FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1979174952> ?p ?o ?g. }

• W1979174952 endingPage "34323" @default.
• W1979174952 startingPage "34312" @default.
• W1979174952 abstract "Extracellular matrix (ECM) protein receptors, or integrins, participate in vascular remodeling and the systemic myogenic response. Synthetic ligands and ECM fragments regulate the vascular smooth muscle cell contractile state by altering intracellular Ca2+ levels ([Ca2+]i). Information on the Ca2+ effect of integrins in vascular smooth muscle cells is limited, but nonexistent in pulmonary arterial smooth muscle cells (PASMCs). We therefore characterized integrin expression in endothelium-denuded pulmonary arteries, and explored [Ca2+]i mobilization pathways induced by soluble ligands in rat PASMCs. Reverse transcriptase-PCR showed mRNA expression of integrins α1, α2, α3, α4, α5, α7, α8, αv, β1, β3, and β4, and immunoblots of α5, αv, β1, and β3 confirmed protein expression. Exposure of PASMCs to integrin-binding peptides (0.5 mm) containing the arginine-glycine-aspartate (RGD) motif elicited [Ca2+]i responses with an order of potency of GRGDNP > GRGDSP > GRGDTP = cyclo-RGD. Pharmacological analysis revealed that the GRGDSP-induced Ca2+ response was unrelated to Ca2+ influx and the inositol triphosphate receptor-gated Ca2+ store, but partially blocked by ryanodine or inhibition of lysosomerelated acidic organelles with bafilomycin A1. Simultaneous inhibition of both pathways was necessary to abolish the response. GRGDSP treatment increased cyclic ADP-ribose, the endogenous activator of ryanodine receptors, by 70%. GRGDSP also rapidly reduced Lysotracker Red accumulation, confirming direct modulation of acidic organelles. These data are the first demonstration of integrin-mediated Ca2+ regulation in PASMCs. The presence of an array of integrins, and activation of ryanodine-sensitive Ca2+ stores and lysosome-like organelles by GRGDSP suggest important roles for integrin-dependent Ca2+ signaling in regulating PASMC function. Extracellular matrix (ECM) protein receptors, or integrins, participate in vascular remodeling and the systemic myogenic response. Synthetic ligands and ECM fragments regulate the vascular smooth muscle cell contractile state by altering intracellular Ca2+ levels ([Ca2+]i). Information on the Ca2+ effect of integrins in vascular smooth muscle cells is limited, but nonexistent in pulmonary arterial smooth muscle cells (PASMCs). We therefore characterized integrin expression in endothelium-denuded pulmonary arteries, and explored [Ca2+]i mobilization pathways induced by soluble ligands in rat PASMCs. Reverse transcriptase-PCR showed mRNA expression of integrins α1, α2, α3, α4, α5, α7, α8, αv, β1, β3, and β4, and immunoblots of α5, αv, β1, and β3 confirmed protein expression. Exposure of PASMCs to integrin-binding peptides (0.5 mm) containing the arginine-glycine-aspartate (RGD) motif elicited [Ca2+]i responses with an order of potency of GRGDNP > GRGDSP > GRGDTP = cyclo-RGD. Pharmacological analysis revealed that the GRGDSP-induced Ca2+ response was unrelated to Ca2+ influx and the inositol triphosphate receptor-gated Ca2+ store, but partially blocked by ryanodine or inhibition of lysosomerelated acidic organelles with bafilomycin A1. Simultaneous inhibition of both pathways was necessary to abolish the response. GRGDSP treatment increased cyclic ADP-ribose, the endogenous activator of ryanodine receptors, by 70%. GRGDSP also rapidly reduced Lysotracker Red accumulation, confirming direct modulation of acidic organelles. These data are the first demonstration of integrin-mediated Ca2+ regulation in PASMCs. The presence of an array of integrins, and activation of ryanodine-sensitive Ca2+ stores and lysosome-like organelles by GRGDSP suggest important roles for integrin-dependent Ca2+ signaling in regulating PASMC function. Extracellular matrix (ECM) 2The abbreviations used are: ECM, extracellular matrix; PASMC, pulmonary arterial smooth muscle cell; RGD, arginine-glycine-aspartic acid; LDV, leucine-aspartic acid-valine; cADPR, cyclic ADP-ribose; HBSS, HEPES-buffered salt solution; PBS, phosphate-buffered saline; PBST, PBS containing Tween 20; IP3, inositol trisphosphate; RyR, ryanodine receptor; NAADP, nicotinic acid adenine dinucleotide phosphate; V-ATPase, vacuolar H+ ATPase; SMC, smooth muscle cell; RT, reverse transcriptase. 2The abbreviations used are: ECM, extracellular matrix; PASMC, pulmonary arterial smooth muscle cell; RGD, arginine-glycine-aspartic acid; LDV, leucine-aspartic acid-valine; cADPR, cyclic ADP-ribose; HBSS, HEPES-buffered salt solution; PBS, phosphate-buffered saline; PBST, PBS containing Tween 20; IP3, inositol trisphosphate; RyR, ryanodine receptor; NAADP, nicotinic acid adenine dinucleotide phosphate; V-ATPase, vacuolar H+ ATPase; SMC, smooth muscle cell; RT, reverse transcriptase. protein receptors, or integrins, comprise a superfamily of structurally related heterodimeric transmembrane receptors that mediate cell-cell and cell-ECM interactions. Integrins physically bridge the ECM and cytoskeleton, and act as transducers of “outside-in” and “inside-out” signaling (1Geiger B. Bershadsky A. Pankov R. Yamada K.M. Nat. Rev. Mol. Cell. Biol. 2001; 2: 793-805Crossref PubMed Scopus (1815) Google Scholar). Extracellular integrin ligation changes [Ca2+]i in a variety of cell types, including platelets, neutrophils, monocytes, lymphocytes, fibroblasts, endothelial cells, osteoclasts, neurons, glomerulosa cells, epithelial and smooth muscle cells (2Campbell S. Otis M. Cote M. Gallo-Payet N. Payet M.D. Endocrinology. 2003; 144: 1486-1495Crossref PubMed Scopus (32) Google Scholar, 3Sjaastad M.D. Lewis R.S. Nelson W.J. Mol. Biol. Cell. 1996; 7: 1025-1041Crossref PubMed Scopus (60) Google Scholar, 4Wildering W.C. Hermann P.M. Bulloch A.G. J. Neurosci. 2002; 22: 2419-2426Crossref PubMed Google Scholar, 5Martinez-Lemus L.A. Wu X. Wilson E. Hill M.A. Davis G.E. Davis M.J. Meininger G.A. J. Vasc. Res. 2003; 40: 211-233Crossref PubMed Scopus (140) Google Scholar). Integrin ligation also activates other intracellular signaling molecules, including H+ and a plethora of protein kinases such as the focal adhesion kinase, Rac, and extracellular signal regulated kinases (1Geiger B. Bershadsky A. Pankov R. Yamada K.M. Nat. Rev. Mol. Cell. Biol. 2001; 2: 793-805Crossref PubMed Scopus (1815) Google Scholar, 6Schwartz M.A. Schaller M.D. Ginsberg M.H. Annu. Rev. Cell Dev. Biol. 1995; 11: 549-599Crossref PubMed Scopus (1461) Google Scholar). As a result, a myriad of cellular functions such as differentiation, proliferation, migration, apoptosis, and mechanosensing for shear and tension are affected (6Schwartz M.A. Schaller M.D. Ginsberg M.H. Annu. Rev. Cell Dev. Biol. 1995; 11: 549-599Crossref PubMed Scopus (1461) Google Scholar, 7Iqbal J. Zaidi M. Biochem. Biophys. Res. Commun. 2005; 328: 751-755Crossref PubMed Scopus (177) Google Scholar).Integrins participate in controlling systemic vascular tone by invoking changes in smooth muscle [Ca2+]i, resulting in relaxation or contraction. Synthetic ligands carrying the prototypic integrin-binding tripeptide motif, arginine-glycine-aspartate (RGD), decrease [Ca2+]i causing vasodilation in rat cremaster muscle arterioles (8Mogford J.E. Davis G.E. Platts S.H. Meininger G.A. Circ. Res. 1996; 79: 821-826Crossref PubMed Scopus (140) Google Scholar, 9D'Angelo G. Mogford J.E. Davis G.E. Davis M.J. Meininger G.A. Am. J. Physiol. 1997; 272: H2065-H2070PubMed Google Scholar). On the other hand, RGD-containing peptides constrict rat renal afferent arterioles through increased [Ca2+]i (10Yip K.P. Marsh D.J. Am. J. Physiol. 1997; 273: F768-F776PubMed Google Scholar, 11Chan W.L. Holstein-Rathlou N.H. Yip K.P. Am. J. Physiol. 2001; 280: C593-C603Crossref PubMed Google Scholar). Other integrin binding sequences also exist, such as leucine-aspartate-valine (LDV), which elevates [Ca2+]i and causes vasoconstriction of rat cremaster muscle arterioles (12Waitkus-Edwards K.R. Martinez-Lemus L.A. Wu X. Trzeciakowski J.P. Davis M.J. Davis G.E. Meininger G.A. Circ. Res. 2002; 90: 473-480Crossref PubMed Scopus (97) Google Scholar). Integrins α5β1 and αvβ3 are, furthermore, directly involved in the vascular myogenic behavior, where blockade of either integrin inhibits myogenic constriction of skeletal muscle arterioles (13Martinez-Lemus L.A. Crow T. Davis M.J. Meininger G.A. Am. J. Physiol. Heart Circ. Physiol.,. 2005; 289: H322-H329Crossref PubMed Scopus (97) Google Scholar).Apart from regulating tone, integrins play an important role in vascular pathogenesis. This is evidenced by the remodeling and deposition of ECM components seen in various vascular diseases such as atherosclerosis, hypertension, and restenosis (5Martinez-Lemus L.A. Wu X. Wilson E. Hill M.A. Davis G.E. Davis M.J. Meininger G.A. J. Vasc. Res. 2003; 40: 211-233Crossref PubMed Scopus (140) Google Scholar). In the pulmonary vasculature, remodeling occurs in chronic obstructive pulmonary disease, asthma, scleroderma, and pulmonary hypertension (14Chapman H.A. J. Clin. Investig. 2004; 113: 148-157Crossref PubMed Scopus (0) Google Scholar). Interestingly, pulmonary vascular remodeling has been linked to integrin activation in rat models recapitulating pulmonary hypertension. Previous studies in monocrotaline-induced pulmonary hypertension show that degraded ECM components activate vascular smooth muscle cell integrin β3, causing focal adhesion formation and initiation of the extracellular signal-regulated kinase signal transduction cascade (15Rabinovitch M. Clin. Chest Med. 2001; 22: 433-449Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Incidentally, the increased PASMC proliferation and medial hypertrophy related to pulmonary hypertension also involves altered [Ca2+]i homeostasis in PASMCs (16Mandegar M. Fung Y.C. Huang W. Remillard C.V. Rubin L.J. Yuan J.X. Microvasc. Res. 2004; 68: 75-103Crossref PubMed Scopus (254) Google Scholar).The influence of integrins on [Ca2+]i homeostasis in governing systemic vascular tone, and the participation of integrins in pulmonary vascular remodeling suggest that integrin ligation would affect [Ca2+]i homeostasis in PASMCs. However, information to this end is lacking. In this article, we therefore test this hypothesis by monitoring [Ca2+]i levels in rat PASMCs upon exposure to soluble integrin ligands. We subsequently characterize the intracellular Ca2+ signaling cascade initiated by GRGDSP, and identify the ryanodine-sensitive Ca2+ stores and lysosome-related acidic organelles as the key mediators of this response.EXPERIMENTAL PROCEDURESIsolation and Culture of PASMCs—PASMCs were enzymatically isolated and transiently cultured as previously described (17Zhang W.M. Yip K.P. Lin M.J. Shimoda L.A. Li W.H. Sham J.S. Am. J. Physiol. 2003; 285: L680-L690Crossref PubMed Scopus (80) Google Scholar). Briefly, lungs were removed from male Wistar rats (150-200 g) anesthetized with sodium pentobarbital (130 mg/kg intraperitoneal), upon which intrapulmonary arteries were dissected in HEPES-buffered salt solution (HBSS) containing (in mm) 130 NaCl, 5 KCl, 1.2 MgCl2, 1.5 CaCl2, 10 HEPES, 10 glucose (pH 7.4). Pulmonary arteries were carefully cleaned of connective tissue, and the endothelial layer removed by gently rubbing the luminal surface with a cotton swab. Arteries were incubated in ice-cold HBSS (30 min), and then in reduced Ca2+ (20 μm) HBSS (20 min, room temperature), upon which they were digested in reduced Ca2+ HBSS containing collagenase (Type I, 1750 units/ml), papain (9.5 units/ml), bovine serum albumin (2 mg/ml), and dithiothreitol (1 mm), at 37 °C for 18 min. After washing with Ca2+-free HBSS, single smooth muscle cells were gently dispersed from the tissues by trituration in Ca2+-free HBSS, and cultured (16-24 h, 37 °C, 5% CO2) on 25-mm glass coverslips in Ham's F-12 medium (with l-glutamine) supplemented with 0.5% fetal calf serum, 100 units/ml streptomycin, and 0.1 mg/ml penicillin.RNA Isolation and RT-PCR—Intralobar pulmonary arteries and aorta were removed, cleaned of connective tissue, denuded of endothelium as above, frozen in liquid nitrogen, and kept at -80 °C until use. Tissues were homogenized in TRIzol reagent (Invitrogen) using a PowerGen homogenizer (Fisher Scientific), and total RNA was isolated according to the protocol supplied with the TRIzol reagent. Ethanol-precipitated RNA samples were dissolved in diethyl pyrocarbonate-treated water and quantified using a BioPhotometer spectrophotometer (Eppendorf, Hamburg, Germany).Total RNA samples were subsequently used for cDNA synthesis with SuperScript II (Invitrogen). Primers for PCR (Table 1) were carefully designed to regions specific for each integrin subtype, based on sequence alignments generated by a Clustal W algorithm. At least one of each primer pair was designed to exon-exon junctions, to minimize the possibility of amplifying genomic DNA. Where it was not feasible to design primers to exon-exon junctions, primers were designed to span intronic regions, to differentiate between genomic DNA and cDNA. PCR was carried out for 30 cycles using PlatinumTaq DNA polymerase (Invitrogen), which involved denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, and extension at 72 °C for 2 min. The resulting RT-PCR products were analyzed by 1.5% agarose gel electrophoresis.TABLE 1Primer sequences used to amplify integrin cDNAPrimer sequenceSubtypeForward (5′-3′)Reverse (5′-3′)Expected size (bases)α1AGCAGACACAGGTCGGGATTGGTGGTGTTATGAGGGATGAC646α2CAGGTGACTTTTACCATTAACTTAGCCAACAGCAAAAGGATTC800α3AAGGAAACAGCTACATGATTCAGTCCATCCTGGTTGATGTCAC487α4ATCTAGTTTTTACACACAGGATTTTGTCAATGTCGCCAAGATT524α5GGTGATGACACAGAAGACTTTGTTGCGCTCCTCTGGGTTGAACA685α7GTGGTCCTAGATTATGTGTTAGATGGTAAAAGGTGACCTGAGTGCC722α8TGACACCACCAACAACAGTTCTGTGCTCCTCTTGGAAT548αvTATTGGGGATGACAACCCTCTGACCCTCATAGATGTGCTGAACAGGC500β1ATGGAGTGAATGGGACAGGAGACACACCATTTCCTCCACAGAT515β3GACTATCGACCCTCTCAGCACTTCCACTGGAGTCTTCATAG598β4GCGAGCTGCAAAAGGAAGTTCGTATCGCCGAGTAGTTGAT498 Open table in a new tab Preparation of Protein Samples and Western Analysis—Total protein was isolated from endothelium-denuded pulmonary arteries and aorta. Briefly, upon dissection, tissues were frozen in liquid nitrogen and pulverized. Samples were subsequently homogenized with a Dounce homogenizer (30 strokes) in ice-cold Tris-HCl buffer (50 mm, pH 7.4) containing phenylmethylsulfonyl fluoride (1 mm) and protease mixture inhibitor (Roche Applied Sciences). Homogenized tissues were centrifuged (3000 × g, 4 °C, 10 min), upon which the protein concentrations of the post-nuclear supernatant were measured with the BCA Protein Assay Kit (Pierce). Total protein from cultured PASMCs were isolated by scraping cells with a rubber policeman in the ice-cold Tris-HCl buffer and processed as described for the smooth muscle tissue.Protein samples were analyzed by SDS-PAGE and Western blot. Samples were treated with Laemmli sample buffer with or without β-mercaptoethanol (100 °C, 5 min), separated by an 8% polyacrylamide gel at a concentration of 20 μg/lane, and then electrotransferred onto Immobilon P membranes (0.45 mm, Millipore) using a tank transfer system (80 V, 3 h, 4 °C). Upon blocking (1 h, room temperature) with 5% skim milk in PBS containing 0.05% Tween 20 (PBST), membranes were incubated with primary antibodies diluted in PBST containing 1% bovine serum albumin (bovine serum albumin/PBST) at 4 °C overnight. The following primary antibodies were used: α5 (1:1000, catalog number AB1949, Chemicon International, Temecula, CA); αv (1:250, catalog number 611012, BD Biosciences, San Diego, CA); β1 (1:2000, catolog number AB1952, Chemicon International); and β3 (1:500, catalog number 4702, Cell Signaling, Beverly, MA). After washing in PBST, membranes were incubated with horseradish peroxidase-coupled donkey anti-rabbit or sheep anti-mouse secondary antibodies (Amersham Biosciences) diluted in 1% bovine serum albumin/PBST (1 h, room temperature), again washed extensively, and ultimately detected using enhanced chemiluminescence (Amersham Biosciences). The anti-CD38 immunoblot was performed essentially as described above, except that for the negative control, the antibody (1:200, catalog number sc-7049, Santa Cruz Biotechnology, Santa Cruz, CA) was preadsorbed with the antigenic peptide (5 times excess by weight, sc-7049P, Santa Cruz) prior to use (overnight, 4 °C).Calcium Imaging—PASMCs were loaded with Fluo-3 AM (10 μm) dissolved in Me2SO containing 20% pluronic acid for 45 min at room temperature (Molecular Probes, Eugene, OR). Upon washing thoroughly with Tyrode solution containing (in mm) 137 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 10 d-glucose, and 10 NaHEPES (pH 7.4), the cytosolic dye was allowed to de-esterify for 20 min at room temperature.Laser scanning confocal microscopy was used to monitor the fluorescence changes upon treatment of PASMCs with the respective agents. Images were acquired with a Zeiss LSM-510 inverted confocal microscope (Carl Zeiss Inc., Germany) using a Zeiss Plan-Neofluor ×40 oil immersion objective (NA = 1.3) and an excitation wavelength of 488 nm. Fluorescence, measured at wavelengths >505 nm, was acquired in a framescan mode at either 5-(Figs. 3, 4, 5 and 6) or 10-s (Fig. 7) intervals. Photobleaching and laser damage to cells were minimized by attenuating the laser to ∼1% of its maximum power (25 milliwatts). In all cases during fluorescence recordings, reagents were applied manually but with care, so as not to disturb the cells or cause an artificial change in fluorescence.FIGURE 4Concentration dependence of [Ca2+]i response to GRGDSP. A, time course of the change in [Ca2+]i evoked by the application of 3 different (0.5, 1.25, and 2.5 mm) GRGDSP concentrations. GRGDSP was applied at time = 50 s. B, comparison of Δ[Ca2+]i levels induced upon exposure to 0.5, 1.25, and 2.5 mm GRGDSP at 7.5 min post-application. Values are the average of data acquired from individual cells in multiple dishes for experiments (i.e. 0.5 mm, n = 89 cells from 8 dishes; 1.25 mm, n = 71 cells from 8 dishes; 2.5 mm, n = 102 cells from 8 dishes). Cells were obtained from individual rats, and experiments were repeated in cells prepared from at least 3 replicate rats.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 5Ca2+ influx is not involved in the GRGDSP-elicited [Ca2+]i response. The GRGDSP-induced (1.25 mm) Ca2+ response was monitored upon pretreating PASMCs with: A, nifedipine (1 μm, 20 min) to block L-type Ca2+ channels; B, SKF 96365 (30 μm, 30 min) to block non-selective Ca2+ channels; and C, 0 mm Ca2+ Tyrode buffer containing 2 mm EGTA to create conditions of no external Ca2+, to eliminate Ca2+ entry. Arrow represents the time of GRGDSP application. D, peak Δ[Ca2+]i elicited by GRGDSP, showing that Ca2+ influx does not contribute to the GRGDSP-induced response. Values in the figure reflect the average of data acquired from individual cells in multiple dishes. A, control, n = 74 cells from 7 dishes; nifedipine, n = 65 cells from 7 dishes; B, control, n = 46 cells, 7 dishes; SKF, n = 34 cells, 5 dishes; C, control, n = 67 cells, 8 dishes; 0 Ca, n = 60 cells, 7 dishes. Cells were obtained from individual animals, and experiments were repeated using cells prepared from at least 2 different rats.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 6GRGDSP mobilizes [Ca2+]i from ryanodine and bafilomycin A1-sensitive stores, but not the IP3 receptor-gated store. PASMCs were exposed to GRGDSP (1.25 mm) upon pretreatment with: A, ryanodine (50 μm, 30 min); B, Xestospongin C (10 μm, 30 min); and C, bafilomycin A1 (3 μm, 30 min). Arrows in A and B indicate the time of GRGDSP application, but reflects the time of bafilomycin A1 treatment in C. GRGDSP treatment in C is illustrated by the horizontal bar. Inset shows averaged Δ[Ca2+]i levels upon stimulation with the Ca2+ ionophore 4Br-A23187 in the presence of 10 mm Ca2+. Cells were challenged with the ionophore after stimulation with GRGDSP ± bafilomycin A1. Note that the y axis scale (Δ[Ca2+]i) reaches the micromolar range, indicating that Fluo-3 fluorescence intensity was not saturated by treatment of PASMCs with GRGDSP ± bafilomycin A1. D, summary of peak Δ[Ca2+]i response elicited by GRGDSP application (compared with [Ca2+]i immediately preceding GRGDSP application) as a percent of control. Values represent the average of data acquired from individual cells in multiple dishes for experiments in A and B, and the average of data acquired from individual dishes in C. A, control, n = 106 cells from 12 dishes; ryanodine: n = 115 cells from 12 dishes; B, control, n = 103 cells, 12 dishes; Xestospongin C, n = 105 cells, 12 dishes; C, control, n = 11 dishes; bafilomycin, n = 12 dishes. Experiments were repeated using cells prepared from three individual animals. Asterisks indicate p < 0.10 relative to the values without blocker treatment.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 7Simultaneous inhibition of ryanodine- and bafilomycin A1-sensitive intracellular Ca2+ stores abolishes the GRGDSP-induced Ca2+ response. A, GRGDSP-induced Ca2+ response in nominally Ca2+-free conditions in which ryanodine and IP3-gated intracellular Ca2+ stores were depleted with thapsigargin (black trace); and lysosome-related acidic organelle was additionally blocked with bafilomycin A1 (gray trace). B, treatment of PASMCs with ryanodine (50 μm) and bafilomycin A1 (3 μm) in the presence of 2 mm extracellular Ca2+ (applied at t = 3 min 20 s; arrow, for 30 min, gray trace). C, bar graph summarizing the peak Δ[Ca2+]i of the GRGDSP-induced response, expressed as a percentage of control (asterisks, p < 0.05). Control values are 130.3 ± 7.9 nm at t = 50 min in A, and 78.0 ± 6.6 nm at t = 30 min in B. Values represent the average of data acquired from individual cells in multiple dishes for experiments in A, and the average of data acquired from individual dishes in B. A, control, n = 160 cells from 8 dishes; bafilomycin, n = 202 cells from 11 dishes; B, control, n = 8 dishes; ryanodine + bafilomycin, n = 9 dishes. Replicates were performed using cells prepared from 4 individual animals.View Large Image Figure ViewerDownload Hi-res image Download (PPT)In some experiments, Fluo-3 fluorescence was detected using a Nikon Diaphot microscope equipped with epifluorescence attachments and a microfluorometer (Biomedical Instrument Group, University of Pennsylvania). Protocols were executed and data collected on-line with a Digidata analog-to-digital interface and the pClamp software package (Axon Instruments, Inc., Foster City, CA).Changes in fluorescence intensity were used to calculate the cellular concentrations of Ca2+, using the following equation: [Ca2+]i = (KD·R)/[(KD/[Ca2+]rest) + 1 - R], where R is F/F0, KD of Fluo-3 is 1.1 μm, and the resting [Ca2+] ([Ca2+]rest) is 100 nm. Changes in [Ca2+]i (i.e. Δ[Ca2+]i) were the differences between the calculated values and the initial [Ca2+]i at rest (i.e. 100 nm) (18Cheng H. Lederer W.J. Cannell M.B. Science. 1993; 262: 740-744Crossref PubMed Scopus (1604) Google Scholar). Concentrations of Ca2+ were similarly calculated for data obtained with the epifluorescence microscope, upon obtaining a background fluorescence value in an area devoid of cells by using the Ca2+ ionophone 4-Br-A23187 (EMD Biosciences) followed by Mn2+ quenching.Imaging Lysosomes—Acidic organelles were labeled with the acidotropic dye Lysotracker Red DND-99 (Molecular Probes) diluted in Tyrode's solution (50 nm) at room temperature for 30-45 min. Labeled PASMCs were imaged with a Zeiss LSM-510 inverted microscope as described above, but with excitation and emission wavelengths of 543 and >560 nm, respectively. Images were acquired in framescan mode at 2-min intervals, and cellular changes in fluorescence intensity were represented as F/F0, with F0 being the fluorescence level immediately preceding treatment with the respective agent.Detection of Cyclic ADP-ribose (cADPR)—cADPR levels were measured in cultured PASMCs at passage 3-4. Cells were isolated and cultured in Ham's F-12 media overnight as described above, and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum thereafter. Prior to treatment with GRGDSP (1.25 mm), cells were washed three times with PBS, and equilibrated in Tyrode's solution for at least 30 min. Upon GRGDSP treatment, nucleotides were extracted from cells with 10% (w/v) trichloroacetic acid at 4 °C, followed by removal with watersaturated diethyl ether. The aqueous layer containing cADPR was adjusted to pH 8 with 1 m Tris and contaminating nucleotides other than cADPR were removed with a mixture containing hydrolytic enzymes with the following final concentrations: 0.44 unit/ml nucleotide pyrophosphatase, 12.5 units/ml alkaline phosphatase, 0.0625 unit/ml NADase, 2.5 mm MgCl2. Incubation proceeded at 37 °C for 2 h. Detection of cADPR was performed with some modifications to the cycling method described recently (19Graeff R. Lee H.C. Biochem. J. 2002; 361: 379-384Crossref PubMed Scopus (152) Google Scholar). Briefly, 0.1 ml of cADPR standard or nucleotides extracted from cell samples were incubated with 100 μl of cycling reagent containing (final concentrations) 0.3 μg/ml ADP-ribosyl cyclase, 4 mm nicotinamide, 100 mm sodium phosphate (pH 8), 0.8% (v/v) ethanol, 40 μg/ml alcohol dehydrogenase, 8 μm resazurin, 0.04 units/ml diaphorase, and 4 μm flavin mononucleotide. Following a 2-h incubation at room temperature, the increase in resorufin fluorescence was measured using a Spectramax XPS fluorescent plate reader with excitation and emission wavelengths of 544 and 590 nm, respectively (Molecular Devices, Sunnyvale, CA). Results are the averages of three to four independent experiments and are normalized to the value at time 0.Chemicals—GRGDSP, GRGDNP, GRGDTP, GRADSP, thapsigargin, nifedipine, SKF96365, ryanodine, Xestospongin C, bafilomycin A1, and 4-Br-A23187 were purchased from EMD Biosciences (San Diego, CA); GRGESP and cyclo-RGD (cyclo-GRGDSPA) were from Bachem (Torrance, CA); caffeine was from Sigma.RESULTSIntegrin Expression in PASMCs—To determine the repertoire of integrins expressed in endothelium-denuded rat pulmonary arteries, RT-PCR was performed using primers designed to integrins α1, α2, α3, α4, α5, α7, α8, αv, β1, β3, and β4 (Table 1). Fig. 1 shows a representative image of an RT-PCR, in which positive mRNA expression was observed for all integrin subtypes examined (Fig. 1a). We further compared the integrin expression profile to that in endothelium-denuded aorta (Fig. 1b). As illustrated in Fig. 1, the pattern of integrin expression was similar in both tissue types, except that integrin α4 consistently could not be detected in the aortic smooth muscle. Sizes of the PCR products obtained in all cases corresponded to that expected (see Table 1). All PCR primers were tested prior to use in other tissues (e.g. heart, small intestine, and brain) and shown to efficiently amplify products of the expected size (data not shown). Negative controls, in which the reverse transcriptase was omitted, yielded no PCR products (data not shown).FIGURE 1RT-PCR shows the presence of multiple integrin subtypes in pulmonary artery (A) and aortic (B) smooth muscle. Table 1 gives the specifics of the primers used, as well as the expected sizes, which correspond with each of the products obtained in this figure. All primers were tested in other tissue types to verify their capability in efficiently and robustly amplifying the product of the expected size. This figure is a representative image of an RT-PCR, which was repeated a total of 3 times.View Large Image Figure ViewerDownload Hi-res image Download (PPT)We focused our attention on a few integrin subtypes that have been characterized most extensively in other smooth muscles and examined the protein expression in endothelium-denuded pulmonary arteries and aorta. Western analysis of integrins α5, αv, β1, and β3 confirmed the presence of these proteins in both tissue subtypes (Fig. 2). Immunoblots were performed using both reduced and nonreduced protein samples, as certain antibodies were generated against reduced or non-reduced antigens. Some integrin α subunits including α5 and αv contain a disulfide-linked cleavage site at the C terminus of the protein, yielding 2 polypeptides in the presence of reducing agents (20Hemler M.E. Annu. Rev. Immunol. 1990; 8: 365-400Crossref PubMed Google Scholar). β Subunits have internally disulfide-bonded cysteine-rich domains in the C termini that influence mobility on SDS-PAGE gels depending on the presence of reducing agents (21Green L.J. Mould A.P. Humphries M.J. Int. J. Biochem. Cell Biol. 1998; 30: 179-184Crossref PubMed Scopus (49) Google Scholar). A number of antibodies from various companies were tested for each of the integrin subtypes, and those giving the most specific products of the expected size were chosen. The anti-α5 antibody recognized a broad band of ∼150 kDa under non-reducing conditions in both PA and aorta, but was not reactive with the reduced protein as indicated by the manufactu" @default.
• W1979174952 created "2016-06-24" @default.
• W1979174952 creator A5007045995 @default.
• W1979174952 creator A5009285209 @default.
• W1979174952 creator A5024758785 @default.
• W1979174952 creator A5035803024 @default.
• W1979174952 creator A5046379137 @default.
• W1979174952 date "2006-11-01" @default.
• W1979174952 modified "2023-09-27" @default.
• W1979174952 title "Integrin Ligands Mobilize Ca2+ from Ryanodine Receptor-gated Stores and Lysosome-related Acidic Organelles in Pulmonary Arterial Smooth Muscle Cells" @default.
• W1979174952 cites W1538490497 @default.
• W1979174952 cites W1560040722 @default.
• W1979174952 cites W1590204800 @default.
• W1979174952 cites W1590619267 @default.
• W1979174952 cites W1615545200 @default.
• W1979174952 cites W1791904161 @default.
• W1979174952 cites W1888295889 @default.
• W1979174952 cites W1903673679 @default.
• W1979174952 cites W1916766996 @default.
• W1979174952 cites W1929857088 @default.
• W1979174952 cites W1953311373 @default.
• W1979174952 cites W1963563479 @default.
• W1979174952 cites W1967347970 @default.
• W1979174952 cites W1973058900 @default.
• W1979174952 cites W1973391847 @default.
• W1979174952 cites W1975609281 @default.
• W1979174952 cites W1976151623 @default.
• W1979174952 cites W1976741834 @default.
• W1979174952 cites W1979715207 @default.
• W1979174952 cites W1979963041 @default.
• W1979174952 cites W1983753718 @default.
• W1979174952 cites W1987149965 @default.
• W1979174952 cites W2000791145 @default.
• W1979174952 cites W2005496211 @default.
• W1979174952 cites W2007458222 @default.
• W1979174952 cites W2009122222 @default.
• W1979174952 cites W2012598160 @default.
• W1979174952 cites W2018480694 @default.
• W1979174952 cites W2029146584 @default.
• W1979174952 cites W2035501441 @default.
• W1979174952 cites W2052745947 @default.
• W1979174952 cites W2054225000 @default.
• W1979174952 cites W2056501914 @default.
• W1979174952 cites W2059069305 @default.
• W1979174952 cites W2063825596 @default.
• W1979174952 cites W2065368005 @default.
• W1979174952 cites W2075911358 @default.
• W1979174952 cites W2078189165 @default.
• W1979174952 cites W2078391920 @default.
• W1979174952 cites W2081375348 @default.
• W1979174952 cites W2082625926 @default.
• W1979174952 cites W2083769234 @default.
• W1979174952 cites W2089033487 @default.
• W1979174952 cites W2089304754 @default.
• W1979174952 cites W2111472663 @default.
• W1979174952 cites W2112945948 @default.
• W1979174952 cites W2118655540 @default.
• W1979174952 cites W2122496105 @default.
• W1979174952 cites W2130391111 @default.
• W1979174952 cites W2133701478 @default.
• W1979174952 cites W2135121318 @default.
• W1979174952 cites W2139615023 @default.
• W1979174952 cites W2142714350 @default.
• W1979174952 cites W2146447679 @default.
• W1979174952 cites W2159927110 @default.
• W1979174952 cites W2161432643 @default.
• W1979174952 cites W2162006028 @default.
• W1979174952 cites W2168918180 @default.
• W1979174952 cites W2186047119 @default.
• W1979174952 cites W2187218172 @default.
• W1979174952 cites W2285808960 @default.
• W1979174952 cites W2310132839 @default.
• W1979174952 cites W2765610915 @default.
• W1979174952 doi "https://doi.org/10.1074/jbc.m606765200" @default.
• W1979174952 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16963791" @default.
• W1979174952 hasPublicationYear "2006" @default.
• W1979174952 type Work @default.
• W1979174952 sameAs 1979174952 @default.
• W1979174952 citedByCount "47" @default.
• W1979174952 countsByYear W19791749522012 @default.
• W1979174952 countsByYear W19791749522013 @default.
• W1979174952 countsByYear W19791749522014 @default.
• W1979174952 countsByYear W19791749522015 @default.
• W1979174952 countsByYear W19791749522016 @default.
• W1979174952 countsByYear W19791749522017 @default.
• W1979174952 countsByYear W19791749522018 @default.
• W1979174952 countsByYear W19791749522020 @default.
• W1979174952 countsByYear W19791749522021 @default.
• W1979174952 countsByYear W19791749522022 @default.
• W1979174952 countsByYear W19791749522023 @default.
• W1979174952 crossrefType "journal-article" @default.
• W1979174952 hasAuthorship W1979174952A5007045995 @default.
• W1979174952 hasAuthorship W1979174952A5009285209 @default.
• W1979174952 hasAuthorship W1979174952A5024758785 @default.
• W1979174952 hasAuthorship W1979174952A5035803024 @default.
• W1979174952 hasAuthorship W1979174952A5046379137 @default.
• W1979174952 hasBestOaLocation W19791749521 @default.
• W1979174952 hasConcept C113217602 @default.

• next