FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1979697890> ?p ?o ?g. }

• W1979697890 endingPage "11" @default.
• W1979697890 startingPage "9" @default.
• W1979697890 abstract "In 1994, Conrad et al. reported initial results that rekindled the debate about the involvement of an infectious agent in type 1 diabetes. They analyzed the T cell (antigen) receptor repertoire of T lymphocytes that had invaded the pancreatic islets of two recently deceased, acutely diabetic patients. Antigen receptors carrying the Vβ7 variable region were shown to be strikingly enriched in the T cells, evoking the involvement of a superantigen (SAG). Recently5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar (see also 1Benoist C Mathis D Nature. 1997; 388: 833-834Crossref PubMed Scopus (15) Google Scholar) described the isolation of a hitherto unknown endogenous HERV-K10-like retroviral genome, IDDMK1,222, related to mouse mammary tumor virus, whose env gene encoded a SAG. The SAG stimulated Vβ7-bearing T cells, but not those that expressed other Vβ genes. Transcripts derived from, or at least related to, the IDDMK1,222 genome were detectable by RT-PCR in the plasma of 10/10 newly diagnosed type 1 diabetes patients, but not from 10 age-matched, nondiabetic control individuals. In order to detect IDDMK1,222 RNA5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar performed RT-PCR on total RNA purified from EDTA plasma using QIAmp Qiagen Kit. All RT and PCR reagents (1 unit AMV reverse transcriptase, 10 units Rnasin, 0.5 mM DTT, 2.6 units Taq/Pwo, 0.2 mM dNTPs, 300 nM primer, 1× buffer, and 1.6 mM MgCl2) were added to the same reaction tube. The RT reaction was performed at 50°C for 30 min for the generation of cDNA, directly followed by a step-down PCR, in which the annealing temperature (68°C) was reduced by 1.3°C for each of 10 cycles, to 55°C for the remaining 25 cycles. Two sets of oligonucleotide primer were used: U3 (5′ AGGTATTGTCCAAGGTTTCTCC 3′) and R (5′ CTTTACAAAGCAGTATTGCTG 3′ or 5′ GTAAAGGATCAAGTGCTGTGC 3′) or U3-R-poly(A) (5′ TTTTTGAGTCCCCTTAGTATTTATT 3′). They stated that the U3 and R primer detected genomic IDDMK1,222, whereas U3 and R-poly(A) primer detected only viral transcripts. In an attempt to reproduce these latter data, we report here the results of experiments carried out independently in laboratories in Melbourne, Pittsburgh, and London. It must be emphasized that the three laboratories only attempted to reproduce and extend the results of 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar on peripheral blood and not those on the isolation of retroviral particles from islets and islet-infiltrating lymphocytes from patients with type 1 diabetes. In Melbourne, we used the exact protocol of 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar, or modified protocols, to confirm that IDDMK1,222 transcripts are present in the plasma of individuals with preclinical or clinical type 1 diabetes. We purified total RNA from EDTA plasma of two individuals with preclinical type 1 diabetes (a male aged 7 and a female aged 18, each of whom had a sibling with type 1 diabetes and circulating antibodies to the islet antigens, insulin and glutamic acid decarboxylase [GAD]), three recently-diagnosed patients (females age 5, 9, and 10, diagnosed for less than three weeks), and four healthy adult controls. All subjects were of Caucasoid extraction. RT-PCRs, with the 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar protocol and reagents, generated a band of the expected size (489 bp) for IDDMK1,222 with U3-R-poly(A) primer from all samples, but in both the presence and absence of RT. The U3-R-poly(A) primer also generated a 489 bp band from genomic DNA samples. The RT-PCR product hybridized with the U3-R probe, as reported by 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar. However, DNase treatment of the RNA samples prevented generation of the PCR product and its detection by Southern blot. We could not achieve specificity for RNA, by extending 5′ the U3-R-poly(A) primer from four to 11Ts and/or by subtracting eight of the 3′ nucleotides, whereas the Pittsburgh and London laboratories (see below) detected viral RNAs with modified primer, although these were also not disease specific. It should be noted, however, that the various modified primer were not identical. 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar added RT and PCR reagents to the same reaction tube. When we added the PCR reagents after the RT reactions, the yield of the U3-R-poly(A) product significantly increased, but again it was not specific for RNA. The increased yield was most likely due to separation of Pwo, a DNA polymerase with 3′–5′ exonuclease proofreading activity, from the RT reaction. Pwo could degrade primer and dNTPs during the RT section, resulting in a lower yield of PCR product. Finally, we made primer to the SAG sequence of IDDMK1,222 and found also that these amplified only genomic DNA and not DNase-treated RNA samples. Thus, we have not been able to confirm the statement of 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar that “the signal generated with the U3-R-poly(A) primer pair could be diminished below background by RNase treatment and was not detected when genomic DNA was used as a template (data not shown).” In our hands, the U3-R-poly(A) primer pair does not detect transcribed IDDMK1,222 endogenous retrovirus in EDTA plasma. All PCR product from plasma RNA appears to derive from contaminating DNA and is not type 1 diabetes (preclinical or clinical)-specific. Our results do not, however, necessarily refute the proposition that endogenous retroelements, identical or similar to IDDMK1,222, might encode a SAG responsible for skewing of the T cell receptor Vβ repertoire in the islet infiltrate of the type 1 diabetes patients as reported by 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar. In Pittsburgh, in order to extend the results of 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar, we designed primer that amplify the sequence encoding the reported superantigen of IDDMK1,222. The sequences of the primer, CCTCCACGGAGATGGTAA and TCGAGGTGCCTAATCTATAATAGT, matched the sequence in the region of the ATG and TAG, start and stop codons, and were first tested on genomic DNA. Cloning and sequencing of the amplified products yielded eight unique sequences from nine clones, one of which was identical to the reported SAG. We then tested, by RT-PCR, RNA extracted from sera and EDTA plasma and peripheral blood lymphocytes (PBL) of five Caucasoid high-risk individuals (siblings of diabetic probands, carrying type 1 diabetes susceptibility HLA class II alleles, positive for autoantibodies to the islet antigens GAD65 and tyrosine phosphatase IA-2, and with impaired glucose tolerance), ten recent-onset type 1 diabetes patients (within one week of clinical diagnosis) and 12 age-matched nondiabetic controls. Thus, our tested samples came from patients at the same stage of their disease as those tested by 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar. Poly(A)-RNA was separated from total RNA that had first been treated with DNase. It was then reverse transcribed using the R-poly(A) primer described by 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar. After PCR amplification using the above primer, bands of 489 bp were frequently, though not always, found in patient samples (100% of high-risk individuals and 50% of recent-onset patients). Most importantly, however, they were also found in seven out of twelve (58%) of control samples. Cloning and sequencing of the PCR products revealed two dominant sequences, present in some samples from both patients and controls, which were very similar to HERV-K10 and to IDDMK1,222. These sequences mismatched HERV-K10 by 8 and 4 nucleotides and IDDMK1,222 by 8 and 13 nucleotides. None of the clones contained a sequence that exactly matched the IDDMK1,222 sequence. When the PCR was performed with either of two alternative primer, which are downstream of the stop codon, TCCCAAGGGTAGAAAGACTG and the U3-R-poly(A) primer, the same two sequences were again most frequent. In addition, they were found to not encode the stop codon characteristic of IDDMK1,222, but rather the same codon, TGG, which is present in HERV-K10. Again, none of the other less frequently obtained clones matched exactly the IDDMK1,222 sequence. Thus, based on the amplification of purified genomic DNA, we confirmed the presence of an endogenous sequence matching that which would encode the reported superantigen. However, if the corresponding RNA is expressed, it is frequently not the most abundantly expressed HERV-K10-like species and, therefore, may not easily be detected in the presence of the other more abundant sequences. Furthermore, these very similar sequences are not specifically expressed in type 1 diabetes, as they are frequently detected in control samples. We do not interpret these findings to necessarily negate a potential etiological role of retroviruses or superantigens in type 1 diabetes, rather to question the epidemiologic value of nonspecific retroviral sequence detection in patients’ plasma. In London, we initially performed survey studies, by means of genomic PCR and RT-PCR based on the published primer sequences from the IDDMK1,222 novel retroviral genome. Genomic DNA was subjected to PCR with the U3 and R primer. Primer U3 R1 and U3 R2 amplified products of the size described by 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar (300 and 395 bp) on DNA samples extracted from PBL of 10 age-matched normal individuals and five newly diagnosed (within one week of clinical onset) type 1 diabetes patients. The patients, two Caucasoids and three Africans, were sero-positive for islet cell antibodies (ICA), by indirect immunofluorescence on sections of human blood group 0 pancreas, and for antibodies to GAD and tyrosine phosphatase IA-2, and all carried type 1 diabetes susceptibility HLA class II alleles. Subsequently, the U3-R-poly(A) primer amplified the expected product of 489 bp by RT-PCR on RNA extracted from PBL of four out of five newly diagnosed patients. However, ribonuclease A treatment did not prevent amplification, suggesting the presence of DNA contamination in the samples. Ribonuclease treatment eliminated the RT-PCR product from positive control RNA (supplied in Access RT-PCR Kit, cat. no 1260, Promega, USA). The U3-R-poly(A) primer also amplified a product of 489 bp, using the same PCR conditions, but without the RT step, on DNA extracted from the same PBL of newly diagnosed patients. When an RNA sample positive in RT-PCR with the U3-R-poly(A) primer was pretreated with RNase-free DNase, the 489 bp product was eliminated. With the same conditions, it was still possible to obtain amplification from the positive control RNA, showing that the elimination of the signal was not due to RNase contaminating the DNase. Hence, in our hands, the U3-R-poly(A) primer amplified DNA and we suggest that the amplification we observed in our RT-PCR samples was due to trace contamination of DNA. The same RT-PCR conditions were used with the U3 primer and a novel viral RNA-specific oligo-dT primer of the sequence 5′–3′ TTTTTTTTTTTTTTTTTTTTGAGTC. A product of approximately 489 bp size was obtained with RNA from two out of three PBL samples from newly diagnosed patients and was eliminated by ribonuclease treatment. In order to confirm specificity for RNA, PCR was performed without the RT step and was negative on DNA from the same PBL. The same RT-PCR conditions were also applied using the U3 primer together with a long oligo dT primer [5′ pd(T)25–30 3′]. A product of approximately 489 bp was again obtained with the same PBL RNA from two out of three newly diagnosed patients. PCR performed on DNA in the same conditions, but without the RT step, detected a product of the same size in one out of five samples of newly diagnosed patients. This sample was also positive in RT-PCR and possibly contains an integrated (endogenous) retrovirus with poly(A) tail. When RNA from PBL of normal individuals were analyzed, with either the U3-oligo dT virus–specific primer or the oligo dT 25–30 primer, products of approximately 489 bp were obtained in two of three and three of three cases, respectively; i.e., the product, in this case, was not disease specific. In summary, our experiments indicate that the U3-R-poly(A) primer described by 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar are not RNA specific, but also amplify DNA, and we could detect viral RNA sequences in both newly diagnosed type 1 diabetes patients and normal controls using our modified RNA-specific primer. RNA transcripts for multiple endogenous retroviral elements are expressed in normal and disease tissues (7Nakagawa K Brusic V McColl G Harrison L.C Arthritis Rheum. 1997; 40: 627-638Crossref PubMed Scopus (74) Google Scholar). The genomic complexity and multiple potential pathogenic mechanisms of endogenous retroviruses (6Nakagawa K Harrison L.C Immunol. Rev. 1996; 152: 193-236Crossref PubMed Google Scholar) suggest that experimental strategies will need to be refined, in order to unravel their possible involvement in the pathogenesis of type 1 diabetes (2Bottazzo G.F Diabetes. 1993; 42: 778-780Crossref PubMed Google Scholar). We are unable to confirm that the strategy of 5Conrad B Weissmahr R.N Boeni J Arcari R Schuepbach J Mach B Cell. 1997; 90: 303-313Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar identifies type 1 diabetes–specific, novel IDDMK1,222 retroviral RNA in plasma.†To whom correspondence should be addressed. Present address: Ospedale Pediatrico Bambino Gesú, Scientific Institute, Direzione Scientifica, via Piazza S Onofrio, 4, 00165 Roma, Italy." @default.
• W1979697890 created "2016-06-24" @default.
• W1979697890 creator A5000556027 @default.
• W1979697890 creator A5016972680 @default.
• W1979697890 creator A5017682705 @default.
• W1979697890 creator A5020535138 @default.
• W1979697890 creator A5048489283 @default.
• W1979697890 creator A5049193991 @default.
• W1979697890 creator A5054476462 @default.
• W1979697890 creator A5068233343 @default.
• W1979697890 date "1998-10-01" @default.
• W1979697890 modified "2023-10-11" @default.
• W1979697890 title "Retroviral Superantigens and Type 1 Diabetes Mellitus" @default.
• W1979697890 cites W1484594808 @default.
• W1979697890 cites W1974920235 @default.
• W1979697890 cites W2011658300 @default.
• W1979697890 cites W2041820353 @default.
• W1979697890 cites W2053449767 @default.
• W1979697890 cites W2087303623 @default.
• W1979697890 cites W2410942595 @default.
• W1979697890 doi "https://doi.org/10.1016/s0092-8674(00)81775-4" @default.
• W1979697890 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9778241" @default.
• W1979697890 hasPublicationYear "1998" @default.
• W1979697890 type Work @default.
• W1979697890 sameAs 1979697890 @default.
• W1979697890 citedByCount "48" @default.
• W1979697890 countsByYear W19796978902017 @default.
• W1979697890 countsByYear W19796978902018 @default.
• W1979697890 crossrefType "journal-article" @default.
• W1979697890 hasAuthorship W1979697890A5000556027 @default.
• W1979697890 hasAuthorship W1979697890A5016972680 @default.
• W1979697890 hasAuthorship W1979697890A5017682705 @default.
• W1979697890 hasAuthorship W1979697890A5020535138 @default.
• W1979697890 hasAuthorship W1979697890A5048489283 @default.
• W1979697890 hasAuthorship W1979697890A5049193991 @default.
• W1979697890 hasAuthorship W1979697890A5054476462 @default.
• W1979697890 hasAuthorship W1979697890A5068233343 @default.
• W1979697890 hasBestOaLocation W19796978901 @default.
• W1979697890 hasConcept C134018914 @default.
• W1979697890 hasConcept C159047783 @default.
• W1979697890 hasConcept C203014093 @default.
• W1979697890 hasConcept C2776090121 @default.
• W1979697890 hasConcept C2781232474 @default.
• W1979697890 hasConcept C36333154 @default.
• W1979697890 hasConcept C54355233 @default.
• W1979697890 hasConcept C555293320 @default.
• W1979697890 hasConcept C86803240 @default.
• W1979697890 hasConcept C8891405 @default.
• W1979697890 hasConceptScore W1979697890C134018914 @default.
• W1979697890 hasConceptScore W1979697890C159047783 @default.
• W1979697890 hasConceptScore W1979697890C203014093 @default.
• W1979697890 hasConceptScore W1979697890C2776090121 @default.
• W1979697890 hasConceptScore W1979697890C2781232474 @default.
• W1979697890 hasConceptScore W1979697890C36333154 @default.
• W1979697890 hasConceptScore W1979697890C54355233 @default.
• W1979697890 hasConceptScore W1979697890C555293320 @default.
• W1979697890 hasConceptScore W1979697890C86803240 @default.
• W1979697890 hasConceptScore W1979697890C8891405 @default.
• W1979697890 hasIssue "1" @default.
• W1979697890 hasLocation W19796978901 @default.
• W1979697890 hasLocation W19796978902 @default.
• W1979697890 hasOpenAccess W1979697890 @default.
• W1979697890 hasPrimaryLocation W19796978901 @default.
• W1979697890 hasRelatedWork W1970480987 @default.
• W1979697890 hasRelatedWork W2022168473 @default.
• W1979697890 hasRelatedWork W2031687972 @default.
• W1979697890 hasRelatedWork W2083701588 @default.
• W1979697890 hasRelatedWork W2084224278 @default.
• W1979697890 hasRelatedWork W2106141910 @default.
• W1979697890 hasRelatedWork W2121410724 @default.
• W1979697890 hasRelatedWork W2416756889 @default.
• W1979697890 hasRelatedWork W4246185469 @default.
• W1979697890 hasRelatedWork W2021372997 @default.
• W1979697890 hasVolume "95" @default.
• W1979697890 isParatext "false" @default.
• W1979697890 isRetracted "false" @default.
• W1979697890 magId "1979697890" @default.
• W1979697890 workType "article" @default.