FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1978939437> ?p ?o ?g. }

• W1978939437 endingPage "1300" @default.
• W1978939437 startingPage "1292" @default.
• W1978939437 abstract "Although the trimming of α1,2-mannose residues from precursor N-linked oligosaccharides is an essential step in the delivery of misfolded glycoproteins to endoplasmic reticulum (ER)-associated degradation (ERAD), the exact role of this trimming is unclear. EDEM1 was initially suggested to bind N-glycans after mannose trimming, a role presently ascribed to the lectins OS9 and XTP3-B, because of their in vitro affinities for trimmed oligosaccharides. We have shown before that ER mannosidase I (ERManI) is required for the trimming and concentrates together with the ERAD substrate and ERAD machinery in the pericentriolar ER-derived quality control compartment (ERQC). Inhibition of mannose trimming prevents substrate accumulation in the ERQC. Here, we show that the mannosidase inhibitor kifunensine or ERManI knockdown do not affect binding of an ERAD substrate glycoprotein to EDEM1. In contrast, substrate association with XTP3-B and with the E3 ubiquitin ligases HRD1 and SCFFbs2 was inhibited. Consistently, whereas the ERAD substrate partially colocalized upon proteasomal inhibition with EDEM1, HRD1, and Fbs2 at the ERQC, colocalization was repressed by mannosidase inhibition in the case of the E3 ligases but not for EDEM1. Interestingly, association and colocalization of the substrate with Derlin-1 was independent of mannose trimming. The HRD1 adaptor protein SEL1L had been suggested to play a role in N-glycan-dependent substrate delivery to OS9 and XTP3-B. However, substrate association with XTP3-B was still dependent on mannose trimming upon SEL1L knockdown. Our results suggest that mannose trimming enables delivery of a substrate glycoprotein from EDEM1 to late ERAD steps through association with XTP3-B. Although the trimming of α1,2-mannose residues from precursor N-linked oligosaccharides is an essential step in the delivery of misfolded glycoproteins to endoplasmic reticulum (ER)-associated degradation (ERAD), the exact role of this trimming is unclear. EDEM1 was initially suggested to bind N-glycans after mannose trimming, a role presently ascribed to the lectins OS9 and XTP3-B, because of their in vitro affinities for trimmed oligosaccharides. We have shown before that ER mannosidase I (ERManI) is required for the trimming and concentrates together with the ERAD substrate and ERAD machinery in the pericentriolar ER-derived quality control compartment (ERQC). Inhibition of mannose trimming prevents substrate accumulation in the ERQC. Here, we show that the mannosidase inhibitor kifunensine or ERManI knockdown do not affect binding of an ERAD substrate glycoprotein to EDEM1. In contrast, substrate association with XTP3-B and with the E3 ubiquitin ligases HRD1 and SCFFbs2 was inhibited. Consistently, whereas the ERAD substrate partially colocalized upon proteasomal inhibition with EDEM1, HRD1, and Fbs2 at the ERQC, colocalization was repressed by mannosidase inhibition in the case of the E3 ligases but not for EDEM1. Interestingly, association and colocalization of the substrate with Derlin-1 was independent of mannose trimming. The HRD1 adaptor protein SEL1L had been suggested to play a role in N-glycan-dependent substrate delivery to OS9 and XTP3-B. However, substrate association with XTP3-B was still dependent on mannose trimming upon SEL1L knockdown. Our results suggest that mannose trimming enables delivery of a substrate glycoprotein from EDEM1 to late ERAD steps through association with XTP3-B. During their translocation into the ER, 3The abbreviations used are: ER, endoplasmic reticulum; ERAD, ER-associated degradation; ERQC, ER-derived quality control compartment; ERManI, ER mannosidase I; Lac, lactacystin; Kif, kifunensine; RFP, red fluorescent protein; SBP, streptavidin binding peptide. most polypeptides acquire N-linked glycans, and the cell attempts to fold them to their native state with the help of several resident chaperones (1Aebi M. Bernasconi R. Clerc S. Molinari M. Trends Biochem. Sci. 2010; 35: 74-82Abstract Full Text Full Text PDF PubMed Scopus (350) Google Scholar, 2Hebert D.N. Bernasconi R. Molinari M. Semin. Cell Dev. Biol. 2010; 21: 526-532Crossref PubMed Scopus (92) Google Scholar, 3Lederkremer G.Z. Curr. Opin. Struct. Biol. 2009; 19: 515-523Crossref PubMed Scopus (173) Google Scholar). Calnexin and calreticulin will bind to the sugar chains if they possess only one terminal glucose residue that remains from the original precursor or after its readdition by the folding sensor UDP-Glc: glycoprotein glucosyltransferase (4D'Alessio C. Caramelo J.J. Parodi A.J. Semin. Cell Dev. Biol. 2010; 21: 491-499Crossref PubMed Scopus (124) Google Scholar, 5Määttänen P. Gehring K. Bergeron J.J. Thomas D.Y. Semin. Cell Dev. Biol. 2010; 21: 500-511Crossref PubMed Scopus (203) Google Scholar). If proper folding cannot be achieved in a certain time frame, the glycoprotein molecules are targeted to ERAD by retrotranslocation to the cytosol and degradation by the ubiquitin-proteasome pathway. The decision to send a glycoprotein molecule to ERAD involves differential processing of its sugar chains (6Frenkel Z. Gregory W. Kornfeld S. Lederkremer G.Z. J. Biol. Chem. 2003; 278: 34119-34124Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar, 7Lederkremer G.Z. Glickman M.H. Trends Biochem. Sci. 2005; 30: 297-303Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Three or four mannose residues are excised from misfolded molecules and only one or two from folded molecules that exit to the Golgi. Although it is well established that this trimming of mannose residues is essential for delivery to ERAD (1Aebi M. Bernasconi R. Clerc S. Molinari M. Trends Biochem. Sci. 2010; 35: 74-82Abstract Full Text Full Text PDF PubMed Scopus (350) Google Scholar, 2Hebert D.N. Bernasconi R. Molinari M. Semin. Cell Dev. Biol. 2010; 21: 526-532Crossref PubMed Scopus (92) Google Scholar, 3Lederkremer G.Z. Curr. Opin. Struct. Biol. 2009; 19: 515-523Crossref PubMed Scopus (173) Google Scholar), it is still unclear what events are regulated by this process. Recent studies on affinity of early secretory pathway lectins in vitro show that OS9 binds only after the trimming and cannot bind untrimmed Man9GlcNAc2 or Man8BGlcNAc2 (8Hosokawa N. Kamiya Y. Kamiya D. Kato K. Nagata K. J. Biol. Chem. 2009; 284: 17061-17068Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar, 9Hosokawa N. Kamiya Y. Kato K. Glycobiology. 2010; 20: 651-660Crossref PubMed Scopus (64) Google Scholar, 10Quan E.M. Kamiya Y. Kamiya D. Denic V. Weibezahn J. Kato K. Weissman J.S. Mol. Cell. 2008; 32: 870-877Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). The same is true for the OS9 functional homolog XTP3-B (11Yamaguchi D. Hu D. Matsumoto N. Yamamoto K. Glycobiology. 2010; 20: 348-355Crossref PubMed Scopus (39) Google Scholar). Conversely, lectins that support trafficking from the ER to the Golgi (ERGIC53, VIP36, VIPL) cannot bind the trimmed Man5GlcNAc2 and associate with higher affinity with untrimmed molecules (12Kamiya Y. Kamiya D. Yamamoto K. Nyfeler B. Hauri H.P. Kato K. J. Biol. Chem. 2008; 283: 1857-1861Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). This suggests a model whereby extensive excision of mannose residues has a triple function: removal of the glycoprotein from the calnexin cycle (because the acceptor mannose for reglucosylation is lost), prevention of its binding to ER-Golgi lectins, and delivery to OS9 or XTP3-B. OS9 and XTP3-B would thus be the lectin-acceptors for the trimmed glycoprotein ERAD substrates, although evidence for this exists in vivo only for OS9 (8Hosokawa N. Kamiya Y. Kamiya D. Kato K. Nagata K. J. Biol. Chem. 2009; 284: 17061-17068Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar). This role was initially proposed for the ERAD-enhancing factor EDEM1 (ER degradation enhancing mannose-like protein 1) (13Hosokawa N. Wada I. Hasegawa K. Yorihuzi T. Tremblay L.O. Herscovics A. Nagata K. EMBO Rep. 2001; 2: 415-422Crossref PubMed Scopus (380) Google Scholar, 14Jakob C.A. Bodmer D. Spirig U. Battig P. Marcil A. Dignard D. Bergeron J.J. Thomas D.Y. Aebi M. EMBO Rep. 2001; 2: 423-430Crossref PubMed Scopus (218) Google Scholar), a protein implicated in accepting misfolded substrates released from the calnexin cycle. EDEM1 has a mannosidase-like domain, but a mannosidase activity has not been found yet in vitro, although it accelerates directly or indirectly trimming of mannose residues in vivo (15Hosokawa N. Tremblay L.O. Sleno B. Kamiya Y. Wada I. Nagata K. Kato K. Herscovics A. Glycobiology. 2010; 20: 567-575Crossref PubMed Scopus (99) Google Scholar, 16Olivari S. Molinari M. FEBS Lett. 2007; 581: 3658-3664Crossref PubMed Scopus (105) Google Scholar). We previously demonstrated that trimming of mannose residues is an obligatory step for ERAD substrate accumulation in the ER quality control compartment (ERQC) (6Frenkel Z. Gregory W. Kornfeld S. Lederkremer G.Z. J. Biol. Chem. 2003; 278: 34119-34124Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar, 17Avezov E. Frenkel Z. Ehrlich M. Herscovics A. Lederkremer G.Z. Mol. Biol. Cell. 2008; 19: 216-225Crossref PubMed Scopus (113) Google Scholar), a proposed staging ground for ERAD (18Kamhi-Nesher S. Shenkman M. Tolchinsky S. Fromm S.V. Ehrlich R. Lederkremer G.Z. Mol. Biol. Cell. 2001; 12: 1711-1723Crossref PubMed Scopus (166) Google Scholar, 19Kondratyev M. Avezov E. Shenkman M. Groisman B. Lederkremer G.Z. Exp. Cell Res. 2007; 313: 3395-3407Crossref PubMed Scopus (59) Google Scholar). The association of XTP3-B and OS9 with ERAD components (5Määttänen P. Gehring K. Bergeron J.J. Thomas D.Y. Semin. Cell Dev. Biol. 2010; 21: 500-511Crossref PubMed Scopus (203) Google Scholar, 9Hosokawa N. Kamiya Y. Kato K. Glycobiology. 2010; 20: 651-660Crossref PubMed Scopus (64) Google Scholar) that are recruited to the ERQC (19Kondratyev M. Avezov E. Shenkman M. Groisman B. Lederkremer G.Z. Exp. Cell Res. 2007; 313: 3395-3407Crossref PubMed Scopus (59) Google Scholar) and the affinity of these lectins for trimmed sugar chains would suggest that the substrate glycoprotein becomes trapped in the ERQC after trimming. Here, we elucidate steps that require mannose trimming in the targeting of a glycoprotein substrate to ERAD in mammalian cells in vivo. We analyzed the effect of mannose trimming inhibition on association of EDEM1 and downstream ERAD factors with the substrate and the effect on the subcellular localization of these factors in relation to the substrate. We used as a model an established ERAD substrate, the uncleaved precursor of asialoglycoprotein receptor H2a (20Shenkman M. Ayalon M. Lederkremer G.Z. Proc. Natl. Acad. Sci. U.S.A. 1997; 94: 11363-11368Crossref PubMed Scopus (34) Google Scholar, 21Frenkel Z. Shenkman M. Kondratyev M. Lederkremer G.Z. Mol. Biol. Cell. 2004; 15: 2133-2142Crossref PubMed Scopus (47) Google Scholar). The precursor of H2a is a type 2 membrane glycoprotein that is expressed endogenously only in hepatocytes and is cleaved next to the transmembrane domain, and its ectodomain is secreted (22Tolchinsky S. Yuk M.H. Ayalon M. Lodish H.F. Lederkremer G.Z. J. Biol. Chem. 1996; 271: 14496-14503Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). When expressed in other cell types, most H2a precursor molecules remain uncleaved and are targeted to ERAD (18Kamhi-Nesher S. Shenkman M. Tolchinsky S. Fromm S.V. Ehrlich R. Lederkremer G.Z. Mol. Biol. Cell. 2001; 12: 1711-1723Crossref PubMed Scopus (166) Google Scholar, 20Shenkman M. Ayalon M. Lederkremer G.Z. Proc. Natl. Acad. Sci. U.S.A. 1997; 94: 11363-11368Crossref PubMed Scopus (34) Google Scholar). Our results suggest that association of EDEM1 with the substrate does not require ERManI and the mannose-trimming event. In contrast, this trimming is essential for association with XTP3-B, substrate sequestration in the ERQC, and delivery to the E3 ubiquitin ligases HRD1 and SCFFbs2. Rainbow 14C-labeled methylated protein standards were obtained from GE Healthcare. Promix cell labeling mix ([35S]Met plus [35S]Cys) >1000 Ci/mmol was from PerkinElmer Life Sciences. Protein A-Sepharose was from Repligen (Needham, MA). Lactacystin (Lac) and kifunensine (Kif) were from Cayman Chemicals (Ann Arbor, MI). Streptavidin-agarose-conjugated beads and other common reagents were from Sigma. H2a was subcloned in pCDNA1 (Invitrogen) (18Kamhi-Nesher S. Shenkman M. Tolchinsky S. Fromm S.V. Ehrlich R. Lederkremer G.Z. Mol. Biol. Cell. 2001; 12: 1711-1723Crossref PubMed Scopus (166) Google Scholar). The pSUPER vector carrying a shRNA for human ERManI was described previously (17Avezov E. Frenkel Z. Ehrlich M. Herscovics A. Lederkremer G.Z. Mol. Biol. Cell. 2008; 19: 216-225Crossref PubMed Scopus (113) Google Scholar). pSUPER carrying shRNA for human SEL1L was a kind gift from R. Tyler and R. Kopito (Stanford University, Stanford, CA). An insert for pSUPER carrying shRNA for human EDEM1 was constructed as in Ref. 17Avezov E. Frenkel Z. Ehrlich M. Herscovics A. Lederkremer G.Z. Mol. Biol. Cell. 2008; 19: 216-225Crossref PubMed Scopus (113) Google Scholar using the target sequence AGATTCCACCGTCCAAGTC. EDEM1-HA was a kind gift from K. Nagata (Kyoto University). Mouse Fbs2 F box deletion mutant (Fbs2ΔF) cloned in pcDNA3-FLAG and human hsHRD1 RING finger mutant cloned in pcDNA3.1-Myc/His-A(−) vector were those used before (23Groisman B. Avezov E. Lederkremer G.Z. Isr. J. Chem. 2006; 46: 189-196Crossref Scopus (12) Google Scholar) and were kind gifts from Y. Yoshida (Tokyo Metropolitan Institute of Medical Science) and E. Wiertz (Leiden University), respectively. S-tagged XTP3-B was a kind gift of R. Tyler and R. Kopito. Constructs encoding H2a G78R uncleavable mutant (24Yuk M.H. Lodish H.F. J. Cell Biol. 1993; 123: 1735-1749Crossref PubMed Scopus (38) Google Scholar) fused through its C terminus to a 38-amino acid streptavidin binding peptide (H2aSBP) or to monomeric red fluorescent protein (H2aRFP) were described before (19Kondratyev M. Avezov E. Shenkman M. Groisman B. Lederkremer G.Z. Exp. Cell Res. 2007; 313: 3395-3407Crossref PubMed Scopus (59) Google Scholar, 23Groisman B. Avezov E. Lederkremer G.Z. Isr. J. Chem. 2006; 46: 189-196Crossref Scopus (12) Google Scholar). Total cell RNA was extracted with EZ-RNA kit (Biological Industries, Beit Haemek, Israel). ReddyMix (ABgene, Epsom, UK) was used for PCR. Reverse transcription was performed with a VersoTM cDNA kit (Thermo Fisher Scientific), using a mixture of random hexamer and anchored oligo(dT) primers. An aliquot (10%) of the RT product was used for PCR with the following primers: CCTTCAGTGAGTGGTTTGG and GTGGTCCATCTTGGCACTG for ERManI, CAATGAAGGAGAAGGAGAC and CAATGTGTCCCTCTGTTGTG for EDEM1, AAAGCCCTGGAGAGAGTG and TTCCACTGTTCATTCCTG for SEL1L, and CTTTTAACTCTGGTAAAGTGG and TTTTGGCTCCCCCCTGCAAAT for GAPDH. Rabbit polyclonal anti-H2 carboxyl-terminal and anti-H2 amino-terminal antibodies were the ones used in earlier studies (22Tolchinsky S. Yuk M.H. Ayalon M. Lodish H.F. Lederkremer G.Z. J. Biol. Chem. 1996; 271: 14496-14503Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar, 25Shenkman M. Ehrlich M. Lederkremer G.Z. J. Biol. Chem. 2000; 275: 2845-2851Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar). Rabbit polyclonal anti-Derlin-1 was a kind gift from Y. Ye (National Institutes of Health). Mouse monoclonal antibodies were as follows; anti-FLAG (M2) was from Sigma, anti-Myc from Cell Signaling (Beverly, MA), anti-HA from Sigma or Santa Cruz Biotechnology (Santa Cruz, CA) and an anti-S tag from Novagen (Gibbstown, NJ). Goat anti-rabbit IgG antibody conjugated to Cy2, goat anti-mouse IgG conjugated to FITC, and goat anti-rabbit and anti-mouse IgG conjugated to HRP were from Jackson ImmunoResearch Laboratories (West Grove, PA). Goat anti-mouse IgG conjugated to agarose was from Sigma. HEK 293 cells were grown in DMEM plus 10% FCS and NIH 3T3 cells in DMEM plus 10% new born calf serum. An HEK 293 stable cell line expressing H2aSBP was described previously (23Groisman B. Avezov E. Lederkremer G.Z. Isr. J. Chem. 2006; 46: 189-196Crossref Scopus (12) Google Scholar). All cells were grown at 37 °C under an atmosphere of 5% CO2. Transient transfection of NIH 3T3 cells was performed using FuGENE 6TM reagent (Roche Applied Science) according to the kit protocol. Transient transfection of HEK 293 cells was done according to the calcium phosphate method. The experiments were performed 24–48 h after the transfection. Subconfluent (90%) cell monolayers in 60-mm dishes were labeled with [35S]Cys, lysed, and immunoprecipitated with anti-H2 antibodies as described previously (20Shenkman M. Ayalon M. Lederkremer G.Z. Proc. Natl. Acad. Sci. U.S.A. 1997; 94: 11363-11368Crossref PubMed Scopus (34) Google Scholar, 22Tolchinsky S. Yuk M.H. Ayalon M. Lodish H.F. Lederkremer G.Z. J. Biol. Chem. 1996; 271: 14496-14503Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Kif (100 μm) was added to cells 2 h before the labeling, and it was also present during starvation, labeling, and chase periods. Reducing SDS-PAGE was performed on 10% or 12% Laemmli gels. The gels were analyzed by fluorography using 20% 2,5-diphenyloxazole and were exposed to Biomax MS film using a BioMax TranScreen LE from Kodak (Vancouver, BC). Quantitation was performed in a Fujifilm FLA 5100 phosphorimaging device (Japan). Cell lysis and immunoprecipitation of H2a and related constructs was done as described previously (20Shenkman M. Ayalon M. Lederkremer G.Z. Proc. Natl. Acad. Sci. U.S.A. 1997; 94: 11363-11368Crossref PubMed Scopus (34) Google Scholar), except that an anti-H2a N-terminal antibody was used. Cell lysis was performed in the presence of 2 mm PMSF and 5 μg/ml aprotinin. For precipitation of SBP cell lysis was done in 1%Nonidet P-40, 50 mm Tris/HCl (pH 8), 150 mm NaCl for 30 min on ice, and debris and nuclei were pelleted in a microfuge for 30 min at 4 °C. The samples were immunoprecipitated with streptavidin-agarose-conjugated beads or an appropriate antisera and protein A-agarose. For immunoprecipitation with an anti-HA monoclonal antibody, whole goat anti-mouse IgG antibody immobilized on agarose beads was used. After overnight precipitation, the beads were washed three times with lysis buffer, followed by elution of the bound proteins by boiling with sample buffer containing β-mercaptoethanol at 100 °C for 5 min. Immunoblotting and detection by ECL were done as described previously (18Kamhi-Nesher S. Shenkman M. Tolchinsky S. Fromm S.V. Ehrlich R. Lederkremer G.Z. Mol. Biol. Cell. 2001; 12: 1711-1723Crossref PubMed Scopus (166) Google Scholar), except for exposure and quantitation in a Bio-Rad ChemiDocXRS Imaging System. The procedures employed were as described previously (17Avezov E. Frenkel Z. Ehrlich M. Herscovics A. Lederkremer G.Z. Mol. Biol. Cell. 2008; 19: 216-225Crossref PubMed Scopus (113) Google Scholar, 18Kamhi-Nesher S. Shenkman M. Tolchinsky S. Fromm S.V. Ehrlich R. Lederkremer G.Z. Mol. Biol. Cell. 2001; 12: 1711-1723Crossref PubMed Scopus (166) Google Scholar). Whereas for biochemical experiments HEK 293 cells were used for high transfection efficiency, the imaging experiments were done using NIH 3T3 cells for optimal subcellular structure resolution. For treatments with Lac (25 μm) or Kif (100 μm) cells on coverslips were incubated with medium containing the drug at 37 °C in a CO2 incubator for 3–5 h. Confocal microscopy was done on a Zeiss laser scanning confocal microscope (LSM 510; Carl Zeiss, Jena, Germany) as described previously (17Avezov E. Frenkel Z. Ehrlich M. Herscovics A. Lederkremer G.Z. Mol. Biol. Cell. 2008; 19: 216-225Crossref PubMed Scopus (113) Google Scholar). Colocalization analysis (Pearson) was done using ImageJ software. We had previously shown that degradation of asialoglycoprotein receptor H2a is strongly dependent on trimming of mannose residues (17Avezov E. Frenkel Z. Ehrlich M. Herscovics A. Lederkremer G.Z. Mol. Biol. Cell. 2008; 19: 216-225Crossref PubMed Scopus (113) Google Scholar, 26Ayalon-Soffer M. Shenkman M. Lederkremer G.Z. J. Cell Sci. 1999; 112: 3309-3318Crossref PubMed Google Scholar). This can be seen in Fig. 1A, that shows the result of a pulse-chase experiment, where the H2a precursor was much stabilized in the presence of the α1,2-mannosidase inhibitor Kif, leading also to an increased amount of the cleaved H2a ectodomain fragment. When mannose trimming is blocked, there is a typical shift to a slower migration of the ERAD substrate (Fig. 1A, lanes 3 and 4 compared with lanes 1 and 2). We tested the requirement of EDEM1 for ERAD of H2a. Anti-EDEM1 shRNA strongly inhibited the degradation of H2a, although it did not lead to a significant change in the migration (Fig. 1B, compare lanes 3 and 4 with 1 and 2 and the graph in Fig. 1D). In contrast, overexpression of EDEM1 accelerated the degradation (Fig. 1C, compare lanes 3 and 4 with 1 and 2, Fig. 1D) and also caused a 30% reduction in the level of the pulse-labeled H2a (Fig. 1C, compare lane 1 with lane 3), probably by reducing the initial lag in degradation (22Tolchinsky S. Yuk M.H. Ayalon M. Lodish H.F. Lederkremer G.Z. J. Biol. Chem. 1996; 271: 14496-14503Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Fig. 1E shows the efficiency of the EDEM1 knockdown. EDEM1 coimmunoprecipitated with H2a to a similar extent in the presence or absence of a proteasomal inhibitor (Lac) and also when inhibiting mannose trimming with Kif (Fig. 2A), similar to what had been observed with another ERAD substrate, Null Hong Kong mutant of α1-antitrypsin (27Cormier J.H. Tamura T. Sunryd J.C. Hebert D.N. Mol. Cell. 2009; 34: 627-633Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). We looked at the subcellular localization of EDEM1, which appeared in a somewhat punctate ER pattern (see Ref. 28Zuber C. Cormier J.H. Guhl B. Santimaria R. Hebert D.N. Roth J. Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 4407-4412Crossref PubMed Scopus (78) Google Scholar for a detailed analysis of EDEM1 localization), colocalizing partially with H2a linked to monomeric red fluorescent protein (H2aRFP) (Fig. 2B, upper panels). H2aRFP is an ERAD substrate (19Kondratyev M. Avezov E. Shenkman M. Groisman B. Lederkremer G.Z. Exp. Cell Res. 2007; 313: 3395-3407Crossref PubMed Scopus (59) Google Scholar) and similar to H2a, Kif inhibits its degradation and trimming of its mannose residues (Fig. 2D). Upon proteasomal inhibition, the ERAD substrate accumulates in the ERQC and colocalized to a much higher extent (2-fold) with EDEM1 (Fig. 2C), which partially redistributed to this juxtanuclear region (Fig. 2B, middle panels). Inhibition of mannose trimming causes the ERAD substrate to accumulate in a punctate pattern (6Frenkel Z. Gregory W. Kornfeld S. Lederkremer G.Z. J. Biol. Chem. 2003; 278: 34119-34124Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar, 17Avezov E. Frenkel Z. Ehrlich M. Herscovics A. Lederkremer G.Z. Mol. Biol. Cell. 2008; 19: 216-225Crossref PubMed Scopus (113) Google Scholar), and also in this case, there was more colocalization with EDEM1 (Fig. 2B, lower panels, and 2C). The behavior of EDEM1 is different from that of ERManI, which is concentrated in the ERQC in all conditions, in untreated cells, after proteasome inhibition and after inhibition of mannose trimming (17Avezov E. Frenkel Z. Ehrlich M. Herscovics A. Lederkremer G.Z. Mol. Biol. Cell. 2008; 19: 216-225Crossref PubMed Scopus (113) Google Scholar). Because Kif could theoretically compete with substrate binding to EDEM1, we analyzed the effect of inhibition of mannose trimming by knockdown of ERManI, an enzyme that we had shown is required for the extensive mannose trimming and targeting to ERAD (17Avezov E. Frenkel Z. Ehrlich M. Herscovics A. Lederkremer G.Z. Mol. Biol. Cell. 2008; 19: 216-225Crossref PubMed Scopus (113) Google Scholar). Knockdown of ERManI causes a smaller extent of inhibition of mannose trimming compared with Kif (compare band shifts in Figs. 2A and 3A, middle panels), but led to increased coimmunoprecipitation of EDEM1 with H2a (Fig. 3), indicating that association of EDEM1 with the substrate does not depend on the activity or presence of ERManI, the presence of which may actually compete for binding to the substrate. Altogether, the results indicate that EDEM1 is involved in ERAD of H2a and that association and colocalization of EDEM1 and the ERAD substrate do not require mannose trimming or ERManI. The affinity of the mammalian lectin OS9 and of yeast Yos9 for several oligosaccharides was determined recently in vitro and showed a clear preference for trimmed oligosaccharides and no binding to Man9GlcNAc2 or Man8BGlcNAc2 (missing the middle branch terminal mannose) (8Hosokawa N. Kamiya Y. Kamiya D. Kato K. Nagata K. J. Biol. Chem. 2009; 284: 17061-17068Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar, 10Quan E.M. Kamiya Y. Kamiya D. Denic V. Weibezahn J. Kato K. Weissman J.S. Mol. Cell. 2008; 32: 870-877Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). The same is true for XTP3-B, which has a similar function as OS9 (11Yamaguchi D. Hu D. Matsumoto N. Yamamoto K. Glycobiology. 2010; 20: 348-355Crossref PubMed Scopus (39) Google Scholar). Therefore, the prediction would be that inhibition of α1,2-mannosidases would inhibit ERAD substrate binding to the lectins. Although for some substrates OS9 and XTP3-B seem to be interchangeable (29Bernasconi R. Galli C. Calanca V. Nakajima T. Molinari M. J. Cell Biol. 2010; 188: 223-235Crossref PubMed Scopus (144) Google Scholar), other substrates have a preference in associating with one of the lectins (30Christianson J.C. Shaler T.A. Tyler R.E. Kopito R.R. Nat. Cell Biol. 2008; 10: 272-282Crossref PubMed Scopus (387) Google Scholar). Coimmunoprecipitation of H2a with OS9 yielded a very low signal (data not shown), but it showed significant binding to XTP3-B (Fig. 4A, lane 1). Cell treatment with Kif or knockdown of ERManI significantly inhibited the coimmunoprecipitation to 25 and 35% of the control, respectively, even though the total amount of ERAD substrate present increased as its degradation was inhibited (Fig. 4A, lanes 2 and 3 compared with lane 1). Combined knockdown of ERManI and Kif treatment reduced the association even further, to 10% of the control (Fig. 4A, graph). It had been reported that the sugar chains of SEL1L, the HRD1 E3 ligase adaptor (31Mueller B. Lilley B.N. Ploegh H.L. J. Cell Biol. 2006; 175: 261-270Crossref PubMed Scopus (154) Google Scholar), are involved in its interactions with EDEM1 (27Cormier J.H. Tamura T. Sunryd J.C. Hebert D.N. Mol. Cell. 2009; 34: 627-633Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar) and also with OS9 and XTP3-B (30Christianson J.C. Shaler T.A. Tyler R.E. Kopito R.R. Nat. Cell Biol. 2008; 10: 272-282Crossref PubMed Scopus (387) Google Scholar). These findings could suggest an indirect sugar dependence, with a protein-protein interaction of the substrate with SEL1L and sugar-protein interactions of SEL1L with the lectins. In this case, knockdown of SEL1L should abrogate the mannose-trimming dependence of the putative indirect interaction of the ERAD substrate with XTP3-B. Nevertheless, after efficient knockdown of SEL1L (Fig. 4C), the coimmunoprecipitation of H2a with XTP3-B was still inhibited by cell treatment with Kif, to an extent similar to that in the control cells (compare Fig. 4, A and B, lanes 1 and 2). We analyzed whether delivery of the substrate to factors downstream of XTP3-B in the ERAD pathway is dependent on the mannose-trimming step. We had shown that two E3 ubiquitin ligases participate in the degradation of H2a (23Groisman B. Avezov E. Lederkremer G.Z. Isr. J. Chem. 2006; 46: 189-196Crossref Scopus (12) Google Scholar), HRD1 (a transmembrane protein exposing a RING H2 finger domain to the cytosol (32Kikkert M. Doolman R. Dai M. Avner R. Hassink G. van Voorden S. Thanedar S. Roitelman J. Chau V. Wiertz E. J. Biol. Chem. 2004; 279: 3525-3534Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar)) and the cytosolic SCFFbs2 (33Yoshida Y. Tokunaga F. Chiba T. Iwai K. Tanaka K. Tai T. J. Biol. Chem. 2003; 278: 43877-43884Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). This can be seen in Fig. 5, which shows a pulse-chase analysis of H2a and the inhibition of the degradation by overexpression of dominant negative mutants of HRD1 (RING finger mutant) and Fbs2 (F box mutant). In this case, we used SBP-tagged uncleavable H2a, which behaves similarly to the wild type protein, except that it does not yield a cleaved fragment (23Groisman B. Avezov E. Lederkremer G.Z. Isr. J. Chem. 2006; 46: 189-196Crossref Scopus (12) Google Scholar). We had seen that upon proteasomal inhibition, a large portion of HRD1 colocalizes with H2aRFP at the ERQC (19Kondratyev M. Avezov E. Shenkman M. Groisman B. Lederkremer G.Z. Exp. Cell Res. 2007; 313: 3395-3407Crossref PubMed Scopus (59) Google Scholar). This can be seen in Fig. 6A (middle panels). Treatment with Kif redistributed both H2aRFP and HRD1 to a punctate pattern but with much decreased colocalization, similar to that in untreated cells (Fig. 6A, lower panels, and B). Kif also caused a much lower degree of coprecipitation of H2aSBP and HRD1 (Fig. 6C). For SCFFbs2, Fbs2, the substrate recognition component of this E3 ligase presents additional interest. Fbs2 is a lectin that binds substrate N-glycans (34Yoshida Y. Biosci. Biotechnol. Biochem. 2007; 71: 2623-2631Crossref PubMed Scopus (31) Google Scholar) and for sugar chain recognition, the glycoprotein must undergo retrotranslocation to the cytosol where the E3 ligase is located. Thus, Fbs2 associates with the substrate at a very late ERAD stage. We had shown that Fbs2 targets the sugar mo" @default.
• W1978939437 created "2016-06-24" @default.
• W1978939437 creator A5024721588 @default.
• W1978939437 creator A5031423535 @default.
• W1978939437 creator A5054240950 @default.
• W1978939437 creator A5073583330 @default.
• W1978939437 date "2011-01-01" @default.
• W1978939437 modified "2023-10-14" @default.
• W1978939437 title "Mannose Trimming Is Required for Delivery of a Glycoprotein from EDEM1 to XTP3-B and to Late Endoplasmic Reticulum-associated Degradation Steps" @default.
• W1978939437 cites W1481795283 @default.
• W1978939437 cites W1976046875 @default.
• W1978939437 cites W1980337003 @default.
• W1978939437 cites W1980612397 @default.
• W1978939437 cites W1981625315 @default.
• W1978939437 cites W1982432510 @default.
• W1978939437 cites W1986274701 @default.
• W1978939437 cites W1987464684 @default.
• W1978939437 cites W2003369977 @default.
• W1978939437 cites W2008559063 @default.
• W1978939437 cites W2010862596 @default.
• W1978939437 cites W2019498660 @default.
• W1978939437 cites W2021773042 @default.
• W1978939437 cites W2026208013 @default.
• W1978939437 cites W2030009057 @default.
• W1978939437 cites W2031079874 @default.
• W1978939437 cites W2031488588 @default.
• W1978939437 cites W2034133901 @default.
• W1978939437 cites W2035349696 @default.
• W1978939437 cites W2035535713 @default.
• W1978939437 cites W2036333455 @default.
• W1978939437 cites W2042447745 @default.
• W1978939437 cites W2044756700 @default.
• W1978939437 cites W2045151558 @default.
• W1978939437 cites W2051881845 @default.
• W1978939437 cites W2052248196 @default.
• W1978939437 cites W2053327377 @default.
• W1978939437 cites W2061793634 @default.
• W1978939437 cites W2064609154 @default.
• W1978939437 cites W2066655356 @default.
• W1978939437 cites W2067072165 @default.
• W1978939437 cites W2067827261 @default.
• W1978939437 cites W2068309688 @default.
• W1978939437 cites W2072534938 @default.
• W1978939437 cites W2079261384 @default.
• W1978939437 cites W2082698485 @default.
• W1978939437 cites W2089328676 @default.
• W1978939437 cites W2089925321 @default.
• W1978939437 cites W2104085655 @default.
• W1978939437 cites W2104734239 @default.
• W1978939437 cites W2105010192 @default.
• W1978939437 cites W2106595136 @default.
• W1978939437 cites W2111415532 @default.
• W1978939437 cites W2117399012 @default.
• W1978939437 cites W2121576917 @default.
• W1978939437 cites W2127716031 @default.
• W1978939437 cites W2128347862 @default.
• W1978939437 cites W2136802921 @default.
• W1978939437 cites W2146357495 @default.
• W1978939437 cites W2149387929 @default.
• W1978939437 cites W2153648191 @default.
• W1978939437 cites W2153693056 @default.
• W1978939437 cites W2156770495 @default.
• W1978939437 cites W2171032591 @default.
• W1978939437 doi "https://doi.org/10.1074/jbc.m110.154849" @default.
• W1978939437 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3020737" @default.
• W1978939437 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21062743" @default.
• W1978939437 hasPublicationYear "2011" @default.
• W1978939437 type Work @default.
• W1978939437 sameAs 1978939437 @default.
• W1978939437 citedByCount "53" @default.
• W1978939437 countsByYear W19789394372012 @default.
• W1978939437 countsByYear W19789394372013 @default.
• W1978939437 countsByYear W19789394372014 @default.
• W1978939437 countsByYear W19789394372015 @default.
• W1978939437 countsByYear W19789394372016 @default.
• W1978939437 countsByYear W19789394372017 @default.
• W1978939437 countsByYear W19789394372018 @default.
• W1978939437 countsByYear W19789394372019 @default.
• W1978939437 countsByYear W19789394372020 @default.
• W1978939437 countsByYear W19789394372021 @default.
• W1978939437 countsByYear W19789394372022 @default.
• W1978939437 countsByYear W19789394372023 @default.
• W1978939437 crossrefType "journal-article" @default.
• W1978939437 hasAuthorship W1978939437A5024721588 @default.
• W1978939437 hasAuthorship W1978939437A5031423535 @default.
• W1978939437 hasAuthorship W1978939437A5054240950 @default.
• W1978939437 hasAuthorship W1978939437A5073583330 @default.
• W1978939437 hasBestOaLocation W19789394372 @default.
• W1978939437 hasConcept C108625454 @default.
• W1978939437 hasConcept C111919701 @default.
• W1978939437 hasConcept C139447449 @default.
• W1978939437 hasConcept C158617107 @default.
• W1978939437 hasConcept C158619295 @default.
• W1978939437 hasConcept C185592680 @default.
• W1978939437 hasConcept C2775887612 @default.
• W1978939437 hasConcept C2777174400 @default.
• W1978939437 hasConcept C2779679103 @default.
• W1978939437 hasConcept C41008148 @default.

• next