FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1979969648> ?p ?o ?g. }

• W1979969648 endingPage "30243" @default.
• W1979969648 startingPage "30236" @default.
• W1979969648 abstract "The SeqA protein regulates chromosome initiation and is involved in segregation in Escherichia coli. One SeqA protein binds to two hemi-methylated GATC sequences to form a stable SeqA-DNA complex. We found that binding induced DNA bending, which was pronounced when the two sequences were on the same face of the DNA. Two SeqA molecules bound cooperatively to each pair of hemi-methylated sites when the spacing between the sites was <30 bp. This cooperative binding was able to stabilize the binding of a wild type to a single hemi-methylated site, or mutant form of SeqA protein to hemi-methylated sites, although such binding did not occur without cooperative interaction. Two cooperatively bound SeqA molecules interacted with another SeqA bound up to 185 bp away from the two bound SeqA proteins, and this was followed by aggregation of free SeqA proteins onto the bound proteins. These results suggest that the stepwise interaction of SeqA proteins with hemi-methylated GATC sites enhances their interaction and leads to the formation of SeqA aggregates. Cooperative interaction followed by aggregation may be the driving force for formation of the SeqA foci that appear to be located behind replication forks. The SeqA protein regulates chromosome initiation and is involved in segregation in Escherichia coli. One SeqA protein binds to two hemi-methylated GATC sequences to form a stable SeqA-DNA complex. We found that binding induced DNA bending, which was pronounced when the two sequences were on the same face of the DNA. Two SeqA molecules bound cooperatively to each pair of hemi-methylated sites when the spacing between the sites was <30 bp. This cooperative binding was able to stabilize the binding of a wild type to a single hemi-methylated site, or mutant form of SeqA protein to hemi-methylated sites, although such binding did not occur without cooperative interaction. Two cooperatively bound SeqA molecules interacted with another SeqA bound up to 185 bp away from the two bound SeqA proteins, and this was followed by aggregation of free SeqA proteins onto the bound proteins. These results suggest that the stepwise interaction of SeqA proteins with hemi-methylated GATC sites enhances their interaction and leads to the formation of SeqA aggregates. Cooperative interaction followed by aggregation may be the driving force for formation of the SeqA foci that appear to be located behind replication forks. The adenine residues of GATC sequences in Escherichia coli are methylated on their 6 amino group by Dam methyltransferase (1Geier G.E. Modrich P. J. Biol. Chem. 1979; 254: 1408-1413Abstract Full Text PDF PubMed Google Scholar, 2Campbell J.L. Kleckner N. Cell. 1990; 62: 967-979Abstract Full Text PDF PubMed Scopus (361) Google Scholar). Upon replication, the GATC sequences on the newly replicated strand remain transiently unmethylated, leading to a hemi-methylated state of the DNA duplex. The new strand is subsequently methylated by Dam, and the duplex becomes methylated on both strands. The initiation of chromosome replication at the origin of chromosomal replication (oriC), 1The abbreviations used are: oriC, origin of chromosomal replication; OP-Cu(II), 1,10-phenanthroline-copper (II).1The abbreviations used are: oriC, origin of chromosomal replication; OP-Cu(II), 1,10-phenanthroline-copper (II). which contains repeated GATC sequences, is tightly controlled (3Messer W. Weigel C. Neidhardt F.C. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. 2nd Ed. American Society for Microbiology, Washington, D. C.1996: 1580-1582Google Scholar, 4Kornberg A. Baker T.A. DNA Replication. 2nd Ed. W. H. Freeman and Co., New York1992: 521-524Google Scholar). Once initiation is fired, reinitiation from the newly formed oriC is prevented by an oriC sequestration process affected by the binding of SeqA protein to the newly replicated, hemi-methylated origin (5Lu M. Campbell J.L. Boye E. Kleckner N. Cell. 1994; 77: 413-426Abstract Full Text PDF PubMed Scopus (410) Google Scholar, 6Kang S. Lee H. Han J.S. Hwang D.S. J. Biol. Chem. 1999; 274: 11463-11468Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). The hemimethylated state of the replicated oriC is maintained for about one-third of the cell cycle, whereas it persists in other chromosomal regions for at most 2 min. Further, the asynchronous and overinitiation of chromosomal replication characteristic of seqA mutants indicates that SeqA is a negative modulator of chromosomal initiation at oriC (5Lu M. Campbell J.L. Boye E. Kleckner N. Cell. 1994; 77: 413-426Abstract Full Text PDF PubMed Scopus (410) Google Scholar, 7Boye E. Stokke T. Kleckner N. Skarstad K. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12206-12211Crossref PubMed Scopus (159) Google Scholar). Topoisomerase IV is essential for decatenating and segregating replicated chromosomes at cell division (8Kato J. Nishimura Y. Yamada M. Suzuki H. Hirota Y. J. Bacteriol. 1988; 170: 3967-3977Crossref PubMed Google Scholar, 9Kato J. Nishimura Y. Imamura R. Niki H. Hiraga S. Suzuki H. Cell. 1990; 63: 393-404Abstract Full Text PDF PubMed Scopus (434) Google Scholar, 10Adams D.E. Shekhtman E.M. Zechiedrich E.L. Schmid M.B. Cozzarelli N.R. Cell. 1992; 71: 277-288Abstract Full Text PDF PubMed Scopus (274) Google Scholar, 11Zechiedrich E.L. Cozzarelli N.R. Genes Dev. 1995; 9: 2859-2869Crossref PubMed Scopus (214) Google Scholar, 12Hiasa H. Marians K.J. J. Biol. Chem. 1996; 271: 21529-21535Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Together with DNA gyrase, it also removes the positive supercoils that accumulate in front of replication forks and growing mRNA transcripts. SeqA has been shown to promote the relaxation and decatenating activity of topoisomerase IV (13Kang S. Han J.S. Park J.H. Skarstad K. Hwang D.S. J. Biol. Chem. 2003; 278: 48779-48785Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). This appears to result from a specific interaction between topoisomerase IV and SeqA. Besides the asynchrony and overinitiation of chromosomal replication, seqA mutants have an aberrant nucleoid structure, an increased frequency of abnormal segregation, and increased negative superhelicity of chromosomal and plasmid DNA (5Lu M. Campbell J.L. Boye E. Kleckner N. Cell. 1994; 77: 413-426Abstract Full Text PDF PubMed Scopus (410) Google Scholar, 14Hiraga S. Ichinose C. Niki H. Yamazoe M. Mol. Cell. 1998; 1: 381-387Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 15Weitao T. Nordstrom K. Dasgupta S. Mol. Microbiol. 1999; 34: 157-168Crossref PubMed Scopus (88) Google Scholar, 16Weitao T. Nordstrom K. Dasgupta S. EMBO Rep. 2000; 1: 494-499Crossref PubMed Scopus (70) Google Scholar). These findings suggest that interaction with SeqA is required for proper functioning of topoisomerase IV in vivo. In addition, SeqA functions as a transcriptional regulator of the bacteriophage λpR promoter (17Slominska M. Wegrzyn A. Konopa G. Skarstad K. Wegrzyn G. Mol. Microbiol. 2001; 40: 1371-1379Crossref PubMed Scopus (29) Google Scholar). The SeqA protein exists as a homotetramer of 21-kDa polypeptides (18Lee H. Kang S. Bae S.H. Choi B.S. Hwang D.S. J. Biol. Chem. 2001; 276: 34600-34606Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). The N-terminal region of SeqA (SeqA-N; amino acid residues 1–50) is responsible for its tetrameric property and for aggregation of the protein (18Lee H. Kang S. Bae S.H. Choi B.S. Hwang D.S. J. Biol. Chem. 2001; 276: 34600-34606Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar, 19Guarné A. Zhao Q. Ghirlando R. Yang W. Nat. Struct. Biol. 2002; 9: 839-843PubMed Google Scholar, 20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar), whereas the C-terminal region (SeqA-C; 51–181) binds to hemi-methylated GATC sequences (19Guarné A. Zhao Q. Ghirlando R. Yang W. Nat. Struct. Biol. 2002; 9: 839-843PubMed Google Scholar, 21Fujikawa N. Kurumizaka H. Yamazoe M. Hiraga S. Yokoyama S. Biochem. Biophys. Res. Commun. 2003; 300: 699-705Crossref PubMed Scopus (9) Google Scholar, 22Fujikawa N. Kurumizaka H. Nureki O. Tanaka Y. Yamazoe M. Hiraga S. Yokoyama S. Nucleic Acids Res. 2004; 32: 82-92Crossref PubMed Scopus (19) Google Scholar). SeqA-C interacts via hydrogen bonds and van der Waals contacts with the major groove of DNA, with the hemi-methylated A-T base pair and also with the surrounding bases and DNA backbone. The NMR structure of hemi-methylated GATC revealed that it has an unusual backbone structure and a remarkably narrow major groove and suggested that this peculiar structural feature might contribute to recognition of hemi-methylated GATC sites by SeqA protein (23Bae S.H. Cheong H.K. Cheong C. Kang S. Hwang D.S. Choi B.S. J. Biol. Chem. 2003; 278: 45987-45993Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). To form a stable SeqA-DNA complex in the presence of competitor DNA, one SeqA tetramer binds to each of two hemi-methylated GATC sequences (20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar) that are up to 31 bases apart on the DNA (24Brendler T. Sawitzke J. Sergueev K. Austin S. EMBO J. 2000; 19: 6249-6258Crossref PubMed Scopus (101) Google Scholar). The sequential binding of SeqA tetramers to hemi-methylated sites leads to the formation of higher order complexes (20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Further, the binding of SeqA proteins to at least six adjacent hemi-methylated sites induces the aggregation of free proteins onto the bound proteins, thus implying cooperative interaction between the SeqA proteins. Such aggregation may be responsible for the SeqA foci that have been visualized by immunofluorescence microscopy and by expression of a SeqA-green fluorescent protein (GFP) fusion protein (14Hiraga S. Ichinose C. Niki H. Yamazoe M. Mol. Cell. 1998; 1: 381-387Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 24Brendler T. Sawitzke J. Sergueev K. Austin S. EMBO J. 2000; 19: 6249-6258Crossref PubMed Scopus (101) Google Scholar, 25Onogi T. Niki H. Yamazoe M. Hiraga S. Mol. Microbiol. 1999; 31: 1775-1782Crossref PubMed Scopus (92) Google Scholar, 26Hiraga S. Ichinose C. Onogi T. Niki H. Yamazoe M. Genes Cells. 2000; 5: 327-341Crossref PubMed Scopus (106) Google Scholar, 27Bach T. Krekling M.A. Skarstad K. EMBO J. 2003; 22: 315-323Crossref PubMed Scopus (54) Google Scholar). These foci appear to track the replication fork, and their number is proportional to growth rate (24Brendler T. Sawitzke J. Sergueev K. Austin S. EMBO J. 2000; 19: 6249-6258Crossref PubMed Scopus (101) Google Scholar). Here, we show that binding of SeqA to hemi-methylated DNA induces a conformational change of the DNA; the bound SeqA proteins interact cooperatively with each other, which increases their tendency to interact and aggregate. Materials—Sources were as follows: restriction enzymes and cloning enzymes, Promega; [γ-32P]ATP (5000 Ci/mmol) and poly(dI-dC), Amersham Biosciences; T4 polynucleotide kinase, New England Biolabs; Pyrobest DNA polymerase and T4 DNA ligase, Takara; QIAEX II gel extraction kit, Qiagen; site-directed mutagenesis kit, Invitrogen; and unmethylated and methylated synthetic oligonucleotides, Genotech. Unless otherwise indicated, additional reagents were from Sigma. Bacterial Strains and Plasmid DNA—E. coli strain Top10F′ (Invitrogen) was used for cloning and preparing fully methylated plasmid DNA, and the GM3819(dam16:K rm) strain (28Boye E. Løbner-Olesen A. Cell. 1990; 62: 981-989Abstract Full Text PDF PubMed Scopus (173) Google Scholar) was used for preparing unmethylated plasmid DNA. E. coli BL21 (29Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar) was used for overproducing wild-type SeqA protein and E. coli W3SQT(seqA::Tetr) (20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar) for overproducing mutant SeqA proteins. The pBend2 plasmid (30Zwieb C. Kim J. Adhya S. Genes Dev. 1989; 3: 606-611Crossref PubMed Scopus (73) Google Scholar) was a gift from Dr. Adhya. The pBMA1 (31Hwang D.S. Kornberg A. Cell. 1990; 63: 325-331Abstract Full Text PDF PubMed Scopus (58) Google Scholar) and pFToriC (32Hwang D.S. Kornberg A. J. Biol. Chem. 1992; 267: 23083-23086Abstract Full Text PDF PubMed Google Scholar) plasmids have been previously described. Proteins—The mutant forms of seqA were constructed by site-directed mutagenesis as previously described (18Lee H. Kang S. Bae S.H. Choi B.S. Hwang D.S. J. Biol. Chem. 2001; 276: 34600-34606Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). Wild-type SeqA and mutant proteins were expressed and purified from BL21(pLys, pSS1) (6Kang S. Lee H. Han J.S. Hwang D.S. J. Biol. Chem. 1999; 274: 11463-11468Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar) and W3SQT (pBAD18-SeqA(K66E-R70E)), respectively, as previously described (24Brendler T. Sawitzke J. Sergueev K. Austin S. EMBO J. 2000; 19: 6249-6258Crossref PubMed Scopus (101) Google Scholar). Crude fractions of W3SQT harboring plasmids overproducing the mutant proteins SeqA(E9K) or SeqA(E5,9K) were prepared according to Lee et al. (18Lee H. Kang S. Bae S.H. Choi B.S. Hwang D.S. J. Biol. Chem. 2001; 276: 34600-34606Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar) with minor modifications. E. coli W3SQT cells harboring the indicated seqA mutant in pBAD18 (33Guzman L.M. Belin D. Carson M.J. Beckwith J. J. Bacteriol. 1995; 177: 4121-4130Crossref PubMed Scopus (3876) Google Scholar), or pBAD18 alone, were grown in LB medium to an optical density at 600 nm of 0.3–0.4, followed by the addition of l-(+)-arabinose to a concentration of 0.1%. Three hours after induction, the cells were harvested and resuspended in 25 mm HEPES (pH 7.8), 1 mm EDTA, and 1 mm dithiothreitol. Cells were lysed and the proteins partially purified as described (34Lee H. Kim H.K. Kang S. Hong C.B. Yim J. Hwang D.S. Mol. Gen. Genet. 2001; 264: 931-935Crossref PubMed Google Scholar). DNAs Containing Hemi-methylated Sites—The synthetic 75-bp DNA fragments containing two hemi-methylated sites with variable spacing are described in Table I. These were obtained by annealing synthetic oligomers, top strand (5′-ctgggtattaaaaagaagatctatttatttagagatctgttctattgtgatctcttattaggatcgcactgccct-3′) and bottom strand (5′-agggcagtgcgatcctaataagagatcacaatagaacagatctctaaataaatagatcttctttttaatacccag-3′). The GATC sequences are underlined, and the N6-methyladenine bases within the GATC sequences of the B-strand are indicated in the corresponding figures. The DNAs containing four hemi-methylated sites with variable spacing (Figs. 2 and 3C) between the second and third GATC sequences are described in Table II and the DNAs containing six hemi-methylated sites with variable spacing (Fig. 5) between the third and fourth GATC sequences are described in Table III. The hemi-methylated DNAs were obtained by annealing synthetic oligomers.Table ISynthetic 75-bp DNAs with variable spacing between hemi-methylated sitesSpacingDNA sequencesbp115′-ctgggtattaaaaagaagatctatttatgatcagttctgttctgttctgttctcttattaggctcgcactgccct-3′5′-agggcagtgcgagcctaataagagaacagaacagaacagaactgatcataaatagatcttctttttaatacccag-3′165′-ctgggtattaaaaagaagatctatttatgttcagatctgttctgttctgttctcttattaggctcgcactgccct-3′5′-agggcagtgcgagcctaataagagaacagaacagaacagatctgaacataaatagatcttctttttaatacccag-3′215′-ctgggtattaaaaagaagatctatttatgttcagttctgatctgttctgttctcttattaggctcgcactgccct-3′5′-agggcagtgcgagcctaataagagaacagaacagatcagaactgaacataaatagatcttctttttaatacccag-3′265′-ctgggtattaaaaagaagatctatttatgttcagttctgttctgatatgatctcttattaggctcggagtgccct-3′5′-agggcagtgcgagcctaataagagaacagatcagaacagaactgaacataaatagatcttctttttaatacccag-3′315′-ctgggtattaaaaagaagatctatttatgttcagttctgttctgttctgatctcttattaggctcgcactgccct-3′5′-agggcagtgcgagcctaataagagatcagaacagaacagaactgaacataaatagatcttctttttaatacccag-3′ Open table in a new tab Fig. 3Cooperative binding of SeqA to hemi-methylated DNA. A, synthetic 75 bp DNAs of identical sequence but having one to four N6-methyladenine bases within the GATC sequences on the bottom strand (20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar) were used for gel-shift assays. SeqA (0, 0.5, 1, 2, 4, 8, 16, and 32 ng) was added to reaction mixtures containing the indicated DNAs. Unmethylated and methylated GATC sequences on the bottom strands are indicated by open and closed circles, respectively. SMC and FMC indicate slow and fast mobility complexes, respectively. The amounts of SMCs and FMCs formed were measured and are plotted in B. C, adenine bases in the fourth GATC site of the hemi-methylated DNAs used in Fig. 2A were changed to thymine. 0 (lane 1), 10 (lanes 2, 7, and 12), 20 (lanes 3, 8, and 13), 40 (lanes 4, 9, and 14), and 60 ng (lanes 5, 10, 15–18) of SeqA were added to reaction mixtures containing the indicated DNA. The number of nucleotides between the adenines of the second and third GATC sequences is indicated.View Large Image Figure ViewerDownload (PPT)Table IIDNA containing four hemi-methylated DNAs with variable spacing between the second and third hemi-methylated GATC sitesSpacingDNA sequencesRestriction sites125′-gatccgactgtgatccatggccggatctcttattacgatccaattgtaccaagctactgg-3′SacI/KpnI5′-aattccagtagcttggtacaattggatcgtaataagagatccggccatggatcacagtcg-3′165′-gatccgactgtgatccatggagctagcgatctcttattacgatccaattgtaccaagctactgg-3′SacI/KpnI5′-aattccagtagcttggtacaattggatcgtaataagagatcgctagctccatggatcacagtcg-3′195′-gatccgactgtgatccatggccgagctagcgatctcttattacgatccaattgtaccaagctactgg-3′SacII/KpnI5′-aattccagtagcttggtacaattggatcgtaataagagatcgctagctcggccatggatcacagtcg-3′245′-catggggatgaggag-3′SacII/ApaI5′-ctagctcctcatccc-3′275′-catggggactatgaggag-3′SacII/ApaI5′-ctagctcctcatagtccc-3′305′-catggggacagctatgaggag-3′XbaI/KpnI5′-ctagctcctcatagctgtccc-3′325′-catggggaaacagctatgaggag-3′XbaI/KpnI5′-ctagctcctcatagctgtttccc-3′355′-catggggaaacagctatgaggatgag-3′XbaI/KpnI5′-ctagctcatcctcatagctgtttccc-3′415′-catggggaaacagctatgaggatgagtacgcg-3′XbaI/ApaI5′-ctagcgcgtactcatcctcatagctgtttccc-3′505′-catggggaaacagctatgaggatgagtacgccatgagcgcg-3′XbaI/XhoI5′-ctagcgcgctcatggcgtactcatcctcatagctgtttccc-3′605′-catggggaaacagctatgaggatgagtacgccatgagcgcaatcacgccg-3′XbaI/SalI5′-ctagcggcgtgattgcgctcatggcgtactcatcctcatagctgtttccc-3′715′-catggggaaacagctatgaggatgagtacgccatgagcgcaatcacgccctatagtgactcg-3′XbaI/HindIII5′-ctagcgagtcactatagggcgtgattgcgctcatggcgtactcatcctcatagctgtttccc-3′ Open table in a new tab Fig. 5Stepwise interaction of SeqA proteins bound on hemimethylated DNA. A, number of nucleotides between the third and fourth GATC sequences on the DNA containing six hemi-methylated sites is indicated. The DNAs used are described in Table III. SeqA (0, 6.25, 12.5, 25, and 100 ng) was added to reaction mixtures containing the indicated DNAs. DNA-protein complexes containing one, two, and three SeqA tetramers are indicated by I, II, and III, respectively. DNA-protein complexes containing more than three SeqA tetramers are indicated by IV and V. Amounts of V were determined and plotted in B. (+/–) and (+/+) indicate hemi- and fully methylated, respectively. C, adenine bases in the second or both the first and the second GATC sequences of the hemi-methylated DNA with 60-bp spacing (see above) were changed to thymine to generate DNAs with five or four hemimethylated GATC sites, respectively. 0 (lanes 1, 6, and 11), 3.5 (lanes 2, 7, and 12), 10 (lanes 3, 8, and 13), 35 (lanes 4, 9, and 14), and 100 ng (lanes 5, 10, and 15) of SeqA were added to reaction mixtures containing the indicated DNA.View Large Image Figure ViewerDownload (PPT)Table IIIDNA containing six hemi-methylated DNAs with variable spacing between the third and fourth hemi-methylated GATC sitesSpacingDNA sequencesbp405′-gatctgggaaacagctatgaggatgagtacgccatgagca-3′5′-gatctgctcatggcgtactcatcctcatagctgtttccca-3′605′-gatctgggaaacagctatgaggatgagtacgccatgagcgcaatcacgccctatagtgaa-3′5′-gatcttcactatagggcgtgattgcgctcatggcgtactcatcctcatagctgtttccca-3′1005′-gatccgtcgacctgcagcggccgcataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgcgcgcttgcagccaagctaattccgga-3′5′-gatctccggaattagcttggctgcaagcgcgcaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttatgcggccgct gcaggtcgacgga-3′1855′-gatccgtcgacctgcagcggccgcataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgcgcgcttgcagccaagctaat tccgggcgaatttcttatgatttatgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttagga-3′5′-gatctcctaagagtcactttaaaatttgtatacacttattttttttataacttatttaataataaaaatcataaatcataagaaattcgcccggaa ttagcttggctgcaagcgcgcaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttatgcggccgctgcaggtcgacgga-3′ Open table in a new tab Gel Shift Assays—Unless otherwise indicated, the 20-μl reaction mixtures contained 10 mm Tris-HCl, pH 7.6, 50 mm KCl, 1 mm EDTA, 1 mm dithiothreitol, 1 μg of poly(dI-dC), 10% glycerol, 5 μg of bovine serum albumin, ∼2 fmol of hemi-methylated DNA, and the specified amount of SeqA protein. These were incubated for 15 min at 32 °C. Subsequent steps have been previously described (6Kang S. Lee H. Han J.S. Hwang D.S. J. Biol. Chem. 1999; 274: 11463-11468Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). 1,10-Phenanthroline-Copper Ion Nuclease in Situ Footprinting— 1,10-phenanthroline-copper (II) (Op-Cu(II)) footprinting was performed as previously described (35Brendler T. Austin S. EMBO J. 1999; 18: 2304-2310Crossref PubMed Scopus (87) Google Scholar, 36Papavassiliou A.G. Kneale G.G. DNA-Protein Interactions: Principles and Protocols. Humana Press Inc., Totowa, NJ1994: 43-78Google Scholar) with minor modifications. The top or bottom strand of synthetic hemi-methylated 75-mer DNAs was 32P end-labeled and incubated with SeqA for 15 min at 30 °C, followed by treatment with 200 μm 1,10-phenanthroline-copper and 5.8 mm 3-mercaptopropionic acid for 35 s at 30 °C. The cleavage reaction was stopped by adding 0.1 volume of 28 mm 2,9-dimethyl-1,10-phenanthroline. SeqA-bound DNA and free DNA were separated by polyacrylamide gel electrophoresis (5% w/v). Subsequent steps were performed as before (37Lee Y.S. Hwang D.S. J. Biol. Chem. 1997; 272: 83-88Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). Binding of SeqA Protein to Two Hemi-methylated GATC Sequences Induces DNA Bending—A SeqA protein as tetramer can bind to two hemi-methylated GATC sequences (20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar) that are separated by up to 31 bp (24Brendler T. Sawitzke J. Sergueev K. Austin S. EMBO J. 2000; 19: 6249-6258Crossref PubMed Scopus (101) Google Scholar). We examined the possibility that the DNA is bent as a result of this event. The DNA fragments used were identical in size but varied in the relative location of a pair of hemi-methylated sites (Fig. 1, A and B). The indicated spacing refers to the number of nucleotides between the N6-methyladenine nucleotides of the GATC sequences. A bend near the center of a DNA fragment maximally retards the electrophoretic mobility of a DNA-protein complex (30Zwieb C. Kim J. Adhya S. Genes Dev. 1989; 3: 606-611Crossref PubMed Scopus (73) Google Scholar). With DNA in which the hemi-methylated sites were separated by 19 bp, so that they were on the same phase of DNA helix, SeqA binding produced a typical DNA-bending pattern. Although bending was not initially apparent with a 16- or 25-bp spacing, such that the two hemi-methylated sites were on opposite phases, a pattern of bent DNA did appear when electrophoresis was continued for longer periods (data not shown). These observations suggest that the extent of bending is dependent on the relative position of the two hemi-methylated sites on the DNA helix and is favored when the two hemi-methylated sites are on the same phase. We compared the affinity of SeqA for DNA containing different spacings between the two hemi-methylated GATC sequences (Fig 1, C and D). Its affinity for hemi-methylated DNA containing an 11-, 21-, or 31-bp spacing was higher than for a 16- and 26-bp spacing. The more efficient binding of SeqA to DNA with the two hemi-methylated sites on the same phase of the DNA helix is in agreement with a previous report (24Brendler T. Sawitzke J. Sergueev K. Austin S. EMBO J. 2000; 19: 6249-6258Crossref PubMed Scopus (101) Google Scholar). Therefore, the phase difference between the two hemi-methylated GATC sequences affects the affinity of SeqA for it as well as DNA bending. Interaction between Two SeqA Proteins Bound on Hemimethylated DNA—We analyzed the interaction between SeqA proteins bound to each of two hemi-methylated GATC sequences by employing DNA containing four hemi-methylated sites (Fig. 2). The spacing between the first and second and between the third and fourth sites was fixed, while the spacing between the second and third sites varied. The lengths of the DNAs were similar, with no more than 4 bp difference (Table I). SeqA formed fast and slow mobility complexes with all of these DNAs (Fig. 2, A and B). We showed previously that the fast and slow mobility complexes are formed by binding one and two molecules of SeqA, respectively, (20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). The fast mobility complexes migrated similarly regardless of the spacing. The slow mobility complexes involving DNA with spacing of >30 bp also migrated at similar rates whereas the slow mobility complexes involving spacing of ≤30 bp migrated at different rates. If the bound SeqA proteins interacted, these complexes would each have a unique nucleoprotein structure, thereby migrating differently through the polyacrylamide gel. The absence of any difference in the migration of the slow mobility complexes formed with spacings of >30 bp suggests that the SeqA proteins bound to those DNAs did not interact. More slow mobility complexes were formed with DNA having a spacing of 19 or 27 bp than with DNA with a spacing of 32 bp (Fig. 2C), supporting the idea that SeqA binds cooperatively to DNA with a spacing of ≤30 bp. The altered migration and efficient formation of slow mobility complexes when the spacing between the two sites is ≤30 bp indicated that the SeqA proteins bound to each pair of hemi-methylated sites interact. Interactions between SeqA Proteins Stabilize the Unstable Binding of SeqA to a Hemi-methylated Site—The binding of a SeqA tetramer to a pair of hemi-methylated GATC sequences yielded a fast mobility complex when the DNA contained two sites, but not to any significant extent when it contained only one site (20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). We therefore compared the binding of SeqA to four synthetic oligonucleotides containing identical sequences but with one, two, three, or four N6-methyladenine residues within the GATC sequences on one strand (Fig. 3, A and B). Formation of fast mobility complexes increased with the number of hemi-methylated GATC sequences. Furthermore a new slow mobility complex that contained two SeqA proteins appeared with three hemi-methylated sites, and formation of this complex was enhanced with four hemi-methylated sites. Evidently the formation of a slow mobility complex by binding of SeqA to DNA containing three hemi-methylated sites is more favorable than formation of the fast mobility complex with DNA containing one hemi-methylated site, although these complexes result from the binding of one SeqA to one hemimethylated site. The greater efficiency with which the slow mobility complex is formed in the first case suggests that the SeqA tetramers bound to two hemi-methylated sites on the DNA facilitate or stabilize the binding of the additional SeqA to an unbound hemi-methylated site. To examine this cooperative binding, we varied the spacing between the second and third hemi-methylated site (Fig. 3C), and we changed the un-methylated GATC sequence at the fourth site to a GTTC sequence to prevent any possible contribution from it. Slow mobility complexes were formed with spacings of 12 and 19 bp, but not when the spacing was greater. This shows that the SeqA proteins bound to two hemi-methylated sites are able to facilitate the binding of an additional SeqA to the third hemi-methylated site but only when the third site was separated from the second by <32 bp. This conclusion is of course consistent with our finding that the cooperative interaction between two SeqA proteins bound to hemi-methylated DNA requires a spacing of ≤30 bp (Fig. 2). Interactions between SeqA Proteins Stabilize the Unfavorable Binding of Mutant SeqA Proteins to Hemi-methylated Sites— SeqA(E9K) protein, in which a Glu-9 is substituted for a Lys, is not able to form fast mobility complexes, only slow mobility complexes, with DNA containing four hemi-methylated sites (18Lee H. Kang S. Bae S.H. Choi B.S. Hwang D.S. J. Biol. Chem. 2001; 276: 34600-34606Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). The introduction of the additional change of Lys for Glu-5 abolished formation of the slow mobility complex (Fig. 4A). Because instability of SeqA(E5,9K) hampered its purification, a partially purified fraction obtained from a seqA-null mutant harboring a SeqA(E5,9K)-overproducing plasmid was used for binding assays. To compensate for any effect of contaminating proteins, the assays were controlled by addition of a partially purified fraction prepared from the seqA-null mutant-containing vector. Despite its inability to bind to hemi-methylated sites, SeqA(E5,9K) could convert the fast mobility complex formed by SeqA to a slow mobility complex (Fig. 4B), indicating that SeqA bound to hemi-methylated sites helps SeqA(E5,9K) bind to additional sites. To throw further light on the binding of SeqA(E5,9K) as a result of interaction with SeqA, we used SeqA(K66E/R70E), which forms complexes that migrate more rapidly, in place of SeqA. The substitutions of Lys-66 and Arg-70 with glutamates might increase the electronegativity of SeqA and lead to the faster migration of the SeqA(E5,9K)-DNA complexes (Fig. 4C, lanes 2 and 4; Ref. 20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Slow mobility complexes exhibiting an intermediate mobility were formed by the binding of one SeqA protein to a pair of hemi-methylated sites together with binding of one SeqA(K66E/R70E) protein to the other pair of hemimethylated sites (lane 3). Incubation of SeqA(E5,9K) together with SeqA(K66E/R70E) generated a slow mobility complex of the same intermediate mobility (lanes 5 and 6) as the complex formed by SeqA plus SeqA(K66E/R70E). The similarity of the OP-Cu(II) footprints of the slow mobility complexes formed by SeqA, SeqA(K66E/R70E), and the mixture of SeqA(K66E/R70E) and SeqA(E5,9K) indicated that SeqA(E5,9K) is bound to two hemi-methylated sites in the slow mobility complex (Fig. 4D). Thus, despite the inability of SeqA(E5,9K) to bind to hemi-methylated sites on its own, the fact that it is able to bind to hemi-methylated sites when present together with SeqA or SeqA(K66E/R70E) implies that the cooperative interaction of SeqA proteins on the hemi-methylated sites stabilizes binding that would otherwise not be possible. Stepwise Interaction of SeqA Proteins Bound to Hemi-methylated DNA Augments Their Ability to Interact—A SeqA molecule bound to two hemi-methylated sites is able to interact cooperatively with a molecule on another site separated from it by up to 30 bp (Figs. 2 and 3). We next examined the interaction of two SeqA proteins cooperatively bound on four hemi-methylated sites with an additional SeqA using DNAs containing six hemi-methylated sites in which the spacing between the second and third sites was varied, while the spacing between all the other sites was fixed (Fig. 5). As the amount of SeqA was increased, the binding of a SeqA to pairs of hemi-methylated sites was observed to result in the sequential formation of three discrete complexes (complex I, II, and III) (Fig. 5A). After these three complexes were formed, there appeared larger complexes in both the upper region of the gel (complex IV) and the well (complex V). The formation of the large complexes is in agreement with our previous finding that SeqA proteins bound to six or more adjacent hemi-methylated sites tend to form aggregates with the free proteins (20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). The absence of both the discrete and the large complexes when the GATC sequences were fully methylated demonstrates that the formation of these complexes is dependent upon hemi-methylation. Quantification of the large complexes (complex V) (Fig. 5B) showed that for a spacing of up to 60 bp between the second and third sites, the yield of the large complex was constant; thereafter, increased spacing resulted in a reduction in the yield. We then changed one or two of the GATC sequences at the left end of the DNA that were separated by 60 bp to GTTC sequences (Fig. 5C). With six hemi-methylated sites, increasing amounts of SeqA generated complexes I, II, and III followed by the large complexes, as shown in Fig. 5A. The DNA with five hemi-methylated sites produced complexes similar to the above except for the inefficient formation of complex III. With only four hemi-methylated sites, only complexes I and II containing one and two SeqA proteins, respectively, were formed. In summary, a SeqA tetramer bound to two hemi-methylated sites interacts cooperatively with another SeqA bound at a distance of ≤30 bp (see Fig. 6). The cooperative interaction between these two SeqA proteins enhances their capacity for interaction, thereby favoring the formation of a larger complex involving another SeqA bound up to 200 bp from the leftmost binding site. Such interaction between three bound SeqA proteins triggers the further aggregation of free proteins with the bound proteins, generating large aggregates. The C-terminal region of SeqA (amino acid residues 71–181) contains a domain that binds to hemi-methylated GATC sequences while the N-terminal region (1–50) is responsible for tetramer formation (19Guarné A. Zhao Q. Ghirlando R. Yang W. Nat. Struct. Biol. 2002; 9: 839-843PubMed Google Scholar, 22Fujikawa N. Kurumizaka H. Nureki O. Tanaka Y. Yamazoe M. Hiraga S. Yokoyama S. Nucleic Acids Res. 2004; 32: 82-92Crossref PubMed Scopus (19) Google Scholar). The two regions are connected by a flexible linker. Although SeqA is a homotetramer (18Lee H. Kang S. Bae S.H. Choi B.S. Hwang D.S. J. Biol. Chem. 2001; 276: 34600-34606Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar, 19Guarné A. Zhao Q. Ghirlando R. Yang W. Nat. Struct. Biol. 2002; 9: 839-843PubMed Google Scholar), chemical cross-linking and the footprinting pattern point to a basic dimeric configuration of the tetramer (35Brendler T. Austin S. EMBO J. 1999; 18: 2304-2310Crossref PubMed Scopus (87) Google Scholar, 38Fossum S. Soreide S. Skarstad K. Mol. Microbiol. 2003; 47: 619-632Crossref PubMed Scopus (24) Google Scholar). We speculate that the SeqA tetramer has a Y shape (Fig. 6A). In this structure the N-terminal regions of the four subunits are apposed while the C-terminal regions connected to the N termini by the flexible linkers are partially split in two with two of the subunits closer than the other two. In the presence of competitor DNAs, binding of a SeqA protein to two hemi-methylated sites is required to form a stable SeqA-DNA complex (20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). The two hemi-methylated sites can be separated by up to 31 bp and located on different phases of the helix (Fig. 1: 24). The flexible binding of SeqA could be achieved if one of the pairs of closely connected subunits recognizes one of the two hemi-methylated sites so that the other pair of subunits can bind to the other site, bends the DNA between the two hemi-methylated sites (Fig. 1) and so stabilizes the binding of the tetramer to the two hemi-methylated sites (Fig. 6A). A SeqA tetramer bound to two hemi-methylated sites can interact with further molecules. Cooperative interaction between the two SeqA proteins occurs when the pair of hemimethylated sites are located within ≤30 bp, otherwise they bind independently (Fig. 2). This cooperative binding is able to stabilize the binding of a wild-type to a single hemi-methylated site (Figs. 3 and 5B) or a mutant SeqA molecule to additional hemi-methylated sites (Fig. 4). Cooperativity was more obvious with DNA containing a larger number of hemi-methylated sites (Fig. 5). Thus two cooperatively SeqA proteins bound to four adjacent hemi-methylated sites could interact with a SeqA protein bound to two hemi-methylated sites 185-bp apart on the same DNA or stabilize the binding of another SeqA to a single hemi-methylated site 60-bp apart (Fig. 5). Interaction between the three SeqA proteins could then induce aggregation of free SeqA proteins onto them (Fig. 5 and Ref. 20Han J.S. Kang S. Lee H. Kim H.K. Hwang D.S. J. Biol. Chem. 2003; 278: 34983-34989Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). We propose that stepwise interaction of the bound SeqA proteins at hemimethylated sites augments their capacity for interaction and aggregation; consequently, as the number of interacting SeqA protein increases, this facilitates recruitment of SeqA that is free or bound distally at hemi-methylated sites, thus expanding the complex. This stepwise interaction followed by aggregation may be the driving force for the formation of the SeqA foci that appear to track replication forks in vivo (14Hiraga S. Ichinose C. Niki H. Yamazoe M. Mol. Cell. 1998; 1: 381-387Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 24Brendler T. Sawitzke J. Sergueev K. Austin S. EMBO J. 2000; 19: 6249-6258Crossref PubMed Scopus (101) Google Scholar, 25Onogi T. Niki H. Yamazoe M. Hiraga S. Mol. Microbiol. 1999; 31: 1775-1782Crossref PubMed Scopus (92) Google Scholar, 26Hiraga S. Ichinose C. Onogi T. Niki H. Yamazoe M. Genes Cells. 2000; 5: 327-341Crossref PubMed Scopus (106) Google Scholar, 27Bach T. Krekling M.A. Skarstad K. EMBO J. 2003; 22: 315-323Crossref PubMed Scopus (54) Google Scholar)." @default.
• W1979969648 created "2016-06-24" @default.
• W1979969648 creator A5032365993 @default.
• W1979969648 creator A5038170854 @default.
• W1979969648 creator A5040681944 @default.
• W1979969648 creator A5042013176 @default.
• W1979969648 creator A5069167592 @default.
• W1979969648 date "2004-07-01" @default.
• W1979969648 modified "2023-09-29" @default.
• W1979969648 title "Binding of SeqA Protein to Hemi-methylated GATC Sequences Enhances Their Interaction and Aggregation Properties" @default.
• W1979969648 cites W1530522271 @default.
• W1979969648 cites W1536557591 @default.
• W1979969648 cites W1589224106 @default.
• W1979969648 cites W1973848497 @default.
• W1979969648 cites W1974527579 @default.
• W1979969648 cites W1980064965 @default.
• W1979969648 cites W1985941652 @default.
• W1979969648 cites W1991395942 @default.
• W1979969648 cites W1992889417 @default.
• W1979969648 cites W1998205522 @default.
• W1979969648 cites W1998443285 @default.
• W1979969648 cites W2001764918 @default.
• W1979969648 cites W2002486322 @default.
• W1979969648 cites W2003325103 @default.
• W1979969648 cites W2014617639 @default.
• W1979969648 cites W2023820135 @default.
• W1979969648 cites W2037675234 @default.
• W1979969648 cites W2041838472 @default.
• W1979969648 cites W2054243030 @default.
• W1979969648 cites W2058172635 @default.
• W1979969648 cites W2064545356 @default.
• W1979969648 cites W2065956437 @default.
• W1979969648 cites W2073800032 @default.
• W1979969648 cites W2078930772 @default.
• W1979969648 cites W2078975494 @default.
• W1979969648 cites W2082065029 @default.
• W1979969648 cites W2086652717 @default.
• W1979969648 cites W2088891507 @default.
• W1979969648 cites W2091181823 @default.
• W1979969648 cites W2120577354 @default.
• W1979969648 cites W2141115102 @default.
• W1979969648 cites W2148387226 @default.
• W1979969648 cites W2160084442 @default.
• W1979969648 cites W4241023725 @default.
• W1979969648 doi "https://doi.org/10.1074/jbc.m402612200" @default.
• W1979969648 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15151991" @default.
• W1979969648 hasPublicationYear "2004" @default.
• W1979969648 type Work @default.
• W1979969648 sameAs 1979969648 @default.
• W1979969648 citedByCount "31" @default.
• W1979969648 countsByYear W19799696482013 @default.
• W1979969648 countsByYear W19799696482014 @default.
• W1979969648 countsByYear W19799696482015 @default.
• W1979969648 countsByYear W19799696482016 @default.
• W1979969648 countsByYear W19799696482017 @default.
• W1979969648 countsByYear W19799696482018 @default.
• W1979969648 countsByYear W19799696482020 @default.
• W1979969648 crossrefType "journal-article" @default.
• W1979969648 hasAuthorship W1979969648A5032365993 @default.
• W1979969648 hasAuthorship W1979969648A5038170854 @default.
• W1979969648 hasAuthorship W1979969648A5040681944 @default.
• W1979969648 hasAuthorship W1979969648A5042013176 @default.
• W1979969648 hasAuthorship W1979969648A5069167592 @default.
• W1979969648 hasConcept C104317684 @default.
• W1979969648 hasConcept C11804247 @default.
• W1979969648 hasConcept C12554922 @default.
• W1979969648 hasConcept C185592680 @default.
• W1979969648 hasConcept C33288867 @default.
• W1979969648 hasConcept C51639874 @default.
• W1979969648 hasConcept C54355233 @default.
• W1979969648 hasConcept C552990157 @default.
• W1979969648 hasConcept C55468747 @default.
• W1979969648 hasConcept C55493867 @default.
• W1979969648 hasConcept C86339819 @default.
• W1979969648 hasConcept C86803240 @default.
• W1979969648 hasConcept C94966510 @default.
• W1979969648 hasConcept C95444343 @default.
• W1979969648 hasConceptScore W1979969648C104317684 @default.
• W1979969648 hasConceptScore W1979969648C11804247 @default.
• W1979969648 hasConceptScore W1979969648C12554922 @default.
• W1979969648 hasConceptScore W1979969648C185592680 @default.
• W1979969648 hasConceptScore W1979969648C33288867 @default.
• W1979969648 hasConceptScore W1979969648C51639874 @default.
• W1979969648 hasConceptScore W1979969648C54355233 @default.
• W1979969648 hasConceptScore W1979969648C552990157 @default.
• W1979969648 hasConceptScore W1979969648C55468747 @default.
• W1979969648 hasConceptScore W1979969648C55493867 @default.
• W1979969648 hasConceptScore W1979969648C86339819 @default.
• W1979969648 hasConceptScore W1979969648C86803240 @default.
• W1979969648 hasConceptScore W1979969648C94966510 @default.
• W1979969648 hasConceptScore W1979969648C95444343 @default.
• W1979969648 hasIssue "29" @default.
• W1979969648 hasLocation W19799696481 @default.
• W1979969648 hasOpenAccess W1979969648 @default.
• W1979969648 hasPrimaryLocation W19799696481 @default.
• W1979969648 hasRelatedWork W2047640583 @default.
• W1979969648 hasRelatedWork W2070181970 @default.
• W1979969648 hasRelatedWork W2084342353 @default.

• next