FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1978045625> ?p ?o ?g. }

• W1978045625 endingPage "8001" @default.
• W1978045625 startingPage "7992" @default.
• W1978045625 abstract "Daptomycin is a cyclic lipopeptide antibiotic produced by Streptomyces roseosporus. To reveal the transcriptional regulatory mechanism of daptomycin biosynthesis, we used the biotinylated dptE promoter (dptEp) as a probe to affinity isolate the dptEp-interactive protein AtrA, a TetR family transcriptional regulator, from the proteome of mycelia. AtrA bound directly to dptEp to positively regulate gene cluster expression and daptomycin production. Meanwhile, both ΔatrA and ΔadpA mutants showed bald phenotype and null production of daptomycin. AdpA positively regulated atrA expression by direct interaction with atrA promoter (atrAp), and removal of ArpA in S. roseosporus, a homolog of the A-factor receptor, resulted in accelerated morphological development and increased daptomycin production, suggesting that atrA was the target of AdpA to mediate the A-factor signaling pathway. Furthermore, AtrA was positively autoregulated by binding to its own promoter atrAp. Thus, for the first time at the transcriptional level, we have identified an autoregulator, AtrA, that directly mediates the A-factor signaling pathway to regulate the proper production of daptomycin. Daptomycin is a cyclic lipopeptide antibiotic produced by Streptomyces roseosporus. To reveal the transcriptional regulatory mechanism of daptomycin biosynthesis, we used the biotinylated dptE promoter (dptEp) as a probe to affinity isolate the dptEp-interactive protein AtrA, a TetR family transcriptional regulator, from the proteome of mycelia. AtrA bound directly to dptEp to positively regulate gene cluster expression and daptomycin production. Meanwhile, both ΔatrA and ΔadpA mutants showed bald phenotype and null production of daptomycin. AdpA positively regulated atrA expression by direct interaction with atrA promoter (atrAp), and removal of ArpA in S. roseosporus, a homolog of the A-factor receptor, resulted in accelerated morphological development and increased daptomycin production, suggesting that atrA was the target of AdpA to mediate the A-factor signaling pathway. Furthermore, AtrA was positively autoregulated by binding to its own promoter atrAp. Thus, for the first time at the transcriptional level, we have identified an autoregulator, AtrA, that directly mediates the A-factor signaling pathway to regulate the proper production of daptomycin. Daptomycin is a cyclic lipopeptide antibiotic against infection caused by a broad spectrum of Gram-positive bacterial pathogens such as Staphylococcus aureus and Enterococcus species (1.Arbeit R.D. Maki D. Tally F.P. Campanaro E. Eisenstein B.I. The safety and efficacy of daptomycin for the treatment of complicated skin and skin-structure infections.Clin. Infect. Dis. 2004; 38: 1673-1681Crossref PubMed Scopus (642) Google Scholar, 2.Sader H.S. Flamm R.K. Farrell D.J. Jones R.N. Daptomycin activity against uncommonly isolated streptococcal and other Gram-positive species groups.Antimicrob. Agents Chemother. 2013; 57: 6378-6380Crossref PubMed Scopus (12) Google Scholar). It has been reported that daptomycin is synthesized by a non-ribosomal peptide synthetase in Streptomyces roseosporus NRRL 11379 (3.Miao V. Coëffet-Legal M.F. Brian P. Brost R. Penn J. Whiting A. Martin S. Ford R. Parr I. Bouchard M. Silva C.J. Wrigley S.K. Baltz R.H. Daptomycin biosynthesis in Streptomyces roseosporus: cloning and analysis of the gene cluster and revision of peptide stereochemistry.Microbiology. 2005; 151: 1507-1523Crossref PubMed Scopus (278) Google Scholar). Because of its clinical importance, many efforts have been made to improve daptomycin production, including random mutagenesis (4.Yu G. Jia X. Wen J. Lu W. Wang G. Caiyin Q. Chen Y. Strain improvement of Streptomyces roseosporus for daptomycin production by rational screening of He-Ne laser and NTG-induced mutants and kinetic modeling.Appl Biochem. Biotechnol. 2011; 163: 729-743Crossref PubMed Scopus (37) Google Scholar), metabolic engineering (5.Huang D. Wen J. Wang G. Yu G. Jia X. Chen Y. In silico aided metabolic engineering of Streptomyces roseosporus for daptomycin yield improvement.Appl. Microbiol. Biotechnol. 2012; 94: 637-649Crossref PubMed Scopus (39) Google Scholar, 6.Huang D. Jia X. Wen J. Wang G. Yu G. Caiyin Q. Chen Y. Metabolic flux analysis and principal nodes identification for daptomycin production improvement by Streptomyces roseosporus.Appl. Biochem. Biotechnol. 2011; 165: 1725-1739Crossref PubMed Scopus (19) Google Scholar), and ribosomal engineering by mutations based on resistance to antibiotics (7.Li L. Ma T. Liu Q. Huang Y. Hu C. Liao G. Improvement of daptomycin production in Streptomyces roseosporus through the acquisition of pleuromutilin resistance.Biomed. Res. Int. 2013. 2013: 479742Google Scholar, 8.Wang L. Zhao Y. Liu Q. Huang Y. Hu C. Liao G. Improvement of A21978C production in Streptomyces roseosporus by reporter-guided rpsL mutation selection.J. Appl. Microbiol. 2012; 112: 1095-1101Crossref PubMed Scopus (27) Google Scholar). Nevertheless, no direct evidence has been reported on the transcriptional regulation of the daptomycin gene cluster expression, which might hinder targeted genetic engineering based on the rational designing of the transcriptional circuit to improve daptomycin production. Secondary metabolism development including antibiotic production in Streptomyces is transcriptionally regulated by extracellular stimuli, intracellular signaling pathways, and their cross-talks (9.Liu G. Chater K.F. Chandra G. Niu G. Tan H. Molecular regulation of antibiotic biosynthesis in Streptomyces.Microbiol. Mol. Biol. Rev. 2013; 77: 112-143Crossref PubMed Scopus (490) Google Scholar). AdpA is one of the key pleiotropic transcriptional regulators in Streptomyces griseus, and is widely found in Streptomyces to control morphological development and secondary metabolism (10.Pan Y. Liu G. Yang H. Tian Y. Tan H. The pleiotropic regulator AdpA-L directly controls the pathway-specific activator of nikkomycin biosynthesis in Streptomyces ansochromogenes.Mol. Microbiol. 2009; 72: 710-723Crossref PubMed Scopus (59) Google Scholar11.Ohnishi Y. Yamazaki H. Kato J.Y. Tomono A. Horinouchi S. AdpA, a central transcriptional regulator in the A-factor regulatory cascade that leads to morphological development and secondary metabolism in Streptomyces griseus.Biosci. Biotechnol. Biochem. 2005; 69: 431-439Crossref PubMed Scopus (192) Google Scholar, 12.Wolanski M. Donczew R. Kois-Ostrowska A. Masiewicz P. Jakimowicz D. Zakrzewska-Czerwinska J. The level of AdpA directly affects expression of developmental genes in Streptomyces coelicolor.J. Bacteriol. 2011; 193: 6358-6365Crossref PubMed Scopus (37) Google Scholar13.Lee H.N. Kim J.S. Kim P. Lee H.S. Kim E.S. Repression of antibiotic downregulator WblA by AdpA in Streptomyces coelicolor.Appl. Environ. Microbiol. 2013; 79: 4159-4163Crossref PubMed Scopus (17) Google Scholar). adpA is under the transcriptional control of a repressor (such as ArpA in S. griseus), which dissociates from the adpA promoter after binding to the growth phase-dependent γ-butyrolactone molecules, thus causing derepression of adpA expression (11.Ohnishi Y. Yamazaki H. Kato J.Y. Tomono A. Horinouchi S. AdpA, a central transcriptional regulator in the A-factor regulatory cascade that leads to morphological development and secondary metabolism in Streptomyces griseus.Biosci. Biotechnol. Biochem. 2005; 69: 431-439Crossref PubMed Scopus (192) Google Scholar, 14.Yang Y.H. Song E. Kim J.N. Lee B.R. Kim E.J. Park S.H. Kim W.S. Park H.Y. Jeon J.M. Rajesh T. Kim Y.G. Kim B.G. Characterization of a new ScbR-like γ-butyrolactone binding regulator (SlbR) in Streptomyces coelicolor.Appl. Microbiol. Biotechnol. 2012; 96: 113-121Crossref PubMed Scopus (17) Google Scholar). Once activated, AdpA binds to the highly conserved binding elements (5′-TGGCSNGWWY-3′) on the promoters of its regulons, which are involved in various cell developmental programs (11.Ohnishi Y. Yamazaki H. Kato J.Y. Tomono A. Horinouchi S. AdpA, a central transcriptional regulator in the A-factor regulatory cascade that leads to morphological development and secondary metabolism in Streptomyces griseus.Biosci. Biotechnol. Biochem. 2005; 69: 431-439Crossref PubMed Scopus (192) Google Scholar, 15.Higo A. Hara H. Horinouchi S. Ohnishi Y. Genome-wide distribution of AdpA, a global regulator for secondary metabolism and morphological differentiation in Streptomyces, revealed the extent and complexity of the AdpA regulatory network.DNA Res. 2012; 19: 259-273Crossref PubMed Scopus (78) Google Scholar, 16.Yamazaki H. Tomono A. Ohnishi Y. Horinouchi S. DNA-binding specificity of AdpA, a transcriptional activator in the A-factor regulatory cascade in Streptomyces griseus.Mol. Microbiol. 2004; 53: 555-572Crossref PubMed Scopus (81) Google Scholar). In the daptomycin industrial producer S. roseosporus SW0702, we have characterized the DeoR-type regulator DptR2 as required for daptomycin production but not for gene cluster expression (17.Wang F. Ren N.N. Luo S. Chen X.X. Mao X.M. Li Y.Q. DptR2, a DeoR-type auto-regulator, is required for daptomycin production in Streptomyces roseosporus.Gene. 2014; 544: 208-215Crossref PubMed Scopus (22) Google Scholar). To further reveal the transcriptional regulatory mechanism of daptomycin production, we applied affinity purification with biotinylated dptEp as a probe to isolate a TetR-type transcriptional regulator, AtrA. In Streptomyces coelicolor, AtrA binds to the coding regions of actII-orf4 and actII-orf3 to positively regulate actinorhodin production, but it is not required for undecylprodigiosin or calcium-dependent antibiotic production or for morphological development (18.Uguru G.C. Stephens K.E. Stead J.A. Towle J.E. Baumberg S. McDowall K.J. Transcriptional activation of the pathway-specific regulator of the actinorhodin biosynthetic genes in Streptomyces coelicolor.Mol. Microbiol. 2005; 58: 131-150Crossref PubMed Scopus (123) Google Scholar). In S. griseus, AtrA binds to the strR promoter synergistically along with AdpA to conditionally regulate streptomycin production (19.Hirano S. Tanaka K. Ohnishi Y. Horinouchi S. Conditionally positive effect of the TetR-family transcriptional regulator AtrA on streptomycin production by Streptomyces griseus.Microbiology. 2008; 154: 905-914Crossref PubMed Scopus (37) Google Scholar). However, AveI, the homolog of AtrA in Streptomyces avermitilis, negatively regulates avermectin biosynthesis and does not bind to the aveR promoter (20.Chen L. Lu Y. Chen J. Zhang W. Shu D. Qin Z. Yang S. Jiang W. Characterization of a negative regulator AveI for avermectin biosynthesis in Streptomyces avermitilis NRRL8165.Appl. Microbiol. Biotechnol. 2008; 80: 277-286Crossref PubMed Scopus (35) Google Scholar). Here we have provided evidence that AtrA could positively regulate daptomycin production by directly binding to the gene cluster promoter; atrA was one of AdpA transcriptional targets to mediate the conserved A-factor signaling pathway. We also have suggested the positive feedback regulation of atrA expression for the proper production of daptomycin. This is the first report to provide direct evidence at the transcriptional regulatory level for daptomycin production and also suggests that an AtrA-mediated A-factor signaling pathway is required for daptomycin production. S. roseosporus SW0702 is an industrial daptomycin producer (17.Wang F. Ren N.N. Luo S. Chen X.X. Mao X.M. Li Y.Q. DptR2, a DeoR-type auto-regulator, is required for daptomycin production in Streptomyces roseosporus.Gene. 2014; 544: 208-215Crossref PubMed Scopus (22) Google Scholar). ΔatrA, ΔadpA, and ΔarpA mutants are the in-frame deletion strains of S. roseosporus SW0702. Escherichia coli strain TG1 was the host for routine plasmid subcloning. BL21(DE3) was used for protein expression and ET12456/pUZ8002 for conjugation of plasmids into Streptomyces. E. coli cells were cultured in LB medium for plasmid preparation and protein expression. Solid R5 medium was used for morphological development and sporulation of Streptomyces cells, and MSF medium was used for conjugation (21.Kieser T. Bibb M.J. Butter M.J. Chater K.F. Hopwood D.A. Practical Streptomyces Genetics. John Innes Foundation, Norwich, United Kingdom2000: 125-160Google Scholar). For daptomycin production, tryptic soy broth plus 5% PEG 6000 was the seed medium, and YEME (0.3% yeast extract, 0.3% malt extract, 0.5% tryptone, 4% glucose) medium was used for fermentation (17.Wang F. Ren N.N. Luo S. Chen X.X. Mao X.M. Li Y.Q. DptR2, a DeoR-type auto-regulator, is required for daptomycin production in Streptomyces roseosporus.Gene. 2014; 544: 208-215Crossref PubMed Scopus (22) Google Scholar). Plasmids and primers were listed in TABLE 1, TABLE 2, respectively. Primer pairs 1 + 2 and 3 + 4 were used to amplify the right and left homologous regions of atrA, respectively, and cloned into the HindIII/BamHI and BamHI/EcoRI sites of pKC1139 (22.Bierman M. Logan R. O'Brien K. Seno E.T. Rao R.N. Schoner B.E. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.Gene. 1992; 116: 43-49Crossref PubMed Scopus (1209) Google Scholar), respectively, to give rise to pKC1139-atrA. Plasmids pKC1139-adpA and pKC1139-arpA were constructed by cloning homologous fragments into the HindIII/BamHI and BamHI/EcoRI sites of pKC1139. Primers 5 + 6 and 7 + 8 were for adpA, and primers 9 + 10 and 11 + 12 were for arpA. The complementation DNA fragments for atrA, adpA, and arpA were amplified with primer pairs 13 + 14, 15 + 16, and 17 + 18, respectively, and cloned into the HindIII/BamHI site of pSET152 (22.Bierman M. Logan R. O'Brien K. Seno E.T. Rao R.N. Schoner B.E. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.Gene. 1992; 116: 43-49Crossref PubMed Scopus (1209) Google Scholar) to create the complementation plasmids pSET152-atrA, pSET152-adpA, and pSET152-arpA, respectively. dptEp and atrAp were obtained with primers 19 + 20 and 21 + 22, respectively, and cloned into pTA2 after deoxyadenylic acid (dA) addition with Taq polymerase. Both promoters were digested with BamHI and ligated into the BamHI site of pIPP1 (23.Jones G.H. Integrative, xylE-based promoter probe vectors for use in Streptomyces.Plasmid. 2011; 65: 219-225Crossref PubMed Scopus (4) Google Scholar) to get pIPP1-dptEp and pIPP1-atrAp, respectively. BamHI-digested dptEp was ligated into the BamHI site of pUC18 to generate pUC18-dptEp. atrA and adpA were amplified with primer pairs 24 + 25 and 26 + 27 and cloned into the BamHI/HindIII site of pET32a to obtain the expression plasmids pET32a-atrA and pET32a-adpA, respectively. All PCR were performed with KOD-Plus-Neo (Toyobo Co.) from the genomic DNA of S. roseosporus SW0702.TABLE 1Plasmids used in this studyPlasmidDescriptionReferencespKC1139Temperature-sensitive vector for gene knock-out(22.Bierman M. Logan R. O'Brien K. Seno E.T. Rao R.N. Schoner B.E. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.Gene. 1992; 116: 43-49Crossref PubMed Scopus (1209) Google Scholar)pKC1139-atrAatrA in-frame deletion plasmidThis studypKC1139-adpAadpA in-frame deletion plasmidThis studypKC1139-arpAarpA in-frame deletion plasmidThis studypSET152Integrative plasmid for complementation in Streptomyces(22.Bierman M. Logan R. O'Brien K. Seno E.T. Rao R.N. Schoner B.E. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.Gene. 1992; 116: 43-49Crossref PubMed Scopus (1209) Google Scholar)pSET152-atrAatrA gene complementation plasmidThis studypSET152-adpAadpA gene complementation plasmidThis studypSET152-arpAarpA gene complementation plasmidThis studypTA2T vectorToyobo Co.pTA2-dptEpdptE promoter (dptEp) cloned in pTA2 vectorThis studypTA2-atrApatrA promoter (atrAp) cloned in pTA2 vectorThis studypUC18Cloning vectorNovagenpUC18-dptEpdptEp cloned in BamHI site of pUC18 vectorThis studypET32aE. coli expression vectorNovagenpET32a-atrAatrA ORF cloned in BamHI/HindIII site of pET32aThis studypET32a-adpAadpA ORF cloned in BamHI/HindIII site of pET32aThis studypIPP1Promoter probing vector with xylE reporter(23.Jones G.H. Integrative, xylE-based promoter probe vectors for use in Streptomyces.Plasmid. 2011; 65: 219-225Crossref PubMed Scopus (4) Google Scholar)pIPP1-dptEpdptEp cloned in BamHI site of pIPP1This studypIPP1-atrApatrAp cloned in BamHI site of pIPP1This study Open table in a new tab TABLE 2Primers used in this studyNo.Sequence1TGTTGGATCCCTGGAGGGACTGCGGTC2CTAAGAATTCGAGATACGCCTGCTTGAG3TATCAAGCTTGACGAAGACGAAGGTGAG4TACTAGATCTCGAGCTCATGACGCCCAG5TACTAAGCTTCTGTTCGCGTACCACAC6TACTGGATCCGGCGGAGTCCTGGCTC7TACTGGATCCCAGCGGAGTGCCCCGTAG8TACTGAATTCCGTCATGGAACACCAGC9ACTTCAAGCTTGATGCCGTTGGTGGACCC10ACTTAGGATCCAGCCTGCTTCGCCATTTC11ACTTAGGATCCGCTGCCTGATCCTCGACC12ACTTAGAATTCCTCCTCGGCACGCTGTTC13ACTTAGGATCCACGACGAGAACGCGCAC14TACTAAGCTTGCAGCAGGAAGAGCCGCT15ACTTAGGATCCTGTCTCGGCGAAGAGAGTC16TACTAAGCTTCTACGGGGCACTCCGCTG17TACTAGATCTGAAACAACGGATGTGAATC18TACTAAGCTTGAGGTGGACTTCATCGTTC19GGATCCCCTCCCCACCACCTGC20GGATCCGGCAGGCACTCCCCCTCC21GGATCCGGAGCCGAGGCGTCCTG22GGATCCCCGCCGACGACGAGAAC23FAM-GCCAGGGTTTTCCCAGTCACGA24TACTGGATCCGTGGGTGCGCTGGGCGTC25TACTAAGCTTCGCCGGCCGTGACCGCAG26AATAGGATCCATGAGCCAGGACTCCGCC27TACTAAGCTTCTACGGGGCACTCCGCTG28Biotin-GCCAGGGTTTTCCCAGTCACGA29GAGCGGATAACAATTTCACACAGG Open table in a new tab atrA, adpA, and arpA were knocked out by in-frame deletion in S. roseosporus SW0702 (17.Wang F. Ren N.N. Luo S. Chen X.X. Mao X.M. Li Y.Q. DptR2, a DeoR-type auto-regulator, is required for daptomycin production in Streptomyces roseosporus.Gene. 2014; 544: 208-215Crossref PubMed Scopus (22) Google Scholar). pKC1139-based knock-out plasmids were introduced into S. roseosporus SW0702 by conjugation. The conjugates were streaked on the solid R5 medium with apramycin at 37 °C to get the single crossover strains. They were patched on the R5 medium at 37 °C for two rounds of sporulation. Spores were then diluted on the R5 medium into single colonies. The mutants were identified from the apramycin-sensitive clones by PCR and Southern blot (data not shown). The biotinylated vector and vector-dptEp were prepared by PCR from pUC18 and pUC18-dptEp, respectively, with universal primers 28 + 29 and gel-purified. About 500 ng of biotinylated DNA was incubated with streptavidin-agarose (Prozyme) and washed twice with the binding buffer (20 mm Tris, pH 8.0, 50 mm NaCl, 1 mm EDTA, and 10% glycerol) to eliminate the unbound probes and save the pellet. S. roseosporus SW0702 cells were cultured in tryptic soy broth medium to the logarithmic phase, collected, sonicated in the binding buffer, and centrifuged at 4 °C for 15 min to collect the total lysate. The proteome was incubated initially with vector-streptavidin-agarose at room temperature for 30 min in the presence of 500 μg of sheared sperm DNA to prevent the nonspecific binding of proteins. The mixture was centrifuged briefly, and the supernatant was incubated with dptEp-streptavidin-agarose. After binding at room temperature for 60 min, the beads were spun down and washed with the binding buffer three times, and the binding proteins were eluted with high ionic buffer (binding buffer plus 1 m NaCl). The eluted protein was buffer-exchanged with 100 mm NH4HCO3, pH 8.0 on a 10-kDa cut-off YM-10 column (Millipore). Then it was incubated with 10 mm DTT at 56 °C for 30 min and cooled down to room temperature followed by incubation with 20 mm iodoacetamide in the dark for 30 min. The protein mixture was digested with 100 ng of trypsin at 37 °C overnight, vacuum-dried, and subjected to LC/MS/MS to identify the peptide sequences. BL21(DE3) containing expression plasmids for AtrA and AdpA, respectively, was cultured in LB medium at 37 °C to OD = 0.5 and induced with 0.1 mm IPTG at 16 °C for 16 h. Cells were collected and disrupted in buffer A (50 mm Tris, pH 8.0, 500 mm NaCl, and 10 mm imidazole) by sonication. Proteins expressed in soluble form were purified on Ni2+-nitrilotriacetic acid resin as described by the manufacturer (Qiagen) and eluted in buffer A plus 500 mm imidazole. Proteins were ultra-filtered on a 10-kDa cut-off YM-3 column (Millipore) with 20 mm Tris buffer, pH 7.5. 5′-Biotin-labeled DNA probes including vector, vector-dptEp, and vector-atrAp were prepared by high fidelity PCR from plasmids pTA2, pTA2-dptEp, and pTA2-atrAp, respectively, with universal primers 28 + 29. These probes were gel-purified and eluted in sterile water. EMSA was demonstrated as described previously with 1 ng of probes and an increasing amount of protein (24.Mao X.M. Sun Z.H. Liang B.R. Wang Z.B. Feng W.H. Huang F.L. Li Y.Q. Positive feedback regulation of stgR expression for secondary metabolism in Streptomyces coelicolor.J. Bacteriol. 2013; 195: 2072-2078Crossref PubMed Scopus (20) Google Scholar). The DNase I footprinting assays were demonstrated as described previously (24.Mao X.M. Sun Z.H. Liang B.R. Wang Z.B. Feng W.H. Huang F.L. Li Y.Q. Positive feedback regulation of stgR expression for secondary metabolism in Streptomyces coelicolor.J. Bacteriol. 2013; 195: 2072-2078Crossref PubMed Scopus (20) Google Scholar). 5′-FAM-labeled dptEp and atrAp were prepared by PCR from plasmids pTA2-dptEp and pTA2-atrAp, respectively, with universal primers 29 + 23 and then gel-purified. About 50 ng of probes were incubated with various amounts of protein, and 0.01 unit of DNase I was added for partial digestion. Daptomycin was produced in S. roseosporus as described previously (17.Wang F. Ren N.N. Luo S. Chen X.X. Mao X.M. Li Y.Q. DptR2, a DeoR-type auto-regulator, is required for daptomycin production in Streptomyces roseosporus.Gene. 2014; 544: 208-215Crossref PubMed Scopus (22) Google Scholar). After fermentation, the culture was mixed with an equal volume of methanol and centrifuged. The supernatant was analyzed by HPLC on a reverse phase column (Phenomenex, 250 × 4.6 mm, C18) with UV detection at 366 nm at a flow rate of 0.1 ml/min. The solutions used were solution A (50 mm Na2HPO4, pH 3.15 ± 0.05) and solution B (100% acetonitrile). HPLC was run using the following procedure: 0–10 min, A:B = 20:50%; 10–40 min, A:B = 50:80%; 40–50 min, A:B = 80:95%. Pure daptomycin was used as a standard. The catechol 2,3-dioxygenase activity assays were demonstrated as described previously with minor modifications (25.Ingram C. Brawner M. Youngman P. Westpheling J. xylE functions as an efficient reporter gene in Streptomyces spp: use for the study of galP1, a catabolite-controlled promoter.J. Bacteriol. 1989; 171: 6617-6624Crossref PubMed Google Scholar). Streptomyces cells were harvested, washed with 20 mm potassium phosphate, pH 7.2, and resuspended in 1 ml of sample buffer (100 mm potassium phosphate, pH 7.5, 10% acetone). Cells were lysed by sonication, and cell debris was removed by centrifugation for 15 min at 4 °C. The assay buffer (100 mm potassium phosphate, pH 7.5, 1 mm catechol) was preincubated at 37 °C for 1 min, and the reactions were initiated by the addition of 100 μl of cell extract to 900 μl of assay buffer. The optical density at 375 nm was measured over time (0, 1, 2, and 3 min, respectively). Catechol dioxygenase activity was calculated as the change rate in the optical density at 375 nm and converted to milliunits/min/mg of total protein. Two pathway-specific regulators, DptR1 and DptR2, were found when the daptomycin gene cluster was initially sequenced in S. roseosporus NRRL 11379 (3.Miao V. Coëffet-Legal M.F. Brian P. Brost R. Penn J. Whiting A. Martin S. Ford R. Parr I. Bouchard M. Silva C.J. Wrigley S.K. Baltz R.H. Daptomycin biosynthesis in Streptomyces roseosporus: cloning and analysis of the gene cluster and revision of peptide stereochemistry.Microbiology. 2005; 151: 1507-1523Crossref PubMed Scopus (278) Google Scholar). We have reported that the industrial daptomycin producer S. roseosporus SW0702 contains the daptomycin gene cluster in high identity with that from S. roseosporus NRRL 11379 (17.Wang F. Ren N.N. Luo S. Chen X.X. Mao X.M. Li Y.Q. DptR2, a DeoR-type auto-regulator, is required for daptomycin production in Streptomyces roseosporus.Gene. 2014; 544: 208-215Crossref PubMed Scopus (22) Google Scholar) (Fig. 1A). The whole gene cluster was reported to be transcribed as a large mRNA from the promoter of dptE (dptEp) (3.Miao V. Coëffet-Legal M.F. Brian P. Brost R. Penn J. Whiting A. Martin S. Ford R. Parr I. Bouchard M. Silva C.J. Wrigley S.K. Baltz R.H. Daptomycin biosynthesis in Streptomyces roseosporus: cloning and analysis of the gene cluster and revision of peptide stereochemistry.Microbiology. 2005; 151: 1507-1523Crossref PubMed Scopus (278) Google Scholar). To further reveal its transcriptional regulatory mechanism, we used the biotinylated dptEp DNA fragment as a probe to isolate regulators that might interact with dptEp directly from the total lysate of mycelia (Fig. 1B). In total, 82 proteins were identified by LC/MS/MS, including the transcription machinery (RNA polymerase and accessary proteins), several transcriptional regulators with DNA-binding domains, and other proteins that might interact with these DNA-binding proteins (data not shown). Among these identified regulators, AtrA is a TetR-type transcriptional regulator with a DNA-binding domain at its N terminus, and protein alignment showed that it had 86, 70, and 67% identity with its homologs from S. griseus, S. avermitilis, and S. coelicolor, respectively, with 100% identity in the DNA-binding domains (data not shown). AtrA was expressed and purified from E. coli. EMSA showed that AtrA specifically bound to dptEp (Fig. 2A), which confirmed our screening strategy. Four AtrA-binding sites on dptEp were determined by DNase I footprinting assays (Fig. 2B). The site closest to the start codon (ATG) of dptE (Fig. 2B, site a) had the same binding pattern, despite the concentration of AtrA, suggesting that a small amount of AtrA could fully occupy this site. On other sites, however, the protection patterns became more significant with the increased amount of AtrA. Farther away from dptE ATG, more AtrA was needed to completely protect these sites (Fig. 2B, site b to d), suggesting gradient binding affinity with AtrA along with dptEp. Moreover, deletion of all four sites on dptEp could abrogate binding of AtrA on dptEp, but removal of each of the binding sites could not apparently alter the binding affinity of AtrA to dptEp (data not shown), further supporting multiple interactive sites on dptEp for AtrA. After alignment with the DNA sequencing data (Fig. 2, C–E), the binding sequence of these sites was determined (Fig. 2F). However, the four AtrA-binding sites had no consensus or apparent palindrome sequence, which is often recognized by TetR-type regulators (26.Ramos J.L. Martínez-Bueno M. Molina-Henares A.J. Terán W. Watanabe K. Zhang X. Gallegos M.T. Brennan R. Tobes R. The TetR family of transcriptional repressors.Microbiol. Mol. Biol. Rev. 2005; 69: 326-356Crossref PubMed Scopus (809) Google Scholar). S. coelicolor AtrA has been shown to bind to the coding region of actII-orf4, and these sites do not show significant conserved sequences but have imperfect inverted repeats of the hexanucleotide GGAAT(G/C) sequence (18.Uguru G.C. Stephens K.E. Stead J.A. Towle J.E. Baumberg S. McDowall K.J. Transcriptional activation of the pathway-specific regulator of the actinorhodin biosynthetic genes in Streptomyces coelicolor.Mol. Microbiol. 2005; 58: 131-150Crossref PubMed Scopus (123) Google Scholar). Also an imperfect inverted repeat (GGAGGGNNNCGTTCC) was identified in S. griseus, and mutation of this repeat abolishes S. griseus AtrA binding to strRp (19.Hirano S. Tanaka K. Ohnishi Y. Horinouchi S. Conditionally positive effect of the TetR-family transcriptional regulator AtrA on streptomycin production by Streptomyces griseus.Microbiology. 2008; 154: 905-914Crossref PubMed Scopus (37) Google Scholar). Consistent with the 100% identity of the AtrA DNA-binding domain from three Streptomyces species, we found two GGAG motifs on site a, a GGAC motif on site b, and a GGAA motif on sites c and d, respectively. However, no apparent inverted repeat was observed on any of the sites. Nevertheless, our results suggested that AtrA is a transcriptional regulator that binds directly to the promoter of the daptomycin gene cluster. The xylE reporter assays were used to investigate the effects of AtrA on dptEp activity. atrA was knocked out by in-frame deletion. S. roseosporus had the highest daptomycin productivity, between 3 and 4 days, and subsequently decreased (17.Wang F. Ren N.N. Luo S. Chen X.X. Mao X.M. Li Y.Q. DptR2, a DeoR-type auto-regulator, is required for daptomycin production in Streptomyces roseosporus.Gene. 2014; 544: 208-215Crossref PubMed Scopus (22) Google Scholar). However, the highest dptEp activity was observed at day 2 and then dropped continuously during daptomycin production. But the ΔatrA mutant showed null dioxygenase activities on all the days examined (Fig. 3A). Consistent with these results, HPLC assays showed that the ΔatrA mutant did not produce daptomycin, whereas reintroduction of atrA rescued daptomycin production (Fig. 3B). These results suggested that AtrA can bind directly to the daptomycin gene cluster promoter to positively regulate daptomycin production. The ΔatrA mutant in S. coelicolor does not show a significant difference in morphological development from the wild type (18.Uguru G.C. Stephens K.E. Stead J.A. Towle J.E. Baumberg S. McDowall K.J. Transcriptional activation of the pathway-specific regulator of the actinorhodin biosynthetic genes in Streptomyces coelicolor.Mol. Microbiol. 2005; 58: 131-150Crossref PubMed Scopus (123) Google Scholar). However, the phenotype of the ΔatrA mutant in S. roseosporus was quite different from the wild type in that this mutant grew only in substrate mycelia on the R5 medium, whereas the wild type and the complementation strain underwent morphological development with aerial mycelia (Fig. 4A) and spores (data not shown). This phenotype was reminiscent of the ΔadpA mutant, which also shows the bald phenotype from many Streptomyces species, including S. coelicolor, S. griseus, etc. (11.Ohnishi Y. Yamazaki H. Kato J.Y. Tomono A. Horinouchi S. AdpA, a central transcriptional regulator in the A-factor regulatory cascade that leads to morphological development and secondary metabolism in Streptomyces griseus.Biosci. Biotechnol. Biochem. 2005; 69: 431-439Crossref PubMed Scopus (192) Google Scholar, 12.Wolanski M. Donczew R. Kois-Ostrowska A. Masiewicz P. Jakimowicz D. Zakrzewska-Czerwinska J. The level of AdpA directly affects expression of developmental genes in Streptomyces coelicolor.J. Bacteriol. 2011; 193: 6358-6365Crossref PubMed Scopus (37) Google Scholar). S. roseosporus AdpA was identified based on a protein BLAST with S. griseus AdpA as a query against the S. roseosporus SW0702 genome sequence. It displayed 97 and 84% identity with its homologs in S. griseus and S. coelicolor, respectively, and the DNA-binding domain also showed 100% identity (data not shown), suggesting that conserved functions of AdpA in S. roseosporus. adpA was disrupted by in-frame deletion. The ΔadpA mutant constantly grew in substrate mycelia, as expected (Fig. 4B), and did not produce daptomycin (Fig. 4C). Moreover, after 3 days on the R5 medium, red pigment production was observed in wild type and complementation strains but not in the ΔatrA or ΔadpA mutant (data not shown). These results suggested that both AtrA and AdpA are positive regulators of secondary metabolism (especially daptomycin production) and morphological development. AdpA is a pleiotropic regulator that binds to the promoters of a variety of regulons with a consensus motif TGGCSNGWWY (S, G, or C; W, A, or T; Y, T, or C; N, any nucleotide) (15.Higo A. Hara H. Horinouchi S. Ohnishi Y. Genome-wide distribution of AdpA, a global regulator for secondary metabolism and morphological differentiation in Streptomyces, revealed the extent and complexity of the AdpA regulatory network.DNA Res. 2012; 19: 259-273Crossref PubMed Scopus (78) Google Scholar). Three potential binding motifs were identified on the atrA promoter (atrAp) of S. roseosporus (Fig. 5A), although one or two mismatches were still found (Fig. 5B). However, these motifs, even with two or three mismatches, can still be recognized by AdpA, as exemplified by the wblA promoter in S. coelicolor (13.Lee H.N. Kim J.S. Kim P. Lee H.S. Kim E.S. Repression of antibiotic downregulator WblA by AdpA in Streptomyces coelicolor.Appl. Environ. Microbiol. 2013; 79: 4159-4163Crossref PubMed Scopus (17) Google Scholar), suggesting that atrA might also be one of the AdpA targets in S. roseosporus. AdpA was expressed and purified from E. coli. Consistent with the in silico prediction, EMSA showed that AdpA could specifically bind to atrAp, and three shifted bands were observed (Fig. 5C). Moreover, xylE reporter assays indicated that atrAp activities decreased during daptomycin production in wild type (Fig. 5D), which was coincident with dptEp activities. Deletion of adpA caused a 2–4-fold decrease in atrAp activities (Fig. 5D). These results suggest that AdpA is required for daptomycin production and morphological development by directly regulating atrA expression. The two positive regulators AtrA and AdpA in S. roseosporus showed the highest homology to their counterparts in S. griseus (data not shown), where A-factor-triggered morphological development and secondary metabolism have been extensively studied. The A-factor binds to its receptor protein, ArpA, and releases it from the adpA promoter (adpAp), thus derepressing adpA expression to switch on the developmental programs (11.Ohnishi Y. Yamazaki H. Kato J.Y. Tomono A. Horinouchi S. AdpA, a central transcriptional regulator in the A-factor regulatory cascade that leads to morphological development and secondary metabolism in Streptomyces griseus.Biosci. Biotechnol. Biochem. 2005; 69: 431-439Crossref PubMed Scopus (192) Google Scholar). S. roseosporus ArpA was also identified from the genome sequence by a protein BLAST with S. griseus ArpA. It showed 95% identity with its counterpart in S. griseus and 100% identity in the DNA-binding domain (data not shown). Meanwhile, the binding sequence on adpAp also showed 100% identity in S. roseosporus and S. griseus (data not shown), suggesting that ArpA in S. roseosporus must function via the same mechanism as in S. griseus. This prompted us to construct a strain for a high yield of daptomycin, because deletion of arpA in S. griseus can enhance streptomycin production and accelerate morphological development (27.Onaka H. Ando N. Nihira T. Yamada Y. Beppu T. Horinouchi S. Cloning and characterization of the A-factor receptor gene from Streptomyces griseus.J. Bacteriol. 1995; 177: 6083-6092Crossref PubMed Google Scholar). arpA was also deleted in S. roseosporus by in-frame knock-out. Consistent with this hypothesis, the ΔarpA mutant showed earlier development of aerial mycelia compared with the wild type (Fig. 6A) and about 2.5-fold higher production of daptomycin (Fig. 6B). These data suggested that an A-factor-motivated signaling pathway is conserved in S. roseosporus and that removal of the A-factor receptor can promote daptomycin production and morphological development. AtrA was predicted to be a TetR-type transcriptional regulator, which often binds to its own promoter (26.Ramos J.L. Martínez-Bueno M. Molina-Henares A.J. Terán W. Watanabe K. Zhang X. Gallegos M.T. Brennan R. Tobes R. The TetR family of transcriptional repressors.Microbiol. Mol. Biol. Rev. 2005; 69: 326-356Crossref PubMed Scopus (809) Google Scholar). EMSA showed that AtrA could bind directly to atrAp at a low concentration (0.2 μm or about 100 ng), but no shifted band was observed even with more AtrA in the control DNA (Fig. 7A), suggesting AtrA could specifically bind to atrAp at high affinity. Meanwhile, five binding sites were determined by DNase I footprinting assays (Fig. 7B), and the sequences were also determined (Fig. 7C). These binding sites were all very small (4, 8, or 10 bp), and no consensus sequence was found (Fig. 7D). Moreover, deletion of all five sites abolished AtrA-atrAp interaction, whereas removal of each site did not affect AtrA binding to atrAp (data not shown), also supporting the idea of multiple interactive sites of AtrA on its own promoter. Nevertheless, we still observed a GGA motif in site a and a GGAA(G/C) motif in sites b and e (Fig. 7D). Although no GGA motif was found in site c or d (Fig. 7D), these sites were rich in purine, suggesting a more complex binding pattern of AtrA on its own promoter. These results, to some extent, were consistent with the previous report that in S. coelicolor, even though AtrA-atrAp interact at high affinity, no AtrA-binding sites could be determined on atrAp by DNase I footprinting assays (28.Ahn S.K. Cuthbertson L. Nodwell J.R. Genome context as a predictive tool for identifying regulatory targets of the TetR family transcriptional regulators.PLoS One. 2012; 7: e50562Crossref PubMed Scopus (48) Google Scholar). Based on xylE reporter assays, atrAp activities in the ΔatrA mutant was only about 1/20th that of the wild type on day 2 and persisted at a lower level than wild type in the following days. However, atrAp activities in the wild type also kept dropping (Fig. 7E), suggesting that atrA is positively autoregulated. Here, we used the biotinylated dptEp to isolate AtrA as a positive regulator for daptomycin production by directly binding to the gene cluster promoter. In other Streptomyces species, AtrA can also positively regulate streptomycin and actinorhodin production in S. griseus and S. coelicolor, respectively, by direct binding to strRp and the flanking regions of actII-orf4p, respectively (18.Uguru G.C. Stephens K.E. Stead J.A. Towle J.E. Baumberg S. McDowall K.J. Transcriptional activation of the pathway-specific regulator of the actinorhodin biosynthetic genes in Streptomyces coelicolor.Mol. Microbiol. 2005; 58: 131-150Crossref PubMed Scopus (123) Google Scholar, 19.Hirano S. Tanaka K. Ohnishi Y. Horinouchi S. Conditionally positive effect of the TetR-family transcriptional regulator AtrA on streptomycin production by Streptomyces griseus.Microbiology. 2008; 154: 905-914Crossref PubMed Scopus (37) Google Scholar), but not the promoter of the gene clusters. Meanwhile, AtrA negatively regulates avermectin production in S. avermitilis without binding to aveRp (20.Chen L. Lu Y. Chen J. Zhang W. Shu D. Qin Z. Yang S. Jiang W. Characterization of a negative regulator AveI for avermectin biosynthesis in Streptomyces avermitilis NRRL8165.Appl. Microbiol. Biotechnol. 2008; 80: 277-286Crossref PubMed Scopus (35) Google Scholar), suggesting diverse and complex regulatory patterns of AtrA in Streptomyces. AtrA was required for morphological development and secondary metabolism in S. roseosporus, suggesting that AtrA is also a pleiotropic regulator as well as AdpA, the key regulator in the A-factor-induced signaling pathway. In S. griseus, AtrA and AdpA synergistically bind to strRp to positively regulate streptomycin production (19.Hirano S. Tanaka K. Ohnishi Y. Horinouchi S. Conditionally positive effect of the TetR-family transcriptional regulator AtrA on streptomycin production by Streptomyces griseus.Microbiology. 2008; 154: 905-914Crossref PubMed Scopus (37) Google Scholar). Here in S. roseosporus, we demonstrated that AdpA and AtrA bind to different sites of atrAp, as determined by bioinformatics analysis and DNase I footprinting assays, respectively (FIGURE 5., FIGURE 7.). We also proved that atrA expression was under the direct control of AdpA, thus establishing the signaling pathway from extracellular stimulation of the potential A-factor to daptomycin gene cluster expression and also, for the first time, providing direct evidence about the transcriptional regulation of daptomycin production (Fig. 8). Based on these observations, we propose that targeted genetic engineering by deletion of arpA results in enhanced daptomycin production. Although this industrial strain showed the highest daptomycin production at about day 4, gene cluster expression decreased continuously. The decreasing dptEp activity might be explained by the decreased expression of atrA, as AtrA bound directly to atrAp, and positively regulated its activity, thus composing a positive feedback regulatory pattern of atrA expression by itself. We observed that adpA expression also declined during daptomycin production (data not shown), which also might contribute to the decreased expression of atrA, because AdpA positively regulates atrA expression directly. This ingenious regulation of atrA expression might ensure proper gene cluster expression and daptomycin production. AtrA protein from all three Streptomyces species had 100% identity in their DNA-binding domains, suggesting the same binding pattern among the three. Although imperfect inverted repeats were reported in S. coelicolor and S. griseus, no apparent palindromic sequence was observed in S. roseosporus dptEp or atrAp, suggesting the atypical binding pattern of this TetR-type transcriptional regulator. However, most binding sites of AtrA in S. roseosporus contained GGA motifs and were rich in purine. These observations suggested complex binding mechanism of AtrA. Therefore it might not be possible to map precisely the universal conserved binding motifs of AtrA on DNA. However, it might be possible that the adjacent DNA sequence environment or higher DNA architecture conformation is also critical for AtrA recognition and binding. We may need more experimental information, such as chromatin immunoprecipitation (ChIP) assays or AtrA-DNA co-crystallization, to establish this binding model. We are grateful to Professor George H. Jones, Department of Biology, Emory University, for providing the xylE reporter plasmid pIPP1. We also thank the reviewers for comments made during the revision process that led to an enhanced discussion of the results." @default.
• W1978045625 created "2016-06-24" @default.
• W1978045625 creator A5000870111 @default.
• W1978045625 creator A5009903384 @default.
• W1978045625 creator A5022512002 @default.
• W1978045625 creator A5023828770 @default.
• W1978045625 creator A5047744865 @default.
• W1978045625 creator A5055029433 @default.
• W1978045625 creator A5064029973 @default.
• W1978045625 creator A5079817035 @default.
• W1978045625 creator A5086448413 @default.
• W1978045625 date "2015-03-01" @default.
• W1978045625 modified "2023-10-16" @default.
• W1978045625 title "Transcriptional Regulation of the Daptomycin Gene Cluster in Streptomyces roseosporus by an Autoregulator, AtrA" @default.
• W1978045625 cites W1588672603 @default.
• W1978045625 cites W1601833279 @default.
• W1978045625 cites W1640069945 @default.
• W1978045625 cites W1973761814 @default.
• W1978045625 cites W1995995599 @default.
• W1978045625 cites W2013310483 @default.
• W1978045625 cites W2017578460 @default.
• W1978045625 cites W2026370576 @default.
• W1978045625 cites W2047269473 @default.
• W1978045625 cites W2050558966 @default.
• W1978045625 cites W2051033712 @default.
• W1978045625 cites W2059892552 @default.
• W1978045625 cites W2065926730 @default.
• W1978045625 cites W2075600594 @default.
• W1978045625 cites W2076914126 @default.
• W1978045625 cites W2098875065 @default.
• W1978045625 cites W2099481682 @default.
• W1978045625 cites W2101335898 @default.
• W1978045625 cites W2112291685 @default.
• W1978045625 cites W2112859245 @default.
• W1978045625 cites W2123836301 @default.
• W1978045625 cites W2144285767 @default.
• W1978045625 cites W2144827388 @default.
• W1978045625 cites W2153584471 @default.
• W1978045625 cites W2165168923 @default.
• W1978045625 cites W2171535756 @default.
• W1978045625 doi "https://doi.org/10.1074/jbc.m114.608273" @default.
• W1978045625 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4367297" @default.
• W1978045625 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/25648897" @default.
• W1978045625 hasPublicationYear "2015" @default.
• W1978045625 type Work @default.
• W1978045625 sameAs 1978045625 @default.
• W1978045625 citedByCount "59" @default.
• W1978045625 countsByYear W19780456252015 @default.
• W1978045625 countsByYear W19780456252016 @default.
• W1978045625 countsByYear W19780456252017 @default.
• W1978045625 countsByYear W19780456252018 @default.
• W1978045625 countsByYear W19780456252019 @default.
• W1978045625 countsByYear W19780456252020 @default.
• W1978045625 countsByYear W19780456252021 @default.
• W1978045625 countsByYear W19780456252022 @default.
• W1978045625 countsByYear W19780456252023 @default.
• W1978045625 crossrefType "journal-article" @default.
• W1978045625 hasAuthorship W1978045625A5000870111 @default.
• W1978045625 hasAuthorship W1978045625A5009903384 @default.
• W1978045625 hasAuthorship W1978045625A5022512002 @default.
• W1978045625 hasAuthorship W1978045625A5023828770 @default.
• W1978045625 hasAuthorship W1978045625A5047744865 @default.
• W1978045625 hasAuthorship W1978045625A5055029433 @default.
• W1978045625 hasAuthorship W1978045625A5064029973 @default.
• W1978045625 hasAuthorship W1978045625A5079817035 @default.
• W1978045625 hasAuthorship W1978045625A5086448413 @default.
• W1978045625 hasBestOaLocation W19780456251 @default.
• W1978045625 hasConcept C104317684 @default.
• W1978045625 hasConcept C164866538 @default.
• W1978045625 hasConcept C185592680 @default.
• W1978045625 hasConcept C199360897 @default.
• W1978045625 hasConcept C2778651397 @default.
• W1978045625 hasConcept C2778980435 @default.
• W1978045625 hasConcept C2779489039 @default.
• W1978045625 hasConcept C2779920670 @default.
• W1978045625 hasConcept C36857842 @default.
• W1978045625 hasConcept C41008148 @default.
• W1978045625 hasConcept C523546767 @default.
• W1978045625 hasConcept C54355233 @default.
• W1978045625 hasConcept C86803240 @default.
• W1978045625 hasConcept C89423630 @default.
• W1978045625 hasConceptScore W1978045625C104317684 @default.
• W1978045625 hasConceptScore W1978045625C164866538 @default.
• W1978045625 hasConceptScore W1978045625C185592680 @default.
• W1978045625 hasConceptScore W1978045625C199360897 @default.
• W1978045625 hasConceptScore W1978045625C2778651397 @default.
• W1978045625 hasConceptScore W1978045625C2778980435 @default.
• W1978045625 hasConceptScore W1978045625C2779489039 @default.
• W1978045625 hasConceptScore W1978045625C2779920670 @default.
• W1978045625 hasConceptScore W1978045625C36857842 @default.
• W1978045625 hasConceptScore W1978045625C41008148 @default.
• W1978045625 hasConceptScore W1978045625C523546767 @default.
• W1978045625 hasConceptScore W1978045625C54355233 @default.
• W1978045625 hasConceptScore W1978045625C86803240 @default.
• W1978045625 hasConceptScore W1978045625C89423630 @default.
• W1978045625 hasIssue "12" @default.
• W1978045625 hasLocation W19780456251 @default.
• W1978045625 hasLocation W19780456252 @default.

• next