A. Gadreau L. EMBO Rep. 2000; 1: 260-265Crossref PubMed Scopus (19) Google Scholar). For example, it may interact with other DNA-bound factors such as Sp1 to regulate transcription. (b) Ikaros may be titrating co-repressors away from the promoter (squelching), hence causing activation of reporters with or without Ikaros sites. In agreement with this hypothesis, Ikaros has been shown to interact with several co-repressors and can function as a transcriptional repressor (21.Kim J. Sif S. Jones B. Jackson A. Koipally J. Heller B. Winandy S. Veil A. Sawyer A. Ikeda T. Kingston R. Georgopoulos K. Immunity. 1999; 10: 345-355Abstract Full Text Full Text PDF PubMed Scopus (483) Google Scholar, 22.Koipally J. Renold A. Kim J. Georgopoulos K. EMBO J. 1999; 18: 3090-3100Crossref PubMed Scopus (257) Google Scholar, 23.Koipally J. Georgopoulos K. J. B. Chem. 2000; 275: 19594-19602Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). (c) Ikaros may bind to the backbone of the reporters, which incidentally have several high, medium, and low affinity Ikaros-consensus binding sites, and in this manner trans-activate reporter expression from these sites. To determine whether Ikaros mediates activation through indirect recruitment, we tested Ikaros' ability to stimulate a diverse series of activators/activation domains as Gal4 fusions. These included Gal4 DBD, Gal4-CTF, Gal4-Ikaros activation domain, Gal4-Sp1 and Gal4-Sp1N (lacking its zinc fingers). The potent repressor, Gal4-Ikaros was also examined. These heterologous proteins were transfected with the reporter 5XGal4 E1B CAT into NIH-3T3 cells in the presence or absence of Ikaros or a dimerization-defective Ikaros mutant. Ikaros expression stimulated all of the activation domains tested, albeit to different levels (Fig. 1C). Even the cryptic activation domain contained in the Gal4 DBD was further enhanced by Ikaros. Only the potent repressor, Gal4-Ik1 (and vector alone) was not activated by Ikaros (Fig. 1C). Among the activators used, only Sp1 has the potential for direct interaction with Ikaros (J. Koipally), 3J. Koipally, unpublished observations. but this interaction was not required for activation as Sp1N, an Ikaros/Sp1 interaction mutant, was also stimulated by Ikaros (Fig. 1C). In contrast to wild type Ikaros, the dimerization-defective Ikaros protein was unable to potentiate reporter gene activity (data not shown). Collectively, these data indicate that Ikaros' ability to stimulate transcription does not occur via a classical mechanism; Ikaros is unable to activate by itself, but rather enhances gene expression by bona fide activators. Ikaros can potentiate the functionally diverse activation domains present in Sp1 (glutamine-rich), CTF (proline-rich), and Ikaros (acidic and hydrophobic) proteins. Since none of these domains directly interact with Ikaros, its potentiation effect is not expected to be mediated through recruitment by these proteins. Instead, the enhancement of gene expression may result from co-repressor squelching or from Ikaros binding to sites associated with the reporter. Gene activation through squelching of co-repressors would not require an intact DNA binding domain unlike activation through Ikaros sites. To distinguish between these two possibilities, we had two available choices: we could mutate the numerous Ikaros sites in the vector or we could target mu" @default.
• W1977795985 created "2016-06-24" @default.
• W1977795985 creator A5004831350 @default.
• W1977795985 creator A5027774838 @default.
• W1977795985 creator A5068587300 @default.
• W1977795985 creator A5072807419 @default.
• W1977795985 date "2002-04-01" @default.
• W1977795985 modified "2023-10-06" @default.
• W1977795985 title "Unconventional Potentiation of Gene Expression by Ikaros" @default.
• W1977795985 cites W1973949165 @default.
• W1977795985 cites W1982295124 @default.
• W1977795985 cites W1985187876 @default.
• W1977795985 cites W1989645452 @default.
• W1977795985 cites W1991783305 @default.
• W1977795985 cites W2016835853 @default.
• W1977795985 cites W2018170238 @default.
• W1977795985 cites W2018822795 @default.
• W1977795985 cites W2019338546 @default.
• W1977795985 cites W2030163569 @default.
• W1977795985 cites W2048365283 @default.
• W1977795985 cites W2052453105 @default.
• W1977795985 cites W2059333381 @default.
• W1977795985 cites W2060742355 @default.
• W1977795985 cites W2064667001 @default.
• W1977795985 cites W2070994243 @default.
• W1977795985 cites W2076464177 @default.
• W1977795985 cites W2079072511 @default.
• W1977795985 cites W2086780553 @default.
• W1977795985 cites W2091253809 @default.
• W1977795985 cites W2104991755 @default.
• W1977795985 cites W2114894459 @default.
• W1977795985 cites W2125378951 @default.
• W1977795985 cites W2145514961 @default.
• W1977795985 cites W2145696182 @default.
• W1977795985 cites W2163461790 @default.
• W1977795985 cites W2333843729 @default.
• W1977795985 cites W4246341361 @default.
• W1977795985 cites W81453212 @default.
• W1977795985 doi "https://doi.org/10.1074/jbc.m111371200" @default.
• W1977795985 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11799125" @default.
• W1977795985 hasPublicationYear "2002" @default.
• W1977795985 type Work @default.
• W1977795985 sameAs 1977795985 @default.
• W1977795985 citedByCount "76" @default.
• W1977795985 countsByYear W19777959852012 @default.
• W1977795985 countsByYear W19777959852013 @default.
• W1977795985 countsByYear W19777959852014 @default.
• W1977795985 countsByYear W19777959852015 @default.
• W1977795985 countsByYear W19777959852017 @default.
• W1977795985 countsByYear W19777959852018 @default.
• W1977795985 countsByYear W19777959852020 @default.
• W1977795985 countsByYear W19777959852021 @default.
• W1977795985 countsByYear W19777959852023 @default.
• W1977795985 crossrefType "journal-article" @default.
• W1977795985 hasAuthorship W1977795985A5004831350 @default.
• W1977795985 hasAuthorship W1977795985A5027774838 @default.
• W1977795985 hasAuthorship W1977795985A5068587300 @default.
• W1977795985 hasAuthorship W1977795985A5072807419 @default.
• W1977795985 hasBestOaLocation W19777959851 @default.
• W1977795985 hasConcept C104317684 @default.
• W1977795985 hasConcept C150194340 @default.
• W1977795985 hasConcept C170493617 @default.
• W1977795985 hasConcept C185592680 @default.
• W1977795985 hasConcept C25274449 @default.
• W1977795985 hasConcept C54355233 @default.
• W1977795985 hasConcept C86803240 @default.
• W1977795985 hasConcept C95444343 @default.
• W1977795985 hasConceptScore W1977795985C104317684 @default.
• W1977795985 hasConceptScore W1977795985C150194340 @default.
• W1977795985 hasConceptScore W1977795985C170493617 @default.
• W1977795985 hasConceptScore W1977795985C185592680 @default.
• W1977795985 hasConceptScore W1977795985C25274449 @default.
• W1977795985 hasConceptScore W1977795985C54355233 @default.
• W1977795985 hasConceptScore W1977795985C86803240 @default.
• W1977795985 hasConceptScore W1977795985C95444343 @default.
• W1977795985 hasIssue "15" @default.
• W1977795985 hasLocation W19777959851 @default.
• W1977795985 hasOpenAccess W1977795985 @default.
• W1977795985 hasPrimaryLocation W19777959851 @default.
• W1977795985 hasRelatedWork W1991523530 @default.
• W1977795985 hasRelatedWork W2002128513 @default.
• W1977795985 hasRelatedWork W2009966535 @default.
• W1977795985 hasRelatedWork W2020824267 @default.
• W1977795985 hasRelatedWork W2031436818 @default.
• W1977795985 hasRelatedWork W2057739827 @default.
• W1977795985 hasRelatedWork W2075354549 @default.
• W1977795985 hasRelatedWork W2088063203 @default.
• W1977795985 hasRelatedWork W2171277769 @default.
• W1977795985 hasRelatedWork W2092874662 @default.
• W1977795985 hasVolume "277" @default.
• W1977795985 isParatext "false" @default.
• W1977795985 isRetracted "false" @default.
• W1977795985 magId "1977795985" @default.
• W1977795985 workType "article" @default.