FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1978597908> ?p ?o ?g. }

• W1978597908 endingPage "22689" @default.
• W1978597908 startingPage "22680" @default.
• W1978597908 abstract "Ischemic stroke stimulates neurogenesis in the adult rodent brain. The molecules underlying stroke-induced neurogenesis have not been fully investigated. Using real-time reverse transcription-PCR, we found that stroke substantially up-regulated angiopoietin 2 (ANG2), a proangiogenic gene, expression in subventricular zone neural progenitor cells. Incubation of neural progenitor cells with recombinant human ANG2 significantly increased the number of β-III tubulin-positive cells, a marker of immature neurons, but did not alter the number of glial fibrillary acidic protein (GFAP)-positive cells, a marker of astrocytes, suggesting that ANG2 promotes neuronal differentiation. Blockage of the ANG2 receptor, Tie2, with small interference RNA (siRNA)-Tie2 attenuated recombinant human ANG2 (rhANG2)-increased β-III tubulin mRNA levels compared with levels in the progenitor cells transfected with control siRNA. Chromatin immunoprecipitation analysis revealed that CCAAT/enhancer-binding protein (C/EBPβ) up-regulated by rhANG2 bound to β-III tubulin, which is consistent with published data that there are several C/EBPβ binding sites in the promoter of β-III tubulin gene. In addition, rhANG2 enhanced migration of neural progenitor cells measured by single neurosphere assay. Blockage of Tie2 with siRNA-Tie2 and a Tie2-neutralizing antibody did not suppress ANG2-enhanced migration. However, inhibition of matrix metalloproteinases with GM6001 blocked ANG2-enhanced migration. Collectively, our data suggest that interaction of ANG2, a proangiogenic factor, with its receptor Tie2 promotes neural progenitor cell differentiation into neuronal lineage cells, whereas ANG2 regulates neural progenitor cell migration through matrix metalloproteinases, which do not require its receptor Tie2. Ischemic stroke stimulates neurogenesis in the adult rodent brain. The molecules underlying stroke-induced neurogenesis have not been fully investigated. Using real-time reverse transcription-PCR, we found that stroke substantially up-regulated angiopoietin 2 (ANG2), a proangiogenic gene, expression in subventricular zone neural progenitor cells. Incubation of neural progenitor cells with recombinant human ANG2 significantly increased the number of β-III tubulin-positive cells, a marker of immature neurons, but did not alter the number of glial fibrillary acidic protein (GFAP)-positive cells, a marker of astrocytes, suggesting that ANG2 promotes neuronal differentiation. Blockage of the ANG2 receptor, Tie2, with small interference RNA (siRNA)-Tie2 attenuated recombinant human ANG2 (rhANG2)-increased β-III tubulin mRNA levels compared with levels in the progenitor cells transfected with control siRNA. Chromatin immunoprecipitation analysis revealed that CCAAT/enhancer-binding protein (C/EBPβ) up-regulated by rhANG2 bound to β-III tubulin, which is consistent with published data that there are several C/EBPβ binding sites in the promoter of β-III tubulin gene. In addition, rhANG2 enhanced migration of neural progenitor cells measured by single neurosphere assay. Blockage of Tie2 with siRNA-Tie2 and a Tie2-neutralizing antibody did not suppress ANG2-enhanced migration. However, inhibition of matrix metalloproteinases with GM6001 blocked ANG2-enhanced migration. Collectively, our data suggest that interaction of ANG2, a proangiogenic factor, with its receptor Tie2 promotes neural progenitor cell differentiation into neuronal lineage cells, whereas ANG2 regulates neural progenitor cell migration through matrix metalloproteinases, which do not require its receptor Tie2. The mammalian brain contains neural stem and progenitor cells in the sub-granular zone of the dentate gyrus and the subventricular zone (SVZ) 2The abbreviations used are: SVZsubventricular zoneANG2angiopoietin 2rhANG2recombinant human ANG2GFAPglial fibrillary acidic proteinsiRNAsmall interference RNAChIPchromatin immunoprecipitationC/EBPβCCAAT/enhancer-binding proteinMMPmatrix metalloproteinaseMCAomiddle cerebral artery occlusionLCMlaser capture microdissectionBmp2bone morphogenetic protein 2BrdUrdbromodeoxyuridineRTreverse transcriptionBrdUrdbromodeoxyuridine. 2The abbreviations used are: SVZsubventricular zoneANG2angiopoietin 2rhANG2recombinant human ANG2GFAPglial fibrillary acidic proteinsiRNAsmall interference RNAChIPchromatin immunoprecipitationC/EBPβCCAAT/enhancer-binding proteinMMPmatrix metalloproteinaseMCAomiddle cerebral artery occlusionLCMlaser capture microdissectionBmp2bone morphogenetic protein 2BrdUrdbromodeoxyuridineRTreverse transcriptionBrdUrdbromodeoxyuridine. of the lateral ventricles to generate new neurons throughout lifetime (1Reynolds B.A. Weiss S. Science. 1992; 255: 1707-1710Crossref PubMed Scopus (4545) Google Scholar, 2Johansson C.B. Momma S. Clarke D.L. Risling M. Lendahl U. Frisén J. Cell. 1999; 96: 25-34Abstract Full Text Full Text PDF PubMed Scopus (1666) Google Scholar, 3Alvarez-Buylla A. Seri B. Doetsch F. Brain Res. Bull. 2002; 57: 751-758Crossref PubMed Scopus (340) Google Scholar, 4Doetsch F. Caillé I. Lim D.A. García-Verdugo J.M. Alvarez-Buylla A. Cell. 1999; 97: 703-716Abstract Full Text Full Text PDF PubMed Scopus (3226) Google Scholar, 5Palmer T.D. Takahashi J. Gage F.H. Mol. Cell Neurosci. 1997; 8: 389-404Crossref PubMed Scopus (952) Google Scholar). Neuroblasts generated in the SVZ migrate in chains rostrally toward the olfactory bulb where they differentiate into olfactory interneurons (6Morshead C.M. Reynolds B.A. Craig C.G. McBurney M.W. Staines W.A. Morassutti D. Weiss S. van der Kooy D. Neuron. 1994; 13: 1071-1082Abstract Full Text PDF PubMed Scopus (1216) Google Scholar, 7García-Verdugo J.M. Doetsch F. Wichterle H. Lim D.A. Alvarez-Buylla A. J. Neurobiol. 1998; 36: 234-248Crossref PubMed Scopus (429) Google Scholar, 8Luskin M.B. J. Neurobiol. 1998; 36: 221-233Crossref PubMed Scopus (178) Google Scholar). Cerebral ischemia increases neurogenesis in the SVZ (9Zhang R.L. Zhang Z.G. Zhang L. Chopp M. Neuroscience. 2001; 105: 33-41Crossref PubMed Scopus (532) Google Scholar, 10Jin K. Minami M. Lan J.Q. Mao X.O. Batteur S. Simon R.P. Greenberg D.A. Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 4710-4715Crossref PubMed Scopus (1006) Google Scholar, 11Parent J.M. Vexler Z.S. Gong C. Derugin N. Ferriero D.M. Ann. Neurol. 2002; 52: 802-813Crossref PubMed Scopus (910) Google Scholar, 12Jin K. Wang X. Xie L. Mao X.O. Zhu W. Wang Y. Shen J. Mao Y. Banwait S. Greenberg D.A. Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 13198-13202Crossref PubMed Scopus (510) Google Scholar), and many SVZ neuroblasts migrate laterally toward the ischemic boundary zone (11Parent J.M. Vexler Z.S. Gong C. Derugin N. Ferriero D.M. Ann. Neurol. 2002; 52: 802-813Crossref PubMed Scopus (910) Google Scholar, 13Zhang R. Zhang Z. Wang L. Wang Y. Gousev A. Zhang L. Ho K.L. Morshead C. Chopp M. J. Cereb. Blood Flow Metab. 2004; 24: 441-448Crossref PubMed Scopus (350) Google Scholar, 14Arvidsson A. Collin T. Kirik D. Kokaia Z. Lindvall O. Nat. Med. 2002; 8: 963-970Crossref PubMed Scopus (2397) Google Scholar). Upon arrival, some neuroblasts exhibit markers of striatal neurons (9Zhang R.L. Zhang Z.G. Zhang L. Chopp M. Neuroscience. 2001; 105: 33-41Crossref PubMed Scopus (532) Google Scholar, 10Jin K. Minami M. Lan J.Q. Mao X.O. Batteur S. Simon R.P. Greenberg D.A. Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 4710-4715Crossref PubMed Scopus (1006) Google Scholar, 15Yamashita T. Ninomiya M. Hernández A.P. García-Verdugo J.M. Sunabori T. Sakaguchi M. Adachi K. Kojima T. Hirota Y. Kawase T. Araki N Abe K. Okano H. Sawamoto K. J. Neurosci. 2006; 26: 6627-6636Crossref PubMed Scopus (613) Google Scholar). However, the molecules that mediate stroke-induced neurogenesis have not been fully investigated. subventricular zone angiopoietin 2 recombinant human ANG2 glial fibrillary acidic protein small interference RNA chromatin immunoprecipitation CCAAT/enhancer-binding protein matrix metalloproteinase middle cerebral artery occlusion laser capture microdissection bone morphogenetic protein 2 bromodeoxyuridine reverse transcription bromodeoxyuridine. subventricular zone angiopoietin 2 recombinant human ANG2 glial fibrillary acidic protein small interference RNA chromatin immunoprecipitation CCAAT/enhancer-binding protein matrix metalloproteinase middle cerebral artery occlusion laser capture microdissection bone morphogenetic protein 2 bromodeoxyuridine reverse transcription bromodeoxyuridine. The angiopoietins, including angiopoietin 1 (ANG1) and angiopoietin 2 are a family of structurally related proteins that bind with similar specificity and affinity to a common endothelial cell-specific receptor-tyrosine kinase (Tie2) (16Davis S. Aldrich T.H. Jones P.F. Acheson A. Compton D.L. Jain V. Ryan T.E. Bruno J. Radziejewski C. Maisonpierre P.C. Yancopoulos G.D. Cell. 1996; 87: 1161-1169Abstract Full Text Full Text PDF PubMed Scopus (1685) Google Scholar). ANG1 and ANG2/Tie2 signaling play important roles in the angiogenic process and hematopoiesis (17Hu B. Jarzynka M.J. Guo P. Imanishi Y. Schlaepfer D.D. Cheng S.Y. Cancer Res. 2006; 66: 775-783Crossref PubMed Scopus (144) Google Scholar, 18Imanishi Y. Hu B. Jarzynka M.J. Guo P. Elishaev E. Bar-Joseph I. Cheng S.Y. Cancer Res. 2007; 67: 4254-4263Crossref PubMed Scopus (158) Google Scholar). The function of ANG2 is context-dependent. When acting in the absence of angiogenic inducers (such as vascular endothelial growth factor), ANG2 induced endothelial cell apoptosis with consequent vascular regression (19Lobov I.B. Brooks P.C. Lang R.A. Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 11205-11210Crossref PubMed Scopus (574) Google Scholar). When acting in concert with vascular endothelial growth factor, ANG2 may stimulate endothelial cell migration and proliferation, thus serving as a permissive angiogenic signal (19Lobov I.B. Brooks P.C. Lang R.A. Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 11205-11210Crossref PubMed Scopus (574) Google Scholar, 20Zhu Y. Lee C. Shen F. Du R. Young W.L. Yang G.Y. Stroke. 2005; 36: 1533-1537Crossref PubMed Scopus (96) Google Scholar). ANG2 is also a critical effector of hypoxia-induced neovasculature and is involved in cerebral angiogenesis in the ischemic brain (21Zhang Z.G. Zhang L. Tsang W. Soltanian-Zadeh H. Morris D. Zhang R. Goussev A. Powers C. Yeich T. Chopp M. J. Cereb. Blood Flow Metab. 2002; 22: 379-392Crossref PubMed Scopus (370) Google Scholar, 22Lin T.N. Wang C.K. Cheung W.M. Hsu C.Y. J. Cereb. Blood Flow Metab. 2000; 20: 387-395Crossref PubMed Scopus (131) Google Scholar, 23Beck H. Acker T. Wiessner C. Allegrini P.R. Plate K.H. Am J. Pathol. 2000; 157: 1473-1483Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar, 24Wang R.G. Zhu X.Z. Acta Pharmacol. Sin. 2002; 23: 405-411PubMed Google Scholar). Emerging evidence indicates that angiogenesis is coupled with neurogenesis under physiological and pathophysiological conditions (25Ohab J.J. Fleming S. Blesch A. Carmichael S.T. J. Neurosci. 2006; 26: 13007-13016Crossref PubMed Scopus (725) Google Scholar, 26Liu X.S. Zhang Z.G. Zhang R.L. Gregg S. Morris D.C. Wang Y. Chopp M. J. Cereb. Blood Flow Metab. 2007; 27: 564-574Crossref PubMed Scopus (100) Google Scholar, 27Sun Y. Jin K. Xie L. Childs J. Mao X.O. Logvinova A. Greenberg D.A. J. Clin. Invest. 2003; 111: 1843-1851Crossref PubMed Scopus (1026) Google Scholar, 28Thored P. Wood J. Arvidsson A. Cammenga J. Kokaia Z. Lindvall O. Stroke. 2007; 38: 3032-3039Crossref PubMed Scopus (340) Google Scholar, 29Teng H. Zhang Z.G. Wang L. Zhang R.L. Zhang L. Morris D. Gregg S.R. Wu Z. Jiang A. Lu M. Zlokovic B.V. Chopp M. J. Cereb. Blood Flow Metab. 2008; 28: 764-771Crossref PubMed Scopus (199) Google Scholar, 30Chopp M. Zhang Z.G. Jiang Q. Stroke. 2007; 38 (Suppl. 2): 827-831Crossref PubMed Scopus (172) Google Scholar, 31Tavazoie M. Van der Veken L. Silva-Vargas V. Louissaint M. Colonna L. Zaidi B. Garcia-Verdugo J.M. Doetsch F. Cell Stem Cell. 2008; 3: 279-288Abstract Full Text Full Text PDF PubMed Scopus (820) Google Scholar, 32Shen Q. Wang Y. Kokovay E. Lin G. Chuang S.M. Goderie S.K. Roysam B. Temple S. Cell Stem Cell. 2008; 3: 289-300Abstract Full Text Full Text PDF PubMed Scopus (823) Google Scholar). Neuroblasts in the SVZ could use cerebral blood vessels as a scaffold to migrate to the ischemic striatum (25Ohab J.J. Fleming S. Blesch A. Carmichael S.T. J. Neurosci. 2006; 26: 13007-13016Crossref PubMed Scopus (725) Google Scholar). Cerebral endothelial cells activated by stroke promote neural progenitor cell differentiation into neurons, whereas ischemic neural progenitor cells facilitate angiogenesis (29Teng H. Zhang Z.G. Wang L. Zhang R.L. Zhang L. Morris D. Gregg S.R. Wu Z. Jiang A. Lu M. Zlokovic B.V. Chopp M. J. Cereb. Blood Flow Metab. 2008; 28: 764-771Crossref PubMed Scopus (199) Google Scholar). Vascular endothelial growth factor mediates the coupling of angiogenesis and neurogenesis in ischemic brain (27Sun Y. Jin K. Xie L. Childs J. Mao X.O. Logvinova A. Greenberg D.A. J. Clin. Invest. 2003; 111: 1843-1851Crossref PubMed Scopus (1026) Google Scholar, 29Teng H. Zhang Z.G. Wang L. Zhang R.L. Zhang L. Morris D. Gregg S.R. Wu Z. Jiang A. Lu M. Zlokovic B.V. Chopp M. J. Cereb. Blood Flow Metab. 2008; 28: 764-771Crossref PubMed Scopus (199) Google Scholar). In addition to vascular endothelial growth factor, stroke up-regulates ANG2 expression in SVZ neural progenitor cells (26Liu X.S. Zhang Z.G. Zhang R.L. Gregg S. Morris D.C. Wang Y. Chopp M. J. Cereb. Blood Flow Metab. 2007; 27: 564-574Crossref PubMed Scopus (100) Google Scholar). In the present study we investigated the effect of ANG2 on differentiation and migration of adult SVZ progenitor cells. There is no single marker to identify SVZ stem cells in the adult rodent brain. Therefore, in the present study the term “neural progenitor cells” was used to describe dividing cells with capacity for differentiation. Adult male mice (C57B/6J, 20–30 g) were employed in this study. Permanent right middle cerebral artery occlusion (MCAo) was induced by advancing a 6–0 surgical nylon suture (8.0–9.0 mm, determined by body weight) with an expanded tip from the external carotid artery into the lumen of the internal carotid artery to block the origin of the middle cerebral artery (33Mao Y. Yang G.Y. Zhou L.F. Stern J.D. Betz A.L. Brain Res. Mol. Brain Res. 1999; 63: 366-370Crossref PubMed Scopus (43) Google Scholar). SVZ cells were dissociated from adult mice, as previously reported (1Reynolds B.A. Weiss S. Science. 1992; 255: 1707-1710Crossref PubMed Scopus (4545) Google Scholar, 6Morshead C.M. Reynolds B.A. Craig C.G. McBurney M.W. Staines W.A. Morassutti D. Weiss S. van der Kooy D. Neuron. 1994; 13: 1071-1082Abstract Full Text PDF PubMed Scopus (1216) Google Scholar, 34Wang L. Zhang Z.G. Zhang R.L. Jiao Z.X. Wang Y. Pourabdollah-Nejad D.S. LeTourneau Y. Gregg S.R. Chopp M. J. Cereb. Blood Flow Metab. 2006; 26: 556-564Crossref PubMed Scopus (53) Google Scholar). The cells were plated at a density of 2 × 104 cells/ml in growth medium. Growth medium contains Dulbecco's modified Eagle's medium/F-12 medium (Invitrogen), 20 ng/ml epidermal growth factor (R&D Systems, Minneapolis, MN), and basic fibroblast growth factor (R&D Systems). Dulbecco's modified Eagle's medium/F-12 medium contains l-glutamine (2 mmol/liter), glucose (0.6%), putrescine (9.6 mg/ml), insulin (0.025 mg/ml), progesterone (6.3 ng/ml), apotransferrin (0.1 mg/ml), and sodium selenite (5.2 ng/ml). The generated neurospheres (primary spheres) were passaged by mechanical dissociation and reseeded as single cells at a density of 20 cells/μl. SVZ cells from ischemic brain were extracted 7 days after MCAo, a peak time of increase of neurogenesis (9Zhang R.L. Zhang Z.G. Zhang L. Chopp M. Neuroscience. 2001; 105: 33-41Crossref PubMed Scopus (532) Google Scholar, 13Zhang R. Zhang Z. Wang L. Wang Y. Gousev A. Zhang L. Ho K.L. Morshead C. Chopp M. J. Cereb. Blood Flow Metab. 2004; 24: 441-448Crossref PubMed Scopus (350) Google Scholar). SVZ cells used in all experiments were from passages 2–5. Briefly, frozen brain coronal sections stored at −80 °C were immediately immersed in acetone for 2 min of fixation and air-dried for 30 s. After a brief rinse with 0.1% diethylpyrocarbonate-treated phosphate-buffered saline, sections were stained with propidium iodide dye (1:3000 dilution, Sigma) for 5 min, rinsed with phosphate-buffered saline twice, and dehydrated in graded alcohols (75, 90, and 100% ethanol, 30 s each) and xylene for clearance for 5 min (26Liu X.S. Zhang Z.G. Zhang R.L. Gregg S. Morris D.C. Wang Y. Chopp M. J. Cereb. Blood Flow Metab. 2007; 27: 564-574Crossref PubMed Scopus (100) Google Scholar). All reaction steps were performed in RNase-free solutions. Sections were then air-dried under laminar flow for 10 min and immediately used for LCM. Dense SVZ cells on sections stained by propidium iodide were readily distinct from the ependymal cells that have cilia along the lateral wall of the lateral ventricle and from the adjacent striatal cells (35Chiasson B.J. Tropepe V. Morshead C.M. van der Kooy D. J. Neurosci. 1999; 19: 4462-4471Crossref PubMed Google Scholar). In the non-ischemic mouse, the dorsal and ventral SVZ of the lateral wall was defined as a 20–30-μm-wide zone approximately of 2–3 cell bodies immediately adjacent to ependymal cells, whereas in the ischemic mouse, the SVZ was expanded to a 60–80-μm-wide zone. Propidium iodide-positive cells within the SVZ were captured onto a thermoplastic film mounted on optically transparent LCM caps using the PixCell II LCM System (Arcturus Bioscience Inc., Mountain View, CA). The following parameters were used during LCM: 7.5-mm laser spot size, 60 milliwatts of power, and 750-ms duration. The transfer film was examined under the microscope to ensure cell lysis. Caps with cells were immediately placed into Eppendorf tubes containing 350 μl of lysis buffer and stored at −80 °C before RNA isolation. Approximately 1000 cells were isolated in the SVZ from each animal. Quantitative PCRs were performed using SYBR Green real-time PCR system. Total RNAs from cultured SVZ cells or LCM cells were extracted using Qiagen Mini kit or Qiagen Micro kit (Qiagen, Valencia, CA). cDNAs were prepared from total RNA using oligodT20, dNTP mix, first-strand buffer, dithiothreitol, RNaseOUT, and Superscript III (Invitrogen). Real-time RT-PCRs were performed on an ABI 7000 PCR instrument (Applied Biosystems, Foster City, CA). Amplicon sizes were confirmed using RT-PCR, as previously described (36Katakowski M. Zhang Z. deCarvalho A.C. Chopp M. Neurosci. Lett. 2005; 385: 204-209Crossref PubMed Scopus (42) Google Scholar). Each sample was tested in triplicate, and relative gene expression was determined using the 2−ΔΔCT method (37Livak K.J. Schmittgen T.D. Methods. 2001; 25: 402-408Crossref PubMed Scopus (123392) Google Scholar). Primers to amplify the following transcripts are as follows: β-actin forward primer, 5′-CCATCATGAAGTGTGACGTTG, and reverse primer, 5′-CAATGATCTTGATCTTCATGGTG (150 bp); ANG1 forward primer, 5′-GATCTTACACGGTGCCGATT, and reverse primer, 5′-TTAGATTGGAAGGGCCACAG (118 bp); ANG2 forward primer, 5′-TCCAAGAGCTCGGTTGCTAT, and reverse primer, 5′-AGTTGGGGAAGGTCAGTGTG (114 bp); Tie2 forward primer, 5′-AAGCATGCCCATCTGGTTAC, and reverse primer, 5′-GCCTGCCTTCTTTCTCACAC (138 bp); bone morphogenetic protein 2 (Bmp2) forward primer, 5′- GTCGAAGCTCTCCCACTGAC, and reverse primer 5′-CAGGAAGCTTTGGGAAACAG (150 bp); Bmp4 forward primer, 5′-CGTTACCTCAAGGGAGTGGA, and reverse primer, 5′-ATGCTTGGGACTACGTTTGG (116 bp); β-III tubulin forward primer, 5′-TGAGGCCTCCTCTCACAAGT, and reverse primer, 5′-GGCCTGAATAGGTGTCCAAA (105 bp); Bmp type I receptor B (Bmpr1b), forward primer, 5′-AGCGCTATATGCCTCCAGAA, and reverse primer, 5′-CTCCTTGCAATCTCCCAGAG (114 bp); Smad5 forward primer, 5′-CTCCAGCTCCTCCATAGCAC, and reverse primer, 5′-ATTGTTGGGCTGGAAACAAG (109 bp). The Oligo arrays (SABiosciences, Frederick, MD) were used, and hybridization procedures were performed as described by the manufacturer. The biotin dUTP-labeled cDNA probes were specifically generated in the presence of a designed set of gene-specific primers using total RNA and reverse transcriptase. The array filters were hybridized with biotin-labeled probes at 60 °C for 17 h. The filters were then washed twice with 2× saline sodium citrate buffer, 1% sodium dodecyl sulfate and twice with 0.1× saline sodium citrate, 1% sodium dodecyl sulfate at 60 °C for 15 min each. Chemiluminescent detection steps were performed by subsequent incubation of the filters with alkaline phosphatase-conjugated streptavidin and CDPStar substrate (SABiosciences). For quantification, intensity of spots was measured by GEArray Expression Analysis Suite software, and then the average intensities derived from blank spots were subtracted. Four random pictures from the bottom of each insert were acquired. These relative intensities were used to compare gene expression levels between control and ANG2 treatment groups. A ChIP assay was performed using the ChIP kit (Upstate, Charlottesville, VA). SVZ cells were cross-linked with 1% formaldehyde and sonicated to an average length of 200–500 bp. The chromatin solutions were precleared with the addition of Protein G beads for 2 h at 4 °C. The precleared chromatins were incubated with C/EBPβ antibody (2 μg, Santa Cruz Biotechnology, Inc. Santa Cruz, CA), normal IgG serum, or no antibody as a negative control overnight. The antibody/chromatin mixtures were precipitated with Protein G beads, and the beads were sequentially washed with ChIP wash buffer. Cross-linking was reversed by adding 4 μl of 5 m NaCl and incubating at 65 °C overnight. DNAs were purified by phenol/chloroform extraction and ethanol precipitation. The real-time PCR primers: forward primer, 5′-GCACCTGGGGTGAACTAAGA, and reverse primer, 5′-CCAAGGAGGAGGACAAAGAA (127 bp), were used to amplify the β-III tubulin promoter region flanking the C/EBPβ binding. Binding activities were calculated as the percentage of pre-immunoprecipitated input DNA. In situ gelatinolytic activity was performed on a single SVZ neurosphere using an 8-well chamber and DQ gelatin as a substrate (Molecular Probes, Eugene, OR) (38Mook O.R. Van Overbeek C. Ackema E.G. Van Maldegem F. Frederiks W.M. J. Histochem. Cytochem. 2003; 51: 821-829Crossref PubMed Scopus (85) Google Scholar, 39Snoek-van Beurden P.A. Von den Hoff J.W. Biotechniques. 2005; 38: 73-83Crossref PubMed Scopus (376) Google Scholar). DQ-gelatin was dissolved in a concentration of 1 mg/ml in water and then 1:10 diluted in 1% (w/v) low gelling temperature-agarose (Sigma) in phosphate-buffered saline. The mixture was put on top of the cells and covered with a coverslip. After gelling of the agar at 4 °C, the incubation was performed for 1 h at room temperature. Cleavage of DQ gelatin by MMPs resulted in a green fluorescent product (wavelengths: excitation, 495 nm; emission, 515 nm). Some SVZ neurospheres were incubated with GM601, a nonspecific inhibitor of MMP activity. Images were taken under a 63× objective of 2-photon laser confocal microscope (Carl Zeiss Inc.), and fluorescent density was compared in control and ANG2 treatment groups. siRNA against mouse Tie2 (sequences are provided in supplemental Data I), purchased from Dharmacon (Chicago, IL, catalog #M-045325-01) and siGLO (Dharmacon, catalog #D-001630-02), was used as the negative control. siRNAs were introduced into cells using a NucleofectorTM kit (Amaxa, Germany). Briefly, 200 pmol/well siRNAs were mixed with 100 μl of Nucleofector solution, and cell-DNA mixtures were transferred into a cuvette and electroporated using program A33. Total RNAs or proteins were extracted at 24 or 72 h after nucleofection for the following experiment. To examine the effects of ANG2 on SVZ cell proliferation, single cells at a density of 10 cells/μl were incubated in the growth medium for 7 days, and bromodeoxyuridine (BrdUrd, 30 μg/ml, Sigma) was added 18 h before the termination of incubation (34Wang L. Zhang Z.G. Zhang R.L. Jiao Z.X. Wang Y. Pourabdollah-Nejad D.S. LeTourneau Y. Gregg S.R. Chopp M. J. Cereb. Blood Flow Metab. 2006; 26: 556-564Crossref PubMed Scopus (53) Google Scholar). The percentage of BrdUrd-positive cells was measured. To examine the effects of ANG2 on SVZ cell differentiation, neurospheres were plated directly onto laminin-coated glass coverslips in Dulbecco's modified Eagle's medium/F-12 medium containing 2% fetal bovine serum, which is referred to as differentiation medium, in the presence of various concentrations of recombinant human ANG2 (rhANG2). Every 4 days, half of the medium was replaced with fresh medium. Incubation was terminated 10 days after plating, and immunostaining for neuronal and astrocyte markers was performed for evaluation of cell differentiation. To assay the migration of ANG2 treated cells, we employed a Matrigel assay that had been used for measurements of neural progenitor cell motility (40Liu X.S. Zhang Z.G. Zhang R.L. Gregg S.R. Wang L. Yier T. Chopp M. J. Neurosci Res. 2007; 85: 2120-2125Crossref PubMed Scopus (97) Google Scholar). Briefly, a single neurosphere was seeded in the Matrigel of 96-well plates for 48 h. Migration of cells out of the neurosphere was measured at 0 and 48 h after seeding. Single, double, and triple immunofluorescent staining was performed on brain coronal sections and cultured cells, as previously described (9Zhang R.L. Zhang Z.G. Zhang L. Chopp M. Neuroscience. 2001; 105: 33-41Crossref PubMed Scopus (532) Google Scholar, 13Zhang R. Zhang Z. Wang L. Wang Y. Gousev A. Zhang L. Ho K.L. Morshead C. Chopp M. J. Cereb. Blood Flow Metab. 2004; 24: 441-448Crossref PubMed Scopus (350) Google Scholar, 26Liu X.S. Zhang Z.G. Zhang R.L. Gregg S. Morris D.C. Wang Y. Chopp M. J. Cereb. Blood Flow Metab. 2007; 27: 564-574Crossref PubMed Scopus (100) Google Scholar, 34Wang L. Zhang Z.G. Zhang R.L. Jiao Z.X. Wang Y. Pourabdollah-Nejad D.S. LeTourneau Y. Gregg S.R. Chopp M. J. Cereb. Blood Flow Metab. 2006; 26: 556-564Crossref PubMed Scopus (53) Google Scholar, 40Liu X.S. Zhang Z.G. Zhang R.L. Gregg S.R. Wang L. Yier T. Chopp M. J. Neurosci Res. 2007; 85: 2120-2125Crossref PubMed Scopus (97) Google Scholar). The following primary antibodies were used in the present study: mouse anti-BrdUrd (1:100; Roche Applied Science), mouse anti-β-III tubulin (TuJ-1, 1:500; Covance the Development Services Co.), rabbit anti-glial fibrillary acidic protein (GFAP, 1:500; Dako Cytomation California Inc., Carpinteria, CA), rabbit anti-ANG2 (1:500, Abcam, Cambridge, MA), rabbit anti-ANG1 (1:500, Abcam), anti-mouse nestin (1:100, Pharmingen, San Jose, CA), goat anti-sox2 (1:100, Santa Cruz Biotechnology, Inc), goat anti-doublecortin (1:100, Santa Cruz Biotechnology, Inc). Cultured cells were fixed in 4% paraformaldehyde for 20 min at room temperature. Nonspecific binding sites were blocked with phosphate-buffered saline with 1% bovine serum albumin goat serum for 1 h at room temperature. The cells were then incubated with the primary antibodies listed above and with CY3 or fluorescein isothiocyanate-conjugated secondary antibodies. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (1:10,000, Vector Laboratories, Burlingame, CA). Measurements of ANG2 immunoreactive cells were performed on five coronal sections per mouse subjected to 7 days after MCAo (34Wang L. Zhang Z.G. Zhang R.L. Jiao Z.X. Wang Y. Pourabdollah-Nejad D.S. LeTourneau Y. Gregg S.R. Chopp M. J. Cereb. Blood Flow Metab. 2006; 26: 556-564Crossref PubMed Scopus (53) Google Scholar). ANG2-positive areas in the ipsilateral SVZ were digitized under a 20× objective (Olympus BX40) with use of a 3-CCD color video camera (Sony DXC-970MD) interfaced with an MCID image analysis system (Imaging Research, St. Catharines, Ontario, Canada). ANG2 immunoreactive areas within the SVZ were determined by setting a threshold to distinguish signals from the background based on the original images. The data are presented as a percentage of positive immunoreactive area in the SVZ. For cultured cells, eight fields per well were randomly selected. The number of BrdUrd-, TuJ1-, and GFAP-positive cells as well as total 4′,6-diamidino-2-phenylindole nuclei was counted under a 40× objective (IX71; Olympus Optical, Tokyo, Japan), and the percentage of each cell type was determined. One-way analysis of variance or the Student-Newman-Keuls test was applied for multiple or two group comparisons, respectively. To analyze the effect of GM6001 on gelatinase activity in the absence or the presence of rhANG2, we designed a method. By assuming a treatment factor (T), rhANG2 (absence or presence), and a blocker factor (B), GM6001 (absence or presence) in which each has two levels (0, 1), response variable (changes of fluorescence, yij), and expected value of yij (μij), E(yij) = μij with indexes of rhANG2 treatment (i) and GM6001 (j). We used the complete 2 × 2 factorial design and two-way analysis of variance to analyze the effect of rhANG2 on MMP signals detected by in situ zymography. The analysis began with testing for T by B interaction using PROC MIXED in SAS with a contract statement, L = (μ11 − μ01) − (μ10 − μ00), followed by evaluating additive or sub-additive effects of the two factors of treatment and condition. The sub-additive effects would be identified if L<0 or (μ11 − μ01) − (μ10 − μ00), indicating that the rhANG2 treatment effect is greatly reduced in the presence of GM6001 compared with the rhANG2 treatment effect in the absence of GM6001. The data are presented as means ± S.D. A value of p < 0.05 was taken as significant. To analyze the effects of stroke on ANG expression in neural progenitor cells, SVZ cells from non-ischemic mice or mice subjected to 7 days after MCAo were isolated using LCM. Real-time RT-PCR analysis revealed that SVZ cells expressed ANG2 under non-ischemic conditions (Fig. 1A). However, mRNA levels of" @default.
• W1978597908 created "2016-06-24" @default.
• W1978597908 creator A5005508444 @default.
• W1978597908 creator A5020019194 @default.
• W1978597908 creator A5032814094 @default.
• W1978597908 creator A5032985983 @default.
• W1978597908 creator A5060565149 @default.
• W1978597908 creator A5074573138 @default.
• W1978597908 creator A5080959797 @default.
• W1978597908 creator A5091841617 @default.
• W1978597908 date "2009-08-01" @default.
• W1978597908 modified "2023-09-29" @default.
• W1978597908 title "Angiopoietin 2 Mediates the Differentiation and Migration of Neural Progenitor Cells in the Subventricular Zone after Stroke" @default.
• W1978597908 cites W1542222934 @default.
• W1978597908 cites W1859730138 @default.
• W1978597908 cites W1963765937 @default.
• W1978597908 cites W1969205319 @default.
• W1978597908 cites W1969225564 @default.
• W1978597908 cites W1969684909 @default.
• W1978597908 cites W1970614272 @default.
• W1978597908 cites W1973724609 @default.
• W1978597908 cites W1975667834 @default.
• W1978597908 cites W1976019207 @default.
• W1978597908 cites W1982850249 @default.
• W1978597908 cites W1983089266 @default.
• W1978597908 cites W1983725263 @default.
• W1978597908 cites W1986469118 @default.
• W1978597908 cites W1989375959 @default.
• W1978597908 cites W1993540495 @default.
• W1978597908 cites W1997801266 @default.
• W1978597908 cites W2013979525 @default.
• W1978597908 cites W2019839655 @default.
• W1978597908 cites W2022139382 @default.
• W1978597908 cites W2025201512 @default.
• W1978597908 cites W2026990513 @default.
• W1978597908 cites W2030508161 @default.
• W1978597908 cites W2031683488 @default.
• W1978597908 cites W2032430815 @default.
• W1978597908 cites W2035222904 @default.
• W1978597908 cites W2037914328 @default.
• W1978597908 cites W2042350316 @default.
• W1978597908 cites W2046006021 @default.
• W1978597908 cites W2047647123 @default.
• W1978597908 cites W2054957750 @default.
• W1978597908 cites W2061705828 @default.
• W1978597908 cites W2062253564 @default.
• W1978597908 cites W2065268256 @default.
• W1978597908 cites W2070306500 @default.
• W1978597908 cites W2073221687 @default.
• W1978597908 cites W2075317738 @default.
• W1978597908 cites W2079356804 @default.
• W1978597908 cites W2079365338 @default.
• W1978597908 cites W2083628520 @default.
• W1978597908 cites W2086435807 @default.
• W1978597908 cites W2087486104 @default.
• W1978597908 cites W2088525524 @default.
• W1978597908 cites W2095885953 @default.
• W1978597908 cites W2097901004 @default.
• W1978597908 cites W2107277218 @default.
• W1978597908 cites W2108340830 @default.
• W1978597908 cites W2109503237 @default.
• W1978597908 cites W2113920157 @default.
• W1978597908 cites W2113992254 @default.
• W1978597908 cites W2115566079 @default.
• W1978597908 cites W2117980967 @default.
• W1978597908 cites W2118377972 @default.
• W1978597908 cites W2119562338 @default.
• W1978597908 cites W2120733119 @default.
• W1978597908 cites W2129974396 @default.
• W1978597908 cites W2132367339 @default.
• W1978597908 cites W2134717451 @default.
• W1978597908 cites W2136751299 @default.
• W1978597908 cites W2139878605 @default.
• W1978597908 cites W2148443137 @default.
• W1978597908 cites W2152215024 @default.
• W1978597908 cites W2154104720 @default.
• W1978597908 cites W2164316007 @default.
• W1978597908 cites W2165530871 @default.
• W1978597908 cites W2165867905 @default.
• W1978597908 cites W2168272960 @default.
• W1978597908 cites W2170045306 @default.
• W1978597908 cites W2170883020 @default.
• W1978597908 cites W4254868516 @default.
• W1978597908 doi "https://doi.org/10.1074/jbc.m109.006551" @default.
• W1978597908 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2755676" @default.
• W1978597908 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19553662" @default.
• W1978597908 hasPublicationYear "2009" @default.
• W1978597908 type Work @default.
• W1978597908 sameAs 1978597908 @default.
• W1978597908 citedByCount "92" @default.
• W1978597908 countsByYear W19785979082012 @default.
• W1978597908 countsByYear W19785979082013 @default.
• W1978597908 countsByYear W19785979082014 @default.
• W1978597908 countsByYear W19785979082015 @default.
• W1978597908 countsByYear W19785979082016 @default.
• W1978597908 countsByYear W19785979082017 @default.
• W1978597908 countsByYear W19785979082018 @default.
• W1978597908 countsByYear W19785979082019 @default.

• next