FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1978298900> ?p ?o ?g. }

• W1978298900 endingPage "17140" @default.
• W1978298900 startingPage "17130" @default.
• W1978298900 abstract "Homeodomain transcription factor Nkx2.2 is required for the final differentiation of the औ-cells in the pancreas and for the production of insulin. Nkx2.2 is expressed in islet cell precursors during pancreatic development and persists in a subset of mature islet cells including all औ-cells. To understand the mechanisms regulating the expression of Nkx2.2 in these different cell populations, we outlined the structure of the mouse nkx2.2gene and identified regions that direct cell type-specific expression. The nkx2.2 gene has two noncoding alternative first exons (exons 1a and 1b). In transgenic mice, sequences upstream from exon 1a directed expression predominantly in mature islet cells. Within this exon 1a promoter, cooperative interactions between HNF3 and basic helix-loop-helix factors neurogenin-3 or NeuroD1 binding to adjacent sites played key roles in its islet cell-specific expression. In contrast, sequences upstream from exon 1b restricted expression specifically to islet cell precursors. These studies reveal distinct mechanisms for directing the expression of a key differentiation factor in precursors versus mature islet cells. Homeodomain transcription factor Nkx2.2 is required for the final differentiation of the औ-cells in the pancreas and for the production of insulin. Nkx2.2 is expressed in islet cell precursors during pancreatic development and persists in a subset of mature islet cells including all औ-cells. To understand the mechanisms regulating the expression of Nkx2.2 in these different cell populations, we outlined the structure of the mouse nkx2.2gene and identified regions that direct cell type-specific expression. The nkx2.2 gene has two noncoding alternative first exons (exons 1a and 1b). In transgenic mice, sequences upstream from exon 1a directed expression predominantly in mature islet cells. Within this exon 1a promoter, cooperative interactions between HNF3 and basic helix-loop-helix factors neurogenin-3 or NeuroD1 binding to adjacent sites played key roles in its islet cell-specific expression. In contrast, sequences upstream from exon 1b restricted expression specifically to islet cell precursors. These studies reveal distinct mechanisms for directing the expression of a key differentiation factor in precursors versus mature islet cells. basic helix-loop-helix cytomegalovirus electrophoretic mobility shift assays glutathione S-transferase luciferase rapid amplification of 5′-cDNA ends thymidine kinase 5-bromo-4-chloro- 3-indolyl-औ-d-galactopyranoside The development and differentiation of organs such as the pancreas involve sequential modifications in gene expression controlled by a cascade of transcription factors. Recently, several mouse strains with mutations in genes encoding transcription factors that are expressed in the pancreatic औ-cells have been found to have severe abnormalities in pancreatic development (1Ahlgren U. Pfaff S.L. Jessell T.M. Edlund T. Edlund H. Nature. 1997; 385: 257-260Crossref PubMed Scopus (582) Google Scholar, 2Gradwohl G. Dierich A. LeMeur M. Guillemot F. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1607-1611Crossref PubMed Scopus (1174) Google Scholar, 3Harrison K.A. Thaler J. Pfaff S.L. Gu H. Kehrl J.H. Nat. Genet. 1999; 23: 71-75Crossref PubMed Scopus (291) Google Scholar, 4Jacquemin P. Durviaux S.M. Jensen J. Godfraind C. Gradwohl G. Guillemot F. Madsen O.D. Carmeliet P. Dewerchin M. Collen D. Rousseau G.G. Lemaigre F.P. Mol. Cell. Biol. 2000; 20: 4445-4454Crossref PubMed Scopus (277) Google Scholar, 5Jonsson J. Carlsson L. Edlund T. Edlund H. Nature. 1994; 371: 606-609Crossref PubMed Scopus (1557) Google Scholar, 6Li H. Arber S. Jessell T.M. Edlund H. Nat. Genet. 1999; 23: 67-70Crossref PubMed Scopus (23) Google Scholar, 7Naya F.J. Huang H.P. Qiu Y. Mutoh H. DeMayo F.J. Leiter A.B. Tsai M.J. Genes Dev. 1997; 11: 2323-2334Crossref PubMed Scopus (848) Google Scholar, 8Sander M. Neubuser A. Kalamaras J. Ee H.C. Martin G.R. German M.S. Genes Dev. 1997; 11: 1662-1673Crossref PubMed Scopus (457) Google Scholar, 9Sander M. Sussel L. Conners J. Scheel D. Kalamaras J. Dela Cruz F. Schwitzgebel V. Hayes-Jordan A. German M. Development. 2000; 127: 5533-5540Crossref PubMed Google Scholar, 10Sosa-Pineda B. Chowdhury K. Torres M. Oliver G. Gruss P. Nature. 1997; 386: 399-402Crossref PubMed Scopus (652) Google Scholar, 11St.-Onge L. Sosa-Pineda B. Chowdhury K. Mansouri A. Gruss P. Nature. 1997; 387: 406-409Crossref PubMed Scopus (659) Google Scholar, 12Sussel L. Kalamaras J. Hartigan-O'Connor D.J. Meneses J.J. Pedersen R.A. Rubenstein J.L. German M.S. Development. 1998; 125: 2213-2221Crossref PubMed Google Scholar). Mice homozygous for a null mutation of the homeodomain transcription factor Nkx2.2 develop severe hyperglycemia and die shortly after birth (12Sussel L. Kalamaras J. Hartigan-O'Connor D.J. Meneses J.J. Pedersen R.A. Rubenstein J.L. German M.S. Development. 1998; 125: 2213-2221Crossref PubMed Google Scholar). The mutant embryos lack insulin-producing औ-cells and have fewer α-cells and PP cells. Remarkably, in these mutants there remains a large population of islet cells that do not produce any of the four endocrine hormones. These cells express some औ-cell markers, such as islet amyloid polypeptide and PDX-1, but lack other definitive औ-cell markers including GLUT2, glucokinase, and the औ-cell-specific homeodomain factor Nkx6.1. These mice demonstrate that Nkx2.2 is necessary for the final differentiation of औ-cells. The onset of Nkx2.2 expression in mouse endoderm is coincident with the onset of dorsal pancreatic bud evagination at embryonic day 9.5. Most or all of the epithelial cells of the pancreas express Nkx2.2 from the onset of bud formation until embryonic day 12.5; thereafter, Nkx2.2 expression becomes more restricted. During the peak period for औ-cell neogenesis, from embryonic day 13.5 to 18.5 (13Pictet R. Rutter W.J. Society A.P. Steiner D.F. Frenkel N. Handbook of Physiology. 1. Williams and Wilkins, Baltimore, MD1972: 25-66Google Scholar), Nkx2.2 is expressed in a subset of incompletely differentiated endocrine precursor cells that coexpress the bHLH1proendocrine transcription factor neurogenin-3 (12Sussel L. Kalamaras J. Hartigan-O'Connor D.J. Meneses J.J. Pedersen R.A. Rubenstein J.L. German M.S. Development. 1998; 125: 2213-2221Crossref PubMed Google Scholar, 14Schwitzgebel V.M. Scheel D.W. Conners J.R. Kalamaras J. Lee J.E. Anderson D.J. Sussel L. Johnson J.D. German M.S. Development. 2000; 127: 3533-3542Crossref PubMed Google Scholar). Unlike neurogenin-3, which is expressed exclusively in precursor cells, Nkx2.2 is expressed also in differentiated endocrine cells. In the mature pancreas, Nkx2.2 expression is limited to the differentiated endocrine cells including α-, औ-, and PP cells, but not δ-cells. Therefore, Nkx2.2 is expressed at least three distinct stages in islet cell differentiation: in the broad initial pancreatic precursor population, in a subset of the neurogenin-3-expressing islet progenitor cells, and in differentiated islet cells. In addition, Nkx2.2 is expressed in the developing ventral neural tube and mature neurons in the central nervous system (15Shimamura K. Hartigan D.J. Martinez S. Puelles L. Rubenstein J.L. Development. 1995; 121: 3923-3933Crossref PubMed Google Scholar). However, the mechanisms that control Nkx2.2 expression in these different populations are unknown. To understand the mechanisms that regulate the expression of Nkx2.2, we outline here the structure of the mouse nkx2.2 gene and identify the regions that direct cell type-specific expression. Thenkx2.2 gene has three alternative first exons (exons 1a, 1b, and 1c). We found that the 5′-flanking region of exon 1a drives the expression of Nkx2.2 predominantly in differentiated islet cells and is activated by cooperative interactions between HNF3औ and either neurogenin-3 or the related bHLH factor NeuroD1. On the other hand, the 5′-flanking region of exon 1b directs expression predominantly to islet precursor cells. These data reveal distinct mechanisms regulating Nkx2.2 expression in progenitor cells and in mature islet cells and support a model in which HNF3औ and neurogenin-3 lie upstream from Nkx2.2 in the hierarchy of औ-cell differentiation factors. Plasmids containing mouse nkx2.2 genomic DNA were kindly provided by L. Sussel (University of Colorado, Denver (12Sussel L. Kalamaras J. Hartigan-O'Connor D.J. Meneses J.J. Pedersen R.A. Rubenstein J.L. German M.S. Development. 1998; 125: 2213-2221Crossref PubMed Google Scholar)). The PI artificial chromosome clone containing the humanNKX2B gene and the plasmid containing human NKX2Bexons 1c and 2 were kindly provided by G. Bell and H. Furuta (University of Chicago) (16Furuta H. Horikawa Y. Iwasaki N. Hara M. Sussel L. Le Beau M.M. Davis E.M. Ogata M. Iwamoto Y. German M.S. Bell G.I. Diabetes. 1998; 47: 1356-1358PubMed Google Scholar). From the PI artificial chromosome clone, the fragment containing exons 1a and 1b was isolated by Southern blot analysis using a fragment of the mouse nkx2.2 gene containing exon 1a and 5′-flanking sequences. The mouse and human upstream regions were sequenced and are available from GenBank. Total RNA was isolated from the mouse neural tube at embryonic day 11.5, pancreas at day 2.5, and isolated adult islets of Langerhans, and from the mouse औ-cell tumor line औTC3. The 5′-end of the mouse nkx2.2 cDNA from each cell was identified by the oligonucleotide-capping RACE method using the GeneRacer Kit according to the manufacturer's instructions (Invitrogen). Briefly, 2 ॖg of total RNA was dephosphorylated, decapped, and ligated to GeneRacer RNA oligonucleotides. Then reverse transcription was carried out using an oligo(dT) primer. Using this cDNA pool as a template, we carried out 30 cycles of PCR using the GeneRacer 5′-primer and HW323 (5′-CACTTGGTCAATTCGTGG CTCTCC-3′) as primers. For nested PCR, we used the GeneRacer 5′-nested primer and HW324 (5′-CACGCAGAAATGTAGGCTGTGACTGG-3′) as primers and performed 25 cycles of PCR. The PCR products were subcloned into pCR4-TOPO (Invitrogen) and sequenced. To generate reporter plasmids, fragments of the 5′-region of the mouse nkx2.2 gene obtained by restriction digestion or PCR were ligated upstream from the luciferase gene in the pFOXLuc1 plasmid or upstream from the thymidine kinase minimal promoter in the pFOXLuc1TK (17Watada H. Mirmira R.G. Leung J. German M.S. J. Biol. Chem. 2000; 275: 34224-34230Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). Mutagenesis of the reporter gene constructs was performed using the QuikChange® mutagenesis kit according to the manufacturer's instructions (Stratagene). All constructs were confirmed by sequencing. The औTC3 cell line and the α-cell tumor line αTC1.6 were grown in Dulbecco's modified Eagle's medium supplemented with 2.57 fetal bovine serum and 157 horse serum. NIH3T3 cells were grown in Dulbecco's modified Eagle's medium supplemented with 107 calf serum. The rat floor plate cell-derived line Z13 (a generous gift from T. Jessell, Columbia University, New York) was grown in OptiMEM with 107 fetal bovine serum. For transient mammalian cell transfections, cells were plated in six-well tissue culture plates 24 h before transfection. For standard reporter gene analyses, 1.8 ॖg of each luciferase reporter plasmid and 0.2 ॖg of the CMVऔ-Gal plasmid were cotransfected into cells using the TRANSFAST cationic lipid reagent (Promega) according to the manufacturer's instructions. For assessing the effect of each transcription factor on the Nkx2.2 promoter, we cotransfected 10 ng of the expression vector with 1.8 ॖg of the reporter gene vector. Controls for transcription factor experiments always contained equal amounts of the empty CMV expression vector (pBAT12). 48 h after transfection, cells were harvested, and luciferase and औ-galactosidase assays were performed as described previously (17Watada H. Mirmira R.G. Leung J. German M.S. J. Biol. Chem. 2000; 275: 34224-34230Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). All transfection experiments were performed in triplicate on at least three separate occasions. Luciferase activity was corrected for transfection efficiency by dividing by the औ-galactosidase activity. The HNF3औ deletion mutant constructs were generated by PCR starting with the CMV-HNF3औ plasmid (a generous gift from M. Stoffel, Albert Einstein College of Medicine, New York (18Duncan S.A. Navas M.A. Dufort D. Rossant J. Stoffel M. Science. 1998; 281: 692-695Crossref PubMed Scopus (293) Google Scholar)) as a template and subcloned into either the pBAT11 T7 in vitro transcription vector (17Watada H. Mirmira R.G. Leung J. German M.S. J. Biol. Chem. 2000; 275: 34224-34230Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar), the pBAT12 CMV expression vector, or the pPIG11 glutathione S-transferase (GST) fusion vector. The truncated neurogenin-3 constructs were generated by PCR and subcloned into the pCITE4a T7 in vitrotranscription vector (Amersham Biosciences), pBAT12, or pPIG11. HNF3औ, E47, NeuroD1, and neurogenin-3 proteins were produced in vitro using the TNT Quick Coupled Lysate System®(Promega) and the in vitro expression vectors as templates. Nuclear extracts from αTC1.6 cells, औTC3 cells, and NIH3T3 cells were prepared following the procedure described by Sadowski and Gilman (19Sadowski H.B. Gilman M.Z. Nature. 1993; 362: 79-83Crossref PubMed Scopus (234) Google Scholar). Single-stranded oligonucleotides corresponding to the sequences in the mouse Nkx2.2 promoter were 5′-end labeled with [γ-32P]ATP using T4 polynucleotide kinase. The labeled oligonucleotide was column purified and annealed to an excess of complementary strand. EMSA buffers and electrophoresis conditions were as described previously (17Watada H. Mirmira R.G. Leung J. German M.S. J. Biol. Chem. 2000; 275: 34224-34230Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). One ॖl of in vitro reaction mixture or 2 ॖg of nuclear extract was used for each 10-ॖl binding reaction. For antibody experiments, 1 ॖl of antiserum was added to each binding reaction, and the mix was incubated for 15 min at room temperature before PAGE. The antisera directed against HNF3α, औ, and γ were generous gifts from R. H. Costa (University of Illinois at Chicago (20Qian X. Samadani U. Porcella A. Costa R.H. Mol. Cell. Biol. 1995; 15: 1364-1376Crossref PubMed Google Scholar)). The following oligonucleotides along with their complementary strands were used as binding probes: H31, CGGGCTAGAAAAACAAACAGAGCGCTGCGC; E4, GATCCATTGGCCATATGTTCAGCGGTAATAAATTGA. The FLAG-fused HNF3औ expression plasmids were generated using the pcDNA3FLAG plasmid (a generous gift from S. Tomita, University of California, San Francisco (21Tomita S. Ozaki T. Taru H. Oguchi S. Takeda S. Yagi Y. Sakiyama S. Kirino Y. Suzuki T. J. Biol. Chem. 1999; 274: 2243-2254Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar)). The FLAG-fused HNF3औ and neurogenin-3 expression plasmids were transfected into NIH3T3 cells, nuclear extracts were isolated, and 50 ॖg of each nuclear extract was used for immunoprecipitation. The immunoprecipitation procedures were performed using FLAG-tagged protein immunoprecipitation kit (Sigma) according to the manufacturer's instructions. GST fusion proteins were produced in Escherichia coli BL21 competent cells via the pPIG plasmid system (22Ohneda K. Mirmira R.G. Wang J. Johnson J.D. German M.S. Mol. Cell. Biol. 2000; 20: 900-911Crossref PubMed Scopus (167) Google Scholar). In vitro translated and [35S]methionine-labeled proteins were prepared using the TNT-coupled reticulocyte lysate system (Promega). 25 ॖl of35S-labeled protein was mixed with 10 ॖg of GST fusion protein bound to glutathione-agarose beads in a total volume of 600 ॖl of interaction buffer (40 mm HEPES (pH 7.5), 50 mm KCl, 5 mm MgCl2, 0.2 mm EDTA, 1 mm dithiothreitol, 0.57 Nonidet P-40). Samples were then incubated for 1 h at 4 °C with gentle rocking, and the beads were washed three times with interaction buffer. The bound protein was eluted with 2 × SDS sample buffer, fractionated on SDS-polyacrylamide gels, and visualized by autoradiography. We isolated 1.8 kb and 0.2 kb of thenkx2.2 exon 1a promoter (from −1754 to +85 bp relative to the 1a transcription start site and from −247 to +85 bp), 0.7 kb of the exon 1b promoter (from −665 to +109 bp relative to the 1b transcription start site), and 3.6 kb of the exon 1c promoter (from approximately −3600 to +106 bp relative to the 1c transcription start site) using suitable restriction enzymes or PCR. After cloning into the pऔgal-Enhancer vector (Clontech, CA), we obtained pऔgal.Nkx2.2E1a-1800, pऔgal.Nkx2.2E1a-200, pऔgal.Nkx2.2E1b-700, and pऔgal.Nkx2.2E1c-3600. Each plasmid was purified using Endo Free Plasmid kit (Qiagen), linearized, and microinjected (1.5 ng/ॖl) into oocyte pronuclei from C3FeB6 mice. The injected embryos were transferred to pseudopregnant BDF1 female mice. After checking the genotype with PCR primers for the lacZsequence, we established multiple mouse lines with each construct by crossing each founder with C57B6 mice. For the Nkx2.2 1a −1754 bp construct we characterized five independent lines, three gave detectable expression of औ-galactosidase in identical patterns. For the Nkx2.2 1a −247 bp construct we characterized six independent lines, two gave detectable expression in the same patterns. For the Nkx2.2 1b construct we characterized 15 independent lines, four gave detectable expression in the same pattern. For the Nkx2.2 1c construct, we examined eight lines, and none gave detectable expression. The embryonic, neonatal, and adult tissues were harvested from the established mouse lines. The pancreases from adult mice were harvested after heart perfusion with 47 paraformaldehyde. Harvested tissues were prefixed for 30 min at 4 °C in 47 paraformaldehyde. Tissues were incubated overnight with 400 ॖg/ml X-gal substrate at room temperature. Gross embryos and dissected pancreases were visualized using a Leica dissecting microscope and imaged with a Spot RT digital camera and Openlab software. The tissues were fixed again in 47 paraformaldehyde, paraffin embedded, and sectioned at 5 ॖm. Immunohistochemical and immunofluorescence analyses were performed on paraffin sections as described previously (8Sander M. Neubuser A. Kalamaras J. Ee H.C. Martin G.R. German M.S. Genes Dev. 1997; 11: 1662-1673Crossref PubMed Scopus (457) Google Scholar). The primary antibodies were used at the following dilutions: guinea pig anti-insulin (Linco), 1:5,000; guinea pig anti-glucagon (Linco), 1:10,000; rabbit anti-neurogenin-3 (14Schwitzgebel V.M. Scheel D.W. Conners J.R. Kalamaras J. Lee J.E. Anderson D.J. Sussel L. Johnson J.D. German M.S. Development. 2000; 127: 3533-3542Crossref PubMed Google Scholar), 1:5,000; guinea pig anti-PDX-1 (14Schwitzgebel V.M. Scheel D.W. Conners J.R. Kalamaras J. Lee J.E. Anderson D.J. Sussel L. Johnson J.D. German M.S. Development. 2000; 127: 3533-3542Crossref PubMed Google Scholar), 1:5,000; rabbit anti-HNF3औ (23Briscoe J. Sussel L. Serup P. Hartigan-O'Connor D. Jessell T.M. Rubenstein J.L. Ericson J. Nature. 1999; 398: 622-627Crossref PubMed Scopus (600) Google Scholar) (gift of T. Jessell), 1:1,000; mouse monoclonal anti-Nkx2.2 (23Briscoe J. Sussel L. Serup P. Hartigan-O'Connor D. Jessell T.M. Rubenstein J.L. Ericson J. Nature. 1999; 398: 622-627Crossref PubMed Scopus (600) Google Scholar) (Developmental Studies Hybridoma Bank, University of Iowa), 1:10. For immunohistochemistry, biotinylated anti-rabbit, anti-guinea pig or anti-mouse antibodies were used at a 1:200 dilution (Vector) and were detected with the ABC Elite immunoperoxidase system (Vector). The secondary antibodies used for immunofluorescence were as follows: FITC-conjugated anti-rabbit, anti-mouse or anti-guinea pig diluted 1:100 (Jackson Laboratory); Cy3-conjugated anti-rabbit diluted 1:800 (Jackson Laboratory). Fluorescence and brightfield images were visualized with a Zeiss axioskop II and imaged with a Hamamatsu ORCA100 digital camera and Openlab software. As an initial step in assessing its regulation, we identified the transcription initiation sites in the mouse nkx2.2 gene using 5′-RACE. Using primers complementary to the 5′-end of the known nkx2.2 cDNA sequence (12Sussel L. Kalamaras J. Hartigan-O'Connor D.J. Meneses J.J. Pedersen R.A. Rubenstein J.L. German M.S. Development. 1998; 125: 2213-2221Crossref PubMed Google Scholar), 5′-RACE was performed with cDNA from fetal mouse pancreas at embryonic day 11.5, neural tube at day 10.5, adult pancreatic islets, the औ-cell tumor line औTC3, and the fibroblast line NIH3T3. Sequencing of the PCR products revealed three major transcription start sites (Fig.1A), which produce three different splice products (Fig. 1B). Two novel exons, 1a and 1b, each are spliced upstream from exon1c. Exon 1b is located ∼8 kb upstream from exon 1c and the translation initiation site, and exon 1a is located ∼0.7 kb farther upstream. Although the 5′-RACE results are not quantitative, the adult islet and औTC3 RNA produced predominantly exon 1a-containing products, whereas the pancreatic bud and neural tube RNA produced predominantly exon 1b products, suggesting that transcription initiating from these exons is regulated in a tissue-specific manner. Products starting with exon1c were found at low abundance in औTC3 cells and all four tissues but not in NIH3T3 cells. To identify sequences that might control transcription of thenkx2.2 gene, we sequenced the regions flanking each major transcription start site in both the mouse and human genes (Fig. 1,C–E). As shown in Fig. 1, promoter 1a contains no TATA box although it has a conserved GC-rich region that is frequently observed in non-TATA box promoters (24Reynolds G.A. Basu S.K. Osborne T.F. Chin D.J. Gil G. Brown M.S. Goldstein J.L. Luskey K.L. Cell. 1984; 38: 275-285Abstract Full Text PDF PubMed Scopus (266) Google Scholar). Promoters 1b and 1c each have a TATA box sequence 30 bp upstream from the major transcription start site. The proximal sequences of promoters 1a and both 1c are highly conserved between mouse and human and contain multiple potential binding sites for bHLH proteins (E boxes), homeodomain proteins, and nkx2 class homeodomain proteins (25Watada H. Mirmira R.G. Kalamaras J. German M.S. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9443-9448Crossref PubMed Scopus (85) Google Scholar). Promoter 1a also contains a conserved consensus binding site for HNF3 (26Overdier D.G. Porcella A. Costa R.H. Mol. Cell. Biol. 1994; 14: 2755-2766Crossref PubMed Scopus (328) Google Scholar). The proximal region of promoter 1b is less well conserved and contains two conserved E boxes but no other identifiable pancreatic transcription factor binding sites. To test for the ability to drive transcription in cell lines, we constructed a series of plasmids with upstream fragments of the mouse nkx2.2 gene linked to the firefly luciferase gene. As shown in Fig.2A, the relative activities of the three promoters were compared in the औ-cell-derived line औTC3, the α-cell-derived line αTC1.6, the rat fetal floor plate cell-derived line Z13, and the fibroblast line NIH3T3. These cell lines were chosen because Nkx2.2 protein was detected by Western blot analysis in औTC3 cells, αTC1.6 cells, and Z13 cells, but not in NIH3T3 cells (data not shown). In agreement with the 5′-RACE results, the nkx2.2 1a promoter drove luciferase expression only in islet cell lines, whereas the nkx2.2 1b promoter functioned in Z13 cells. The nkx2.2 1c promoter showed minimal activity in all cell lines. Although the longest construct, containing sequences from promoter 1a through 1c, produced less absolute activity than the shorter constructs, all transfections were performed with the same mass of DNA, so that the molar concentration for this large plasmid was 2–3-fold lower than for the shorter promoters. Because, in addition, the transfection efficiencies of such large plasmids may be decreased, relative activity of this very large construct can best be judged by comparing the औTC3 cells and NIH3T3 cells infected with the same construct. Using that comparison, the activity of the longest construct was not significantly different from the construct with the isolated 1a promoter in औTC3 cells. Focusing on the Nkx2.2 1a promoter, we mapped sequences within the proximal 2,800 bp important for expression in islet cell lines. As shown in Fig. 2B, a series of truncations of the promoter demonstrated that removal of the sequence between −247 and −121 bp completely disrupted the activity of the promoter in औTC3 cells. Within this region, we identified seven potentially important elements based on their similarity to known transcription factor binding sites. Mutations were introduced into each of these sites in the context of the −247 bp reporter gene construct and tested in औTC3 cells (Fig.3, A andB). Mutations introduced into the homeodomain binding site (Ho), or the two 5′-E boxes (E1 and E2) singly or together had modest effects on promoter activity. In contrast, mutation of either the HNF3 (recently renamed FoxA) binding site (H3) or the adjacent E box (E4) blocked promoter activity almost completely. The fact that both mutations can independently abolish promoter activity suggests that these two elements may work synergistically. Next, we generated reporter gene constructs containing three tandem repeats of the H3/E4 region inserted upstream from the minimal promoter. As shown in Fig. 3C, this small mini-enhancer is capable of activating transcription in a cell type-specific and orientation-independent manner. Together with the mutation data, these results demonstrate that the H3 and E4 elements are both necessary and sufficient for nkx2.2 1a promoter activity in the transfected cell lines. To identify factors that bind to H3 and E4, we performed EMSAs using double-stranded oligodeoxynucleotides corresponding to H3 and E4 as probes. The H3 site conforms to an HNF3 binding consensus (26Overdier D.G. Porcella A. Costa R.H. Mol. Cell. Biol. 1994; 14: 2755-2766Crossref PubMed Scopus (328) Google Scholar). The three member of the HNF3 family of winged helix transcription factors play key roles in development and gene expression in endoderm-derived tissues (27Monaghan A.P. Kaestner K.H. Grau E. Schutz G. Development. 1993; 119: 567-578Crossref PubMed Google Scholar), and HNF3औ (FoxA2) is a key regulator of the pancreatic/duodenal homeobox gene pdx-1 (28Wu K.L. Gannon M. Peshavaria M. Offield M.F. Henderson E. Ray M. Marks A. Gamer L.W. Wright C.V. Stein R. Mol. Cell. Biol. 1997; 17: 6002-6013Crossref PubMed Google Scholar, 29Sharma S. Jhala U.S. Johnson T. Ferreri K. Leonard J. Montminy M. Mol. Cell. Biol. 1997; 17: 2598-2604Crossref PubMed Scopus (97) Google Scholar, 30Marshak S. Benshushan E. Shoshkes M. Havin L. Cerasi E. Melloul D. Mol. Cell. Biol. 2000; 20: 7583-7590Crossref PubMed Scopus (106) Google Scholar). As shown in Fig. 4A, in vitrotranslated HNF3औ can bind to H3. A complex of similar mobility was detected in nuclear extracts from αTC1.6 cells and औTC3 cells, but not in NIH3T3 cell, and this complex was recognized by antiserum to HNF3औ but not to HNF3α or HNF3γ. E boxes contain the consensus sequence CANNTG, bind to dimers of the bHLH class of transcription factors, and mediate cell-specific gene expression. Among the bHLH proteins expressed in the pancreas, neurogenin-3 and NeuroD1 play critical roles in islet development and gene expression (2Gradwohl G. Dierich A. LeMeur M. Guillemot F. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1607-1611Crossref PubMed Scopus (1174) Google Scholar, 7Naya F.J. Huang H.P. Qiu Y. Mutoh H. DeMayo F.J. Leiter A.B. Tsai M.J. Genes Dev. 1997; 11: 2323-2334Crossref PubMed Scopus (848) Google Scholar, 14Schwitzgebel V.M. Scheel D.W. Conners J.R. Kalamaras J. Lee J.E. Anderson D.J. Sussel L. Johnson J.D. German M.S. Development. 2000; 127: 3533-3542Crossref PubMed Google Scholar, 31Apelqvist A. Li H. Sommer L. Beatus P. Anderson D.J. Honjo T. Hrabe de Angelis M. Lendahl U. Edlund H. Nature. 1999; 400: 877-881Crossref PubMed Scopus (970) Google Scholar, 32Naya F.J. Stellrecht C.M. Tsai M.J. Genes Dev. 1995; 9: 1009-1019Crossref PubMed Scopus (521) Google Scholar, 33Sommer L. Ma Q. Anderson D.J. Mol. Cell. Neurosci. 1996; 8: 221-241Crossref PubMed Scopus (459) Google Scholar). As shown in Fig. 4B,in vitro translated neurogenin-3 and NeuroD1 can bind to E4 when dimerized with the ubiquitous bHLH protein E47. A complex of similar mobility detected in nuclear extracts from αTC1.6 cells and औTC3 cells, but not NIH3T3 cells, was recognized by antisera to NeuroD1 and E47. To test the ability of the bHLH proteins and HNF3औ to activate the islet-specific H3/E4 element in non-islet cells, we expressed various bHLH factors in NIH3T3 cells along with a luciferase construct driven by either the −247 bp nkx2.2 1a promoter (Fig. 5A) or by three copies of the H3/E4 element from the 1a promoter upstream from a minimal THYMIDINE KINASE promoter (Fig. 5D). As shown in Fig.5A, HNF3औ or E47 alone activated the nkx2.2 1a promoter modestly; and coexpression of HNF3औ with E47 did not provide any further activation. On the other hand, the addition of NeuroD1 or neurogenin-3 to E47 and HNF3औ synergistically activated the promoter. Activity of the three factors transfected together was significantly greater than the combined activities of the individual transcription factors. To keep all transfections comparable, no attempt was made to optimize relative synergistic activity by varying plasmid concentrations. In contrast, the related non-pancreatic bHLH factors MyoD and Tal1 did not synergize with HNF3औ, although MyoD significantly activated the promoter and mini-enhancer construct in the absence of HNF3औ. Synergistic activati" @default.
• W1978298900 created "2016-06-24" @default.
• W1978298900 creator A5016365141 @default.
• W1978298900 creator A5043895658 @default.
• W1978298900 creator A5057951350 @default.
• W1978298900 creator A5078965301 @default.
• W1978298900 date "2003-05-01" @default.
• W1978298900 modified "2023-10-17" @default.
• W1978298900 title "Distinct Gene Expression Programs Function in Progenitor and Mature Islet Cells" @default.
• W1978298900 cites W1538129425 @default.
• W1978298900 cites W1593837562 @default.
• W1978298900 cites W1721336579 @default.
• W1978298900 cites W1844312938 @default.
• W1978298900 cites W1893164080 @default.
• W1978298900 cites W1902497723 @default.
• W1978298900 cites W1961434948 @default.
• W1978298900 cites W1963537017 @default.
• W1978298900 cites W1969886345 @default.
• W1978298900 cites W1992517228 @default.
• W1978298900 cites W1995269929 @default.
• W1978298900 cites W2003028861 @default.
• W1978298900 cites W2005688198 @default.
• W1978298900 cites W2009624062 @default.
• W1978298900 cites W2015469705 @default.
• W1978298900 cites W2031204411 @default.
• W1978298900 cites W2033045615 @default.
• W1978298900 cites W2035621553 @default.
• W1978298900 cites W2041076714 @default.
• W1978298900 cites W2064520670 @default.
• W1978298900 cites W2070630477 @default.
• W1978298900 cites W2089328941 @default.
• W1978298900 cites W2090693983 @default.
• W1978298900 cites W2106004510 @default.
• W1978298900 cites W2110447217 @default.
• W1978298900 cites W2112163906 @default.
• W1978298900 cites W2126705032 @default.
• W1978298900 cites W2134219901 @default.
• W1978298900 cites W2137987484 @default.
• W1978298900 cites W2139168410 @default.
• W1978298900 cites W2141943090 @default.
• W1978298900 cites W2142486892 @default.
• W1978298900 cites W2149622001 @default.
• W1978298900 cites W2158511807 @default.
• W1978298900 cites W2159947557 @default.
• W1978298900 cites W2162464438 @default.
• W1978298900 cites W2171019508 @default.
• W1978298900 cites W2223979714 @default.
• W1978298900 doi "https://doi.org/10.1074/jbc.m213196200" @default.
• W1978298900 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12604598" @default.
• W1978298900 hasPublicationYear "2003" @default.
• W1978298900 type Work @default.
• W1978298900 sameAs 1978298900 @default.
• W1978298900 citedByCount "75" @default.
• W1978298900 countsByYear W19782989002012 @default.
• W1978298900 countsByYear W19782989002013 @default.
• W1978298900 countsByYear W19782989002014 @default.
• W1978298900 countsByYear W19782989002015 @default.
• W1978298900 countsByYear W19782989002016 @default.
• W1978298900 countsByYear W19782989002018 @default.
• W1978298900 countsByYear W19782989002019 @default.
• W1978298900 countsByYear W19782989002020 @default.
• W1978298900 countsByYear W19782989002021 @default.
• W1978298900 countsByYear W19782989002023 @default.
• W1978298900 crossrefType "journal-article" @default.
• W1978298900 hasAuthorship W1978298900A5016365141 @default.
• W1978298900 hasAuthorship W1978298900A5043895658 @default.
• W1978298900 hasAuthorship W1978298900A5057951350 @default.
• W1978298900 hasAuthorship W1978298900A5078965301 @default.
• W1978298900 hasBestOaLocation W19782989001 @default.
• W1978298900 hasConcept C104317684 @default.
• W1978298900 hasConcept C134018914 @default.
• W1978298900 hasConcept C14036430 @default.
• W1978298900 hasConcept C150194340 @default.
• W1978298900 hasConcept C153911025 @default.
• W1978298900 hasConcept C15729860 @default.
• W1978298900 hasConcept C165220095 @default.
• W1978298900 hasConcept C199360897 @default.
• W1978298900 hasConcept C201750760 @default.
• W1978298900 hasConcept C28328180 @default.
• W1978298900 hasConcept C41008148 @default.
• W1978298900 hasConcept C54355233 @default.
• W1978298900 hasConcept C555293320 @default.
• W1978298900 hasConcept C86803240 @default.
• W1978298900 hasConcept C90559484 @default.
• W1978298900 hasConcept C95444343 @default.
• W1978298900 hasConceptScore W1978298900C104317684 @default.
• W1978298900 hasConceptScore W1978298900C134018914 @default.
• W1978298900 hasConceptScore W1978298900C14036430 @default.
• W1978298900 hasConceptScore W1978298900C150194340 @default.
• W1978298900 hasConceptScore W1978298900C153911025 @default.
• W1978298900 hasConceptScore W1978298900C15729860 @default.
• W1978298900 hasConceptScore W1978298900C165220095 @default.
• W1978298900 hasConceptScore W1978298900C199360897 @default.
• W1978298900 hasConceptScore W1978298900C201750760 @default.
• W1978298900 hasConceptScore W1978298900C28328180 @default.
• W1978298900 hasConceptScore W1978298900C41008148 @default.
• W1978298900 hasConceptScore W1978298900C54355233 @default.
• W1978298900 hasConceptScore W1978298900C555293320 @default.

• next