FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1978083226> ?p ?o ?g. }

• W1978083226 endingPage "8287" @default.
• W1978083226 startingPage "8277" @default.
• W1978083226 abstract "Inheritance of DNA cytosine methylation pattern during successive cell division is mediated by maintenance DNA (cytosine-5) methyltransferase 1 (DNMT1). Lysine 142 of DNMT1 is methylated by the SET domain containing lysine methyltransferase 7 (SET7), leading to its degradation by proteasome. Here we show that PHD finger protein 20-like 1 (PHF20L1) regulates DNMT1 turnover in mammalian cells. Malignant brain tumor (MBT) domain of PHF20L1 binds to monomethylated lysine 142 on DNMT1 (DNMT1K142me1) and colocalizes at the perinucleolar space in a SET7-dependent manner. PHF20L1 knockdown by siRNA resulted in decreased amounts of DNMT1 on chromatin. Ubiquitination of DNMT1K142me1 was abolished by overexpression of PHF20L1, suggesting that its binding may block proteasomal degradation of DNMT1K142me1. Conversely, siRNA-mediated knockdown of PHF20L1 or incubation of a small molecule MBT domain binding inhibitor in cultured cells accelerated the proteasomal degradation of DNMT1. These results demonstrate that the MBT domain of PHF20L1 reads and controls enzyme levels of methylated DNMT1 in cells, thus representing a novel antagonist of DNMT1 degradation. Inheritance of DNA cytosine methylation pattern during successive cell division is mediated by maintenance DNA (cytosine-5) methyltransferase 1 (DNMT1). Lysine 142 of DNMT1 is methylated by the SET domain containing lysine methyltransferase 7 (SET7), leading to its degradation by proteasome. Here we show that PHD finger protein 20-like 1 (PHF20L1) regulates DNMT1 turnover in mammalian cells. Malignant brain tumor (MBT) domain of PHF20L1 binds to monomethylated lysine 142 on DNMT1 (DNMT1K142me1) and colocalizes at the perinucleolar space in a SET7-dependent manner. PHF20L1 knockdown by siRNA resulted in decreased amounts of DNMT1 on chromatin. Ubiquitination of DNMT1K142me1 was abolished by overexpression of PHF20L1, suggesting that its binding may block proteasomal degradation of DNMT1K142me1. Conversely, siRNA-mediated knockdown of PHF20L1 or incubation of a small molecule MBT domain binding inhibitor in cultured cells accelerated the proteasomal degradation of DNMT1. These results demonstrate that the MBT domain of PHF20L1 reads and controls enzyme levels of methylated DNMT1 in cells, thus representing a novel antagonist of DNMT1 degradation. Methylation at the 5-position of cytosine to generate 5mC 3The abbreviations and trivial names used are: 5mC5-methylcytosinePCNAproliferative cell nuclear antigenDNMT1K142me1DNMT1 lysine 142 monomethylated5-aza-CdR5-aza-2′-deoxycytidineMBTmalignant brain tumorSET7SET domain containing lysine methyltransferase 7UNC12152-phenylamino-1,4-bis(4-(pyrrolidinyl)piperidinyl)benzamideMG132N-(benzyloxycarbonyl)leucinylleucinylleucinalCADORchromatin-associated domain array. on DNA represents a major epigenetic mechanism of gene silencing (1.Kim J.K. Samaranayake M. Pradhan S. Epigenetic mechanisms in mammals.Cell Mol. Life Sci. 2009; 66: 596-612Crossref PubMed Scopus (338) Google Scholar, 2.Kinney S.R. Pradhan S. Cheng X. Blumenthal R. Modifications of Nuclear DNA and Its Regulatory Proteins. Elsevier Inc., London, UK2011: 311-333Google Scholar, 3.Jones P.A. Functions of DNA methylation. Islands, start sites, gene bodies and beyond.Nat. Rev. Genet. 2012; 13: 484-492Crossref PubMed Scopus (3805) Google Scholar). 5mC occurs mostly at CpG dinucleotides and a small percentage at CHG and CHH sequences (4.Lister R. Pelizzola M. Dowen R.H. Hawkins R.D. Hon G. Tonti-Filippini J. Nery J.R. Lee L. Ye Z. Ngo Q.M. Edsall L. Antosiewicz-Bourget J. Stewart R. Ruotti V. Millar A.H. Thomson J.A. Ren B. Ecker J.R. Human DNA methylomes at base resolution show widespread epigenomic differences.Nature. 2009; 462: 315-322Crossref PubMed Scopus (3352) Google Scholar). In mammalian cells, there are three catalytically active DNA (cytosine-5) methyltransferase families represented by DNMT1, DNMT3A, and DNMT3B along with a methyltransferase-like protein, DNMT3L, which lacks a catalytic domain (5.Chen T. Li E. Establishment and maintenance of DNA methylation patterns in mammals.in: Doerfler W. Böhm P. DNA Methylation: Basic Mechanisms. Springer, Berlin2006: 179-201Crossref Scopus (143) Google Scholar). The physical interaction and functional partnership between de novo methyltransferase DNMT3A, DNMT3B, and DNMT3L is well documented and is hypothesized to bind and methylate chromatin as a substrate (6.Ooi S.K. Qiu C. Bernstein E. Li K. Jia D. Yang Z. Erdjument-Bromage H. Tempst P. Lin S.P. Allis C.D. Cheng X. Bestor T.H. DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA.Nature. 2007; 448: 714-717Crossref PubMed Scopus (1129) Google Scholar, 7.Suetake I. Shinozaki F. Miyagawa J. Takeshima H. Tajima S. DNMT3L stimulates the DNA methylation activity of Dnmt3a and Dnmt3b through a direct interaction.J. Biol. Chem. 2004; 279: 27816-27823Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar). Hypomethylation of the genome leads to chromosome instability, and aberrant DNA methylation is frequently observed in cancer (8.Ehrlich M. Cancer-linked DNA hypomethylation and its relationship to hypermethylation.in: Doerfler W. Böhm P. DNA Methylation: Development, Genetic Disease and Cancer. Springer, Berlin2006: 251-274Crossref Scopus (125) Google Scholar, 9.Karpf A.R. Matsui S. Genetic disruption of cytosine DNA methyltransferase enzymes induces chromosomal instability in human cancer cells.Cancer Res. 2005; 65: 8635-8639Crossref PubMed Scopus (207) Google Scholar). Among the DNA methyltransferases, DNMT1 is known as the maintenance methyltransferase. DNMT1 preserves epigenetic inheritance by methylating the newly synthesized daughter strand during DNA replication (10.Leonhardt H. Page A.W. Weier H.U. Bestor T.H. A targeting sequence directs DNA methyltransferase to sites of DNA replication in mammalian nuclei.Cell. 1992; 71: 865-873Abstract Full Text PDF PubMed Scopus (822) Google Scholar). There are several interacting proteins of DNMT1, most notably PCNA and UHRF1 (ubiquitin-like containing PHD and RING finger domains 1) (11.Chuang L.S. Ian H.I. Koh T.W. Ng H.H. Xu G. Li B.F. Human DNA-(cytosine-5) methyltransferase-PCNA complex as a target for p21WAF1.Science. 1997; 277: 1996-2000Crossref PubMed Scopus (787) Google Scholar, 12.Bostick M. Kim J.K. Estève P.O. Clark A. Pradhan S. Jacobsen S.E. UHRF1 plays a role in maintaining DNA methylation in mammalian cells.Science. 2007; 317: 1760-1764Crossref PubMed Scopus (982) Google Scholar). Both PCNA and UHRF1 are colocalized with DNMT1 during DNA replication, and deletion of UHRF1 by genetic knockout resulted in a severe loss (>80%) of 5mC in the embryonic stem cells. This suggests that there are proteins other than DNA methyltransferases that play an important role in the mechanism of epigenetic inheritance, perhaps via selective targeting of enzymes. Furthermore, UHRF1 has E3 ubiquitin-protein ligase activity that mediates the ubiquitination of target proteins, such as histone H3 and promyelocytic leukemia protein and alters gene expression (13.Guan D. Factor D. Liu Y. Wang Z. Kao H.Y. The epigenetic regulator UHRF1 promotes ubiquitination-mediated degradation of the tumor-suppressor protein promyelocytic leukemia protein.Oncogene. 2013; 32: 3819-3828Crossref PubMed Scopus (52) Google Scholar, 14.Citterio E. Papait R. Nicassio F. Vecchi M. Gomiero P. Mantovani R. Di Fiore P.P. Bonapace I.M. Np95 is a histone-binding protein endowed with ubiquitin ligase activity.Mol. Cell. Biol. 2004; 24: 2526-2535Crossref PubMed Scopus (157) Google Scholar). 5-methylcytosine proliferative cell nuclear antigen DNMT1 lysine 142 monomethylated 5-aza-2′-deoxycytidine malignant brain tumor SET domain containing lysine methyltransferase 7 2-phenylamino-1,4-bis(4-(pyrrolidinyl)piperidinyl)benzamide N-(benzyloxycarbonyl)leucinylleucinylleucinal chromatin-associated domain array. Another mechanism that influences epigenetic inheritance is the availability and stability of DNA methyltransferases in cells. Some mechanistic based inhibitors of DNMTs, such as 5-azacytidine, are a chemical analog of the cytosine nucleoside of DNA and RNA (15.Li L.H. Olin E.J. Buskirk H.H. Reineke L.M. Cytotoxicity and mode of action of 5-azacytidine on L1210 leukemia.Cancer Res. 1970; 30: 2760-2769PubMed Google Scholar). 5-Azacytidine is thought to inhibit DNA methyltransferases at low doses, causing hypomethylation of DNA (16.Stresemann C. Brueckner B. Musch T. Stopper H. Lyko F. Functional diversity of DNA methyltransferase inhibitors in human cancer cell lines.Cancer Res. 2006; 66: 2794-2800Crossref PubMed Scopus (337) Google Scholar). Incorporation of 5-azacytidine into DNA leads to its covalent binding and capturing of DNA methyltransferases, resulting in the depletion of the enzyme pool in the cell (17.Santi D.V. Norment A. Garrett C.E. Covalent bond formation between a DNA-cytosine methyltransferase and DNA containing 5-azacytosine.Proc. Natl. Acad. Sci. U.S.A. 1984; 81: 6993-6997Crossref PubMed Scopus (425) Google Scholar, 18.Jüttermann R. Li E. Jaenisch R. Toxicity of 5-aza-2′-deoxycytidine to mammalian cells is mediated primarily by covalent trapping of DNA methyltransferase rather than DNA demethylation.Proc. Natl. Acad. Sci. U.S.A. 1994; 91: 11797-11801Crossref PubMed Scopus (578) Google Scholar). In another study, 5-azacytidine and 5-aza-CdR treatment of cultured mammalian cells led to rapid degradation of DNMTs by the cellular proteasomal pathway (19.Ghoshal K. Datta J. Majumder S. Bai S. Kutay H. Motiwala T. Jacob S.T. 5-Aza-deoxycytidine induces selective degradation of DNA methyltransferase 1 by a proteasomal pathway that requires the KEN box, bromo-adjacent homology domain, and nuclear localization signal.Mol. Cell. Biol. 2005; 25: 4727-4741Crossref PubMed Scopus (362) Google Scholar). Therefore, it is plausible that both covalent attachment of these enzymes to DNA and their degradation may lead to poor maintenance of DNA methylation, consequently leading to hypomethylation of the genome and cellular apoptosis. There are several studies supporting the role of lysine methylation of non-histone proteins in the regulation of protein activity and stability, particularly p53, ERα, RelA, and DNMT1 (20.Yang X.D. Lamb A. Chen L.F. Methylation, a new epigenetic mark for protein stability.Epigenetics. 2009; 4: 429-433Crossref PubMed Scopus (37) Google Scholar). Both p53 and ERα are stabilized by lysine methylation, whereas RelA and DNMT1 are destabilized. The effect of lysine methylation on histones is well studied, and it can be repressive or activating, depending on what lysine is methylated in a chromatin context (21.Black J.C. Van Rechem C. Whetstine J.R. Histone lysine methylation dynamics. Establishment, regulation, and biological impact.Mol. Cell. 2012; 48: 491-507Abstract Full Text Full Text PDF PubMed Scopus (765) Google Scholar). Indeed, distinct methyllysine marks recruit different reader proteins, resulting in different transcriptional responses. For example, histone H3K9me recruits HP1 proteins for gene silencing (22.Lachner M. O'Carroll D. Rea S. Mechtler K. Jenuwein T. Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins.Nature. 2001; 410: 116-120Crossref PubMed Scopus (2173) Google Scholar). Several protein domains are capable of recognizing methylation marks, including ANK repeats, WD40, plant homeodomain, PWWP, chromodomain, and MBT domain (23.Wysocka J. Swigut T. Milne T.A. Dou Y. Zhang X. Burlingame A.L. Roeder R.G. Brivanlou A.H. Allis C.D. WDR5 associates with histone H3 methylated at K4 and is essential for H3 K4 methylation and vertebrate development.Cell. 2005; 121: 859-872Abstract Full Text Full Text PDF PubMed Scopus (646) Google Scholar, 24.Kim J. Daniel J. Espejo A. Lake A. Krishna M. Xia L. Zhang Y. Bedford M.T. Tudor, MBT and chromo domains gauge the degree of lysine methylation.EMBO Rep. 2006; 7: 397-403Crossref PubMed Scopus (387) Google Scholar, 25.Vermeulen M. Eberl H.C. Matarese F. Marks H. Denissov S. Butter F. Lee K.K. Olsen J.V. Hyman A.A. Stunnenberg H.G. Mann M. Quantitative interaction proteomics and genome-wide profiling of epigenetic histone marks and their readers.Cell. 2010; 142: 967-980Abstract Full Text Full Text PDF PubMed Scopus (576) Google Scholar). Proteins containing MBT domains are products of polycomb group genes and have been implicated in transcriptional repression of developmental genes. Indeed, misregulation of MBT-containing proteins has been linked to various disease phenotypes (26.Bonasio R. Lecona E. Reinberg D. MBT domain proteins in development and disease.Semin. Cell Dev. Biol. 2010; 21: 221-230Crossref PubMed Scopus (115) Google Scholar). In a previous report, we demonstrated that SET7 monomethylation of DNMT1 (DNMT1K142me1) leads to its proteasome-mediated protein degradation, and we have hypothesized that the antagonist LSD1 (lysine-specific demethylase 1) may prevent this degradation by removing the methyl mark (27.Estève P.O. Chin H.G. Benner J. Feehery G.R. Samaranayake M. Horwitz G.A. Jacobsen S.E. Pradhan S. Regulation of DNMT1 stability through SET7-mediated lysine methylation in mammalian cells.Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 5076-5081Crossref PubMed Scopus (235) Google Scholar). Furthermore, DNMT1K142me1 acts as an antagonist to Ser-143 phosphorylation, thus offering a methyl-phospho switch status that operates during the cell cycle. Phosphorylated DNMT1 is more stable than the methylated enzyme, and it is more abundant during the DNA synthesis stage of the cell cycle (28.Estève P.O. Chang Y. Samaranayake M. Upadhyay A.K. Horton J.R. Feehery G.R. Cheng X. Pradhan S. A methylation and phosphorylation switch between an adjacent lysine and serine determines human DNMT1 stability.Nat. Struct. Mol. Biol. 2011; 18: 42-48Crossref PubMed Scopus (156) Google Scholar). Although the methylated species of DNMT1 accumulates during the late DNA synthesis stage and decreases thereafter, a significant percentage still remains throughout the whole cell cycle. This prompted us to search for a possible reader(s) of lysine-methylated DNMT1 and its role in the cell. In this report, we discuss a novel DNMT1K142me1 reader, PHF20L1, a protein that contains an active MBT domain (24.Kim J. Daniel J. Espejo A. Lake A. Krishna M. Xia L. Zhang Y. Bedford M.T. Tudor, MBT and chromo domains gauge the degree of lysine methylation.EMBO Rep. 2006; 7: 397-403Crossref PubMed Scopus (387) Google Scholar). We studied its role in DNMT1 stability, loading, and epigenetic inheritance in mammalian cells. All cell lines (HeLa, COS-7, Jurkat, HCT116, and HEK293) were grown as per ATCC recommendations. Nuclear cell extracts were immunoprecipitated as described previously (29.Andrews N.C. Faller D.V. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells.Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2211) Google Scholar, 30.Estève P.O. Chin H.G. Smallwood A. Feehery G.R. Gangisetty O. Karpf A.R. Carey M.F. Pradhan S. Direct interaction between DNMT1 and G9a coordinates DNA and histone methylation during replication.Genes Dev. 2006; 20: 3089-3103Crossref PubMed Scopus (416) Google Scholar). GST pull-downs and immunofluorescence studies were performed as described previously (30.Estève P.O. Chin H.G. Smallwood A. Feehery G.R. Gangisetty O. Karpf A.R. Carey M.F. Pradhan S. Direct interaction between DNMT1 and G9a coordinates DNA and histone methylation during replication.Genes Dev. 2006; 20: 3089-3103Crossref PubMed Scopus (416) Google Scholar, 31.Pradhan S. Kim G.D. The retinoblastoma gene product interacts with maintenance human DNA (cytosine-5) methyltransferase and modulates its activity.EMBO J. 2002; 21: 779-788Crossref PubMed Scopus (93) Google Scholar). Far-Western experiments were carried out by first incubating recombinant DNMT1 with equimolar amounts of either recombinant SET7 or MBP2 (New England Biolabs), as described previously (28.Estève P.O. Chang Y. Samaranayake M. Upadhyay A.K. Horton J.R. Feehery G.R. Cheng X. Pradhan S. A methylation and phosphorylation switch between an adjacent lysine and serine determines human DNMT1 stability.Nat. Struct. Mol. Biol. 2011; 18: 42-48Crossref PubMed Scopus (156) Google Scholar). UNC1215 and proteasome inhibitor MG132 were purchased from Tocris Bioscience and Selleck Chemicals, respectively. UNC1215 and MG132 were dissolved in ethanol and methanol, respectively. For cell cycle analysis, HeLa cells were synchronized in G1/S by using 2 mm thymidine block followed by 5 μg/ml aphidicolin treatment. Chromatin was extracted as described previously (12.Bostick M. Kim J.K. Estève P.O. Clark A. Pradhan S. Jacobsen S.E. UHRF1 plays a role in maintaining DNA methylation in mammalian cells.Science. 2007; 317: 1760-1764Crossref PubMed Scopus (982) Google Scholar). For DNMT1 protein stability and degradation studies, either cycloheximide or MG132 was applied. For the cycloheximide study, HeLa cells were treated with 60 μm UNC1215 for 2 days and then incubated with 50 μg/ml cycloheximide (Sigma-Aldrich) at different times. For the MG132 study, HeLa cells were treated with different concentrations (0, 20, 40, and 80 μm) of UNC1215 for 2 days and then incubated with 50 μm MG132 for 2 h. Cells were then lysed and assayed by Western blot using a DNMT1 antibody (New England Biolabs, catalog no. M0231S). Immunoprecipitations of nuclear cell extracts (400 μg to 1 mg) were performed by using 5 μg of anti-DNMT1 (Abcam, catalog no. ab92453) or anti-PHF20L1 (Sigma-Aldrich, catalog no. HPA028417). 5 μg of purified normal rabbit IgG (Cell Signaling Technology, catalog no. 2729) was used as a negative control. Immunoprecipitations were loaded into SDS-polyacrylamide gels for subsequent Western blot analyses. For immunoprecipitation studies done after UNC1215 treatment, HeLa cells were treated with 80 μm UNC1215 or ethanol for 3 days prior to precipitation. GST pull-downs were performed with increasing amounts (1, 2, and 4 μg) of baculovirus purified full-length DNMT1 (New England Biolabs, catalog no. M0230S) that were methylated overnight by MBP-SET7 (New England Biolabs, catalog no. M0233S) and then incubated with purified MBT-GST (10 μg). DNMT1 was cloned into pVIC1 (New England Biolabs) and purified as described previously (32.Pradhan S. Bacolla A. Wells R.D. Roberts R.J. Recombinant human DNA (cytosine-5) methyltransferase. I. Expression, purification, and comparison of de novo and maintenance methylation.J. Biol. Chem. 1999; 274: 33002-33010Abstract Full Text Full Text PDF PubMed Scopus (475) Google Scholar). MBP-SET7 and MBP-PHF20L1 were cloned into pMAL-C5x vector (New England Biolabs, catalog no. N8108S) and purified using amylose resin (New England Biolabs, catalog no. E8021). In vitro pull-downs of MBP-PHF20L1a with DNMT1K142me1 peptide were carried out by first incubating 10 μm peptide (biotin-LSKPRTPRRSK(me1)SDGEAKPE) with agarose-streptavidin beads (25 μl of bead slurry, Thermo Scientific, catalog no. 2359) for 1 h at 4 °C with rotation in peptide binding buffer containing 10% glycerol (v/v), 0.1 mm DTT, 1 mm EDTA, 20 mm HEPES, and 100 mm KCl. The beads were then washed two times with 1× PBS and resuspended in fresh binding buffer. 500 ng of recombinant MBP-PHF20L1a, with increasing concentrations of UNC1215 inhibitor (0, 20, 40, 100, and 200 μm) was then added simultaneously to the peptide-bound streptavidin beads and incubated for 1 h at 4 °C with rotation. The beads were then washed two times with binding buffer and resuspended in 3× SDS sample buffer containing 1 mm DTT (New England Biolabs, catalog no. B7709S). Samples were then boiled at 95 °C for 5 min and analyzed by Western blot analysis (detailed under “Western Blot and Densitometry”) with anti-MBP-HRP antibodies at a 1:5000 dilution (New England Biolabs, catalog no. E8038S). For immunofluorescence studies, COS-7 cells were cultured on coverslips and transfected with a mixture of epitope-tagged PHF20L1a, CFP-SET7 plasmids, and Transpass D2 transfection reagent (New England Biolabs) at a ratio of 1:3 μg/μl for 24 h. The cells were fixed with 1% paraformaldehyde (v/v). Serum detecting endogenous DNMT1K142me1 protein (New England Biolabs) was used at a 1:10,000 dilution and visualized with an anti-rabbit IgG coupled with Alexa Fluor 594 dye (Molecular Probes). Epitope-tagged PHF20L1a protein was detected by an anti-mouse FLAG (or anti-mouse Myc from Cell Signaling Technology, catalog no. 2276) and visualized with an anti-mouse IgG coupled with Alexa Fluor 488 dye (Molecular Probes). These probes were visualized under a Zeiss LSM510 confocal microscope with a 63× oil objective lens or under a Zeiss Axiovert 200M microscope. CFP-SET7 was visualized using confocal microscopy (405-nm laser) or with an AQUA filter using an Axiovert microscope. In some cases, DAPI nuclear staining was used. For 5mC detection, fixed cells were first incubated with 2 n HCl for 20 min and neutralized with 1 m Tris base for 5 min at room temperature. A mouse monoclonal antibody specific for 5mC (Eurogentec, catalog no. BI-MECY-0100) was added at 1:500 dilution overnight at 4 °C and detected by an anti-mouse IgG coupled with Alexa Fluor 488 dye. Endogenous PHF20L1 and DNMT1 proteins in HeLa cells were detected using an anti-PHF20L1 antibody (Abcam, catalog no. ab67796) at 1:20 dilution and an anti-DNMT1 antibody (Santa Cruz Biotechnology, Inc., catalog no. sc-20701) at 1:50 dilution. To visualize endogenous colocalization of PHF20L1 and DNMT1, secondary anti-mouse IgG coupled with Alexa Fluor 594 dye and anti-rabbit IgG coupled with Alexa Fluor 488 dye antibodies (Molecular Probes) were used, respectively. For the far-Western experiment, samples containing recombinant DNMT1 (10 μg) were first incubated with either recombinant MBP2-SET7 (40 μg) or MBP2 (20 μg). Increasing amounts of these DNMT1 mixtures (0.25, 0.5, 1, and 2 μg) were then electrophoresed on an SDS-polyacrylamide gel and transferred to a PVDF membrane. The PVDF membrane was blocked in 1× PBS, 0.1% Tween 20 (v/v), and 5% dry milk (w/v) for 1 h at room temperature. The membrane was then washed three times for 5 min in 1× PBS containing 0.1% Tween 20 (v/v). Peptide binding buffer containing 2 μg of recombinant MBP-PHF20L1a was added to the membrane and incubated for 1 h at room temperature. The membrane was then washed three times for 5 min in 1× PBS, 0.1% Tween 20 (v/v). Rabbit anti-PHF20L1 (Sigma-Aldrich, catalog no. HPA028417) antibody was used (1:2000 dilution) to detect the PHF20L1a bound to the membrane-immobilized DNMT1. For PHF20L1 gene knockdown, HeLa cells were transfected for 48 h using HiPerFect reagent (Qiagen, catalog no. 301705) with 100 nm PHF20L1 siRNA (catalog no. EHU060221, Sigma-Aldrich) or SMART pool ON-TARGETplus PHF20L1 siRNA (catalog no. L-027322-01-0005, Thermo Scientific). For control transfection, 100 nm EGFP siRNA (catalog no. EHUEGFP, Sigma-Aldrich) or a universal negative control siRNA were used (catalog no. 12935-300, Invitrogen). The siRNA control used for SMART pool PHF20L1 was an ON-TARGETplus non-targeting control pool (catalog no. D-001810-10-05, Thermo Scientific). For global 5mC detection by HPLC, cells were transfected for 5 days using 50 nm PHF20L1 siRNA. Briefly, 107 HeLa cells were collected, washed three times with PBS, and resuspended in buffer A containing 10 mm HEPES (pH 7.4), 1.5 mm MgCl2, 10 mm KCl, 0.34 m sucrose, 10% glycerol (v/v), 0.1% Triton X-100 (v/v), 1 mm DTT, protease inhibitor mixture (Sigma-Aldrich), and PMSF. After a 5-min incubation on ice, cells were centrifuged (1300 × g for 5 min at 4 °C), and the pellet P1 corresponding to the nuclei was collected, the supernatant S1 representing the cytoplasmic fraction. The nuclei were lysed for 10 min on ice with a hypotonic buffer B containing 0.2 mm EGTA, 3 mm EDTA, 1 mm DTT, and protease inhibitor mixture plus PMSF. The soluble nuclear fraction S3 and the chromatin P3 were separated through centrifugation (1700 × g for 5 min at 4 °C). The P3 fraction was resuspended in buffer C, containing 10 mm Tris-HCl (pH 7.5), 1 mm CaCl2, and protease inhibitor mixture plus PMSF. The chromatin P3 fraction was kept at −80 °C. Before loading 20 μg of chromatin on a SDS-polyacrylamide gel, the P3 fraction was first treated with DNase I (New England Biolabs, catalog no. M0303S) for 10 min at 37 °C and then resuspended and boiled for 5 min in SDS sample buffer (New England Biolabs) containing 1 mm DTT. Gel filtration chromatography was performed with Jurkat cell nuclear extract as described previously (30.Estève P.O. Chin H.G. Smallwood A. Feehery G.R. Gangisetty O. Karpf A.R. Carey M.F. Pradhan S. Direct interaction between DNMT1 and G9a coordinates DNA and histone methylation during replication.Genes Dev. 2006; 20: 3089-3103Crossref PubMed Scopus (416) Google Scholar). COS-7 cells were co-transfected with a mixture of GFP or GFP-SET7, 3xFLAG or 3xFLAG-PHF20L1, HA-ubiquitin as well as DsRed-DNMT1 plasmids, and Transpass D2 transfection reagent (New England Biolabs) at a ratio of 1:3 μg/μl for 24 h. Transfected COS-7 cells were treated with 10 μm MG132 for 12 h and lysed as described previously (27.Estève P.O. Chin H.G. Benner J. Feehery G.R. Samaranayake M. Horwitz G.A. Jacobsen S.E. Pradhan S. Regulation of DNMT1 stability through SET7-mediated lysine methylation in mammalian cells.Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 5076-5081Crossref PubMed Scopus (235) Google Scholar). Cell lysates (100–200 μg) were then immunoprecipitated with DNMT1 antibody (Abcam, catalog no. ab92453). Ubiquitination was detected as described previously (27.Estève P.O. Chin H.G. Benner J. Feehery G.R. Samaranayake M. Horwitz G.A. Jacobsen S.E. Pradhan S. Regulation of DNMT1 stability through SET7-mediated lysine methylation in mammalian cells.Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 5076-5081Crossref PubMed Scopus (235) Google Scholar). Western blots were performed as previously described (30.Estève P.O. Chin H.G. Smallwood A. Feehery G.R. Gangisetty O. Karpf A.R. Carey M.F. Pradhan S. Direct interaction between DNMT1 and G9a coordinates DNA and histone methylation during replication.Genes Dev. 2006; 20: 3089-3103Crossref PubMed Scopus (416) Google Scholar). Antibodies and antiserum against DNMT1 were obtained from New England Biolabs (1:10,000 working dilution). Anti-PHF20L1 antibody (1:5000 working dilution) was purchased from Sigma-Aldrich (catalog no. HPA028417). Anti-SET7 (catalog no. 2813), anti-histone H3 (catalog no. 9715), anti-PHF20 (catalog no. 3934), and anti-HA tag (catalog no. 3724) were obtained from Cell Signaling Technology and used at a 1:2000 dilution. Anti-β-actin and anti-GFP monoclonal antibodies were obtained from Sigma-Aldrich and Roche Applied Science, respectively, and used at a 1:5000 dilution. Densitometry was performed using ImageJ software (W. S. Rasband, National Institutes of Health). All densitometry values (arbitrary units) were normalized to either their respective β-actin, histone H3 blots, or Ponceau S staining. siRNA-transfected HeLa cells were harvested, and total RNA was purified using TRIzol reagent (Invitrogen). For reverse transcription of RNA, iScript (Bio-Rad) was used to convert 1 μg of total RNA, and then 40 ng of cDNA was quantified by performing real-time PCR using a MyiQ Cycler (Bio-Rad) and iQ SYBR Green Supermix (Bio-Rad). The following primers were used in the real-time mixes at a working concentration of 5 nm each: DNMT1, GGCTGAGATGAGGCAAAAAG (forward) and ACCAACTCGGTACAGGATGC (reverse); PHF20L1, AGCGTTGGAACCATCGTTAT (forward) and GACAATCAGACCAGCAAGCA (reverse). RNA values were normalized using primers GCCAAAAGGGTCATCATCTC (forward) and TGAGTCCTTCCACGATACCA (reverse) for human GAPDH. Genomic DNA was isolated from siRNA-transfected HeLa cells using an Invitrogen Easy-DNA kit (catalog no. K1800-01) per the manufacturer's specifications. RNA contamination was removed from the genomic DNA with AMPure XP (Agencourt, catalog no. A63880) beads per the manufacturer's specifications. Nucleoside digestion of genomic DNA was done by incubating 4–5 μg of genomic DNA in a mixture of New England Biolabs nucleases at 37 °C overnight. Nucleosides were subsequently purified by running the digested sample through a Qiagen QIAquick spin column and collecting the flow-through. LC-MS analysis was performed on an Agilent 1200 series HPLC system equipped with a G1316A UV detector and 6120 mass detector (Agilent, Santa Clara, CA) with a Waters Atlantis T3 column (4.6 × 150 mm, 3 μm, Waters (Milford, MA)) equipped with an in-line filter and guard column. Peak quantification was based on the integration area of each target nucleoside at the maximum absorption of UV and adjusted by its respective extinction coefficient constant. Biotin or biotin-DNMT1K142me1 peptides were bound and detected on a chromatin-associated domain array (CADOR) as described previously (24.Kim J. Daniel J. Espejo A. Lake A. Krishna M. Xia L. Zhang Y. Bedford M.T. Tudor, MBT and chromo domains gauge the degree of lysine methylation.EMBO Rep. 2006; 7: 397-403Crossref PubMed Scopus (387) Google Scholar). The CADOR chip contains bromodomain, chromodomain, and Tudor, PHD, SANT, SWIRM, MBT, CW, and PWWP domains fused to glutathione S-transferase (GST). To search for a reader of DNMT1K142me1 modification, we synthesized a biotin-tagged peptide encompassing amino acids 132–150 of DNMT1 with monomethylated Lys-142 in the center and screened with a protein domain microarray (24.Kim J. Daniel J. Espejo A. Lake A. Krishna M. Xia L. Zhang Y. Bedford M.T. Tudor, MBT and chromo domains gauge the degree of lysine methylation.EMBO Rep. 2006; 7: 397-403Crossref PubMed Scopus (387) Google Scholar, 34.Espejo A. Côté J. Bednarek A. Richard S. Bedford M.T. A protein-domain microarray identif" @default.
• W1978083226 created "2016-06-24" @default.
• W1978083226 creator A5001008905 @default.
• W1978083226 creator A5009848955 @default.
• W1978083226 creator A5012364874 @default.
• W1978083226 creator A5012509736 @default.
• W1978083226 creator A5035136612 @default.
• W1978083226 creator A5041910084 @default.
• W1978083226 creator A5058818197 @default.
• W1978083226 creator A5073753231 @default.
• W1978083226 creator A5087842003 @default.
• W1978083226 date "2014-03-01" @default.
• W1978083226 modified "2023-10-18" @default.
• W1978083226 title "Methyllysine Reader Plant Homeodomain (PHD) Finger Protein 20-like 1 (PHF20L1) Antagonizes DNA (Cytosine-5) Methyltransferase 1 (DNMT1) Proteasomal Degradation" @default.
• W1978083226 cites W1603793127 @default.
• W1978083226 cites W1964232579 @default.
• W1978083226 cites W1974322725 @default.
• W1978083226 cites W1981354816 @default.
• W1978083226 cites W1981969478 @default.
• W1978083226 cites W1982356313 @default.
• W1978083226 cites W1982991963 @default.
• W1978083226 cites W1994252008 @default.
• W1978083226 cites W1996868531 @default.
• W1978083226 cites W2002788005 @default.
• W1978083226 cites W2007534169 @default.
• W1978083226 cites W2008744347 @default.
• W1978083226 cites W2024088186 @default.
• W1978083226 cites W2027065741 @default.
• W1978083226 cites W2034619626 @default.
• W1978083226 cites W2036403623 @default.
• W1978083226 cites W2040754208 @default.
• W1978083226 cites W2049195493 @default.
• W1978083226 cites W2049868369 @default.
• W1978083226 cites W2055171335 @default.
• W1978083226 cites W2057877925 @default.
• W1978083226 cites W2059099579 @default.
• W1978083226 cites W2064472812 @default.
• W1978083226 cites W2079784129 @default.
• W1978083226 cites W2084885369 @default.
• W1978083226 cites W2093396457 @default.
• W1978083226 cites W2094646101 @default.
• W1978083226 cites W2099407732 @default.
• W1978083226 cites W2102462903 @default.
• W1978083226 cites W2114599216 @default.
• W1978083226 cites W2115802074 @default.
• W1978083226 cites W2121356384 @default.
• W1978083226 cites W2123032740 @default.
• W1978083226 cites W2131823236 @default.
• W1978083226 cites W2136905998 @default.
• W1978083226 cites W2142745453 @default.
• W1978083226 cites W2148033621 @default.
• W1978083226 cites W2154471713 @default.
• W1978083226 cites W2171118762 @default.
• W1978083226 doi "https://doi.org/10.1074/jbc.m113.525279" @default.
• W1978083226 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3961655" @default.
• W1978083226 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/24492612" @default.
• W1978083226 hasPublicationYear "2014" @default.
• W1978083226 type Work @default.
• W1978083226 sameAs 1978083226 @default.
• W1978083226 citedByCount "36" @default.
• W1978083226 countsByYear W19780832262014 @default.
• W1978083226 countsByYear W19780832262015 @default.
• W1978083226 countsByYear W19780832262016 @default.
• W1978083226 countsByYear W19780832262017 @default.
• W1978083226 countsByYear W19780832262018 @default.
• W1978083226 countsByYear W19780832262019 @default.
• W1978083226 countsByYear W19780832262020 @default.
• W1978083226 countsByYear W19780832262021 @default.
• W1978083226 countsByYear W19780832262022 @default.
• W1978083226 crossrefType "journal-article" @default.
• W1978083226 hasAuthorship W1978083226A5001008905 @default.
• W1978083226 hasAuthorship W1978083226A5009848955 @default.
• W1978083226 hasAuthorship W1978083226A5012364874 @default.
• W1978083226 hasAuthorship W1978083226A5012509736 @default.
• W1978083226 hasAuthorship W1978083226A5035136612 @default.
• W1978083226 hasAuthorship W1978083226A5041910084 @default.
• W1978083226 hasAuthorship W1978083226A5058818197 @default.
• W1978083226 hasAuthorship W1978083226A5073753231 @default.
• W1978083226 hasAuthorship W1978083226A5087842003 @default.
• W1978083226 hasBestOaLocation W19780832261 @default.
• W1978083226 hasConcept C104317684 @default.
• W1978083226 hasConcept C121587040 @default.
• W1978083226 hasConcept C150194340 @default.
• W1978083226 hasConcept C153911025 @default.
• W1978083226 hasConcept C175211621 @default.
• W1978083226 hasConcept C185592680 @default.
• W1978083226 hasConcept C2776023528 @default.
• W1978083226 hasConcept C33288867 @default.
• W1978083226 hasConcept C54355233 @default.
• W1978083226 hasConcept C552990157 @default.
• W1978083226 hasConcept C55493867 @default.
• W1978083226 hasConcept C86803240 @default.
• W1978083226 hasConcept C91965660 @default.
• W1978083226 hasConcept C95444343 @default.
• W1978083226 hasConceptScore W1978083226C104317684 @default.
• W1978083226 hasConceptScore W1978083226C121587040 @default.
• W1978083226 hasConceptScore W1978083226C150194340 @default.
• W1978083226 hasConceptScore W1978083226C153911025 @default.

• next