FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1981504013> ?p ?o ?g. }

• W1981504013 endingPage "1069" @default.
• W1981504013 startingPage "1057" @default.
• W1981504013 abstract "Most studies of genomic disorders have focused on patients with cognitive disability and/or peripheral nervous system defects. In an effort to broaden the phenotypic spectrum of this disease model, we assessed 155 autopsy samples from fetuses with well-defined developmental pathologies in regions predisposed to recurrent rearrangement, by array-based comparative genomic hybridization. We found that 6% of fetal material showed evidence of microdeletion or microduplication, including three independent events that likely resulted from unequal crossing-over between segmental duplications. One of the microdeletions, identified in a fetus with multicystic dysplastic kidneys, encompasses the TCF2 gene on 17q12, previously shown to be mutated in maturity-onset diabetes, as well as in a subset of pediatric renal abnormalities. Fine-scale mapping of the breakpoints in different patient cohorts revealed a recurrent 1.5-Mb de novo deletion in individuals with phenotypes that ranged from congenital renal abnormalities to maturity-onset diabetes of the young type 5. We also identified the reciprocal duplication, which appears to be enriched in samples from patients with epilepsy. We describe the first example of a recurrent genomic disorder associated with diabetes. Most studies of genomic disorders have focused on patients with cognitive disability and/or peripheral nervous system defects. In an effort to broaden the phenotypic spectrum of this disease model, we assessed 155 autopsy samples from fetuses with well-defined developmental pathologies in regions predisposed to recurrent rearrangement, by array-based comparative genomic hybridization. We found that 6% of fetal material showed evidence of microdeletion or microduplication, including three independent events that likely resulted from unequal crossing-over between segmental duplications. One of the microdeletions, identified in a fetus with multicystic dysplastic kidneys, encompasses the TCF2 gene on 17q12, previously shown to be mutated in maturity-onset diabetes, as well as in a subset of pediatric renal abnormalities. Fine-scale mapping of the breakpoints in different patient cohorts revealed a recurrent 1.5-Mb de novo deletion in individuals with phenotypes that ranged from congenital renal abnormalities to maturity-onset diabetes of the young type 5. We also identified the reciprocal duplication, which appears to be enriched in samples from patients with epilepsy. We describe the first example of a recurrent genomic disorder associated with diabetes. Genomic disorders result from nonallelic homologous recombination (NAHR) between low-copy repeats and occur in ∼1 in 1,000 live births.1Shaw CJ Lupski JR Implications of human genome architecture for rearrangement-based disorders: the genomic basis of disease.Hum Mol Genet Spec 1. 2004; 13: R57-R64Crossref PubMed Google Scholar The phenotypes of many of the known genomic disorders include developmental delay and mental retardation (e.g., velocardiofacial syndrome, Williams-Beurens syndrome, and Smith-Magenis syndrome). Therefore, many of the large screens for novel genomic disorders have focused on individuals with mental retardation.2de Vries BB Pfundt R Leisink M Koolen DA Vissers LE Janssen IM Reijmersdal S Nillesen WM Huys EH Leeuw N et al.Diagnostic genome profiling in mental retardation.Am J Hum Genet. 2005; 77: 606-616Abstract Full Text Full Text PDF PubMed Scopus (476) Google Scholar, 3Friedman JM Baross A Delaney AD Ally A Arbour L Armstrong L Asano J Bailey DK Barber S Birch P et al.Oligonucleotide microarray analysis of genomic imbalance in children with mental retardation.Am J Hum Genet. 2006; 79: 500-513Abstract Full Text Full Text PDF PubMed Scopus (236) Google Scholar, 4Koolen DA Vissers LE Pfundt R de Leeuw N Knight SJ Regan R Kooy RF Reyniers E Romano C Fichera M et al.A new chromosome 17q21.31 microdeletion syndrome associated with a common inversion polymorphism.Nat Genet. 2006; 38: 999-1001Crossref PubMed Scopus (333) Google Scholar, 5Menten B Maas N Thienpont B Buysse K Vandesompele J Melotte C de Ravel T Van Vooren S Balikova I Backx L et al.Emerging patterns of cryptic chromosomal imbalance in patients with idiopathic mental retardation and multiple congenital anomalies: a new series of 140 patients and review of published reports.J Med Genet. 2006; 43: 625-633Crossref PubMed Scopus (334) Google Scholar, 6Rosenberg C Knijnenburg J Bakker E Vianna-Morgante AM Sloos W Otto PA Kriek M Hansson K Krepischi-Santos AC Fiegler H et al.Array-CGH detection of micro rearrangements in mentally retarded individuals: clinical significance of imbalances present both in affected children and normal parents.J Med Genet. 2006; 43: 180-186Crossref PubMed Scopus (177) Google Scholar, 7Sharp AJ Hansen S Selzer RR Cheng Z Regan R Hurst JA Stewart H Price SM Blair E Hennekam RC et al.Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome.Nat Genet. 2006; 38: 1038-1042Crossref PubMed Scopus (479) Google Scholar Previously, we developed a BAC array targeted to 130 “rearrangement hotspots,” defined as regions of the genome with an architecture suggestive of a susceptibility to recurrent microdeletion and/or duplication. Use of this array to evaluate 316 unaffected individuals8Locke DP Sharp AJ McCarroll SA McGrath SD Newman TL Cheng Z Schwartz S Albertson DG Pinkel D Altshuler DM et al.Linkage disequilibrium and heritability of copy-number polymorphisms within duplicated regions of the human genome.Am J Hum Genet. 2006; 79: 275-290Abstract Full Text Full Text PDF PubMed Scopus (250) Google Scholar, 9Sharp AJ Locke DP McGrath SD Cheng Z Bailey JA Vallente RU Pertz LM Clark RA Schwartz S Segraves R et al.Segmental duplications and copy-number variation in the human genome.Am J Hum Genet. 2005; 77: 78-88Abstract Full Text Full Text PDF PubMed Scopus (690) Google Scholar and 290 individuals with idiopathic mental retardation7Sharp AJ Hansen S Selzer RR Cheng Z Regan R Hurst JA Stewart H Price SM Blair E Hennekam RC et al.Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome.Nat Genet. 2006; 38: 1038-1042Crossref PubMed Scopus (479) Google Scholar resulted in the identification of copy-number polymorphisms, as well as novel genomic disorders. Interestingly, despite an architecture that predicts a susceptibility to rearrangement, many of these 130 hotspot regions have never been observed as a copy-number variant in the unaffected and developmentally delayed individuals studied. We hypothesized that these “invariant” regions contain genes essential for normal morphogenesis and are involved in pathways other than those critical for normal cognitive development. To test this hypothesis, we evaluated DNA from fetal samples with one or more congenital anomalies for which the pathology was well documented. We reasoned that rearrangements resulting in major malformations or incompatibility with life would be found in such prenatal cases. We show here that one of these microdeletions associated with a fetal sample with grossly abnormal, dysplastic multicystic kidneys is the result of a recurrent rearrangement of 17q12 mediated by segmental duplications. De novo deletions with identical breakpoints are found in living patients with a range of phenotypes, from those with renal abnormalities10Decramer S Parant O Beaufils S Clauin S Guillou C Kessler S Aziza J Bandin F Schanstra JP Bellanne-Chantelot C Anomalies of the TCF2 gene are the main cause of fetal bilateral hyperechogenic kidneys.J Am Soc Nephrol. 2007; 18: 923-933Crossref PubMed Scopus (148) Google Scholar, 11Ulinski T Lescure S Beaufils S Guigonis V Decramer S Morin D Clauin S Deschenes G Bouissou F Bensman A et al.Renal phenotypes related to hepatocyte nuclear factor-1β (TCF2) mutations in a pediatric cohort.J Am Soc Nephrol. 2006; 17: 497-503Crossref PubMed Scopus (189) Google Scholar to individuals whose primary diagnosis is maturity-onset diabetes of the young type 5 (MODY5 [MIM 137920]).12Bellanne-Chantelot C Clauin S Chauveau D Collin P Daumont M Douillard C Dubois-Laforgue D Dusselier L Gautier JF Jadoul M et al.Large genomic rearrangements in the hepatocyte nuclear factor-1β (TCF2) gene are the most frequent cause of maturity-onset diabetes of the young type 5.Diabetes. 2005; 54: 3126-3132Crossref PubMed Scopus (198) Google Scholar This is the first example of a recurrent genomic disorder associated with diabetes and one of the few examples of a contiguous gene-deletion syndrome without mental retardation. We also discovered the reciprocal duplication in individuals with epilepsy and/or mental retardation, as well as in unaffected individuals. These data suggest considerable variability in expressivity of the phenotype and widen the spectrum of diseases caused by genomic disorders. DNA samples were obtained from prenatal autopsy specimens (n=155) and from individuals with renal disease and/or MODY5, with the appropriate institutional-review-board approval. Fetal liver tissue was obtained from Children’s Hospital and Regional Medical Center. All samples were from fetuses that underwent autopsy after elective termination or fetal demise between 1995 and 2006. DNA was extracted using Gentra PureGene DNA extraction kit. The renal pediatric and MODY5 cases represent patients who were analyzed previously for TCF2 molecular abnormalities.10Decramer S Parant O Beaufils S Clauin S Guillou C Kessler S Aziza J Bandin F Schanstra JP Bellanne-Chantelot C Anomalies of the TCF2 gene are the main cause of fetal bilateral hyperechogenic kidneys.J Am Soc Nephrol. 2007; 18: 923-933Crossref PubMed Scopus (148) Google Scholar, 11Ulinski T Lescure S Beaufils S Guigonis V Decramer S Morin D Clauin S Deschenes G Bouissou F Bensman A et al.Renal phenotypes related to hepatocyte nuclear factor-1β (TCF2) mutations in a pediatric cohort.J Am Soc Nephrol. 2006; 17: 497-503Crossref PubMed Scopus (189) Google Scholar, 12Bellanne-Chantelot C Clauin S Chauveau D Collin P Daumont M Douillard C Dubois-Laforgue D Dusselier L Gautier JF Jadoul M et al.Large genomic rearrangements in the hepatocyte nuclear factor-1β (TCF2) gene are the most frequent cause of maturity-onset diabetes of the young type 5.Diabetes. 2005; 54: 3126-3132Crossref PubMed Scopus (198) Google Scholar Two control groups were used to assess the extent of normal copy-number variation. The first control group consisted of 316 unrelated individuals (HapMap and Diversity population) who had been tested using the same BAC duplication microarray.8Locke DP Sharp AJ McCarroll SA McGrath SD Newman TL Cheng Z Schwartz S Albertson DG Pinkel D Altshuler DM et al.Linkage disequilibrium and heritability of copy-number polymorphisms within duplicated regions of the human genome.Am J Hum Genet. 2006; 79: 275-290Abstract Full Text Full Text PDF PubMed Scopus (250) Google Scholar, 9Sharp AJ Locke DP McGrath SD Cheng Z Bailey JA Vallente RU Pertz LM Clark RA Schwartz S Segraves R et al.Segmental duplications and copy-number variation in the human genome.Am J Hum Genet. 2005; 77: 78-88Abstract Full Text Full Text PDF PubMed Scopus (690) Google Scholar A second control population, comprising 960 unrelated white adults (aged 40–70 years) from the United States, was genotyped using the HumanHap300 Genotyping BeadChips (Illumina), which consists of ∼317,000 HapMap SNPs spread throughout the genome. Each individual was enrolled in the Pharmacogenomics and Risk of Cardiovascular Disease (PARC) study, which aims to identify genetic contributors to the variable efficacy of statin drugs for cardiovascular disease (PharmGKB: PARC Profile). Hybridizations, data analysis, and copy-number analysis, with particular reference to chromosome 17q12 (137 probes within the critical region), were performed according to published protocols.13Peiffer DA Le JM Steemers FJ Chang W Jenniges T Garcia F Haden K Li J Shaw CA Belmont J et al.High-resolution genomic profiling of chromosomal aberrations using Infinium whole-genome genotyping.Genome Res. 2006; 16: 1136-1148Crossref PubMed Scopus (389) Google Scholar DNA was hybridized to a custom BAC array consisting of 2,007 clones targeted to regions of the genome flanked by segmental duplications, as described elsewhere.9Sharp AJ Locke DP McGrath SD Cheng Z Bailey JA Vallente RU Pertz LM Clark RA Schwartz S Segraves R et al.Segmental duplications and copy-number variation in the human genome.Am J Hum Genet. 2005; 77: 78-88Abstract Full Text Full Text PDF PubMed Scopus (690) Google Scholar This array includes all regions associated with known genomic disorders and an additional ∼105 regions with similar genomic architecture. Because of the targeted nature of this array, we will not detect rearrangements that are not mediated by segmental duplications. Regions were scored as copy-number variant if the log2 ratio of two or more consecutive clones each exceeded twice the SD of the autosomal clones in dye-swap replicate experiments.7Sharp AJ Hansen S Selzer RR Cheng Z Regan R Hurst JA Stewart H Price SM Blair E Hennekam RC et al.Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome.Nat Genet. 2006; 38: 1038-1042Crossref PubMed Scopus (479) Google Scholar We used a whole-genome tiling path array containing 32,433 BAC clones14Ishkanian AS Malloff CA Watson SK DeLeeuw RJ Chi B Coe BP Snijders A Albertson DG Pinkel D Marra MA et al.A tiling resolution DNA microarray with complete coverage of the human genome.Nat Genet. 2004; 36: 299-303Crossref PubMed Scopus (525) Google Scholar or a custom oligonucleotide array (NimbleGen Systems), consisting of 385,000 isothermal probes (length 45–75 bp) covering several chromosomal regions, including a 3-Mb region of chromosome 17q12 (55,888 probes; mean density 1 probe per 53 bp) to refine the breakpoints. Hybridizations were performed as described elsewhere,15Selzer RR Richmond TA Pofahl NJ Green RD Eis PS Nair P Brothman AR Stallings RL Analysis of chromosome breakpoints in neuroblastoma at sub-kilobase resolution using fine-tiling oligonucleotide array CGH.Genes Chromosomes Cancer. 2005; 44: 305-319Crossref PubMed Scopus (225) Google Scholar and a single unaffected male (GM15724 [Coriell]) was used as reference. Oligonucleotide array data are available at the Human Genome Structural Variation Project Web site. Oligonucleotides for real-time quantitative PCR assays were selected using Primer3 software.16Rozen S Skaletsky H Primer3 on the WWW for general users and for biologist programmers.Methods Mol Biol. 2000; 132: 365-386Crossref PubMed Google Scholar Primer sequences (5′→3′) for exon 1 primers are as follows: forward primer ATTTCCTGGTGCGAGTTTTG and reverse primer CAGGGGATGACTCCTGAAGA. PCRs were performed in an LC480 machine (Roche) by use of SYBR Green PCR Master Mix (Applied Biosystems). PCR conditions were 95°C for 5 min, followed by 40 cycles at 95°C for 15 s, 55°C for 20 s, and 72°C for 20 s. Reactions were performed in triplicate, with a final reaction volume of 10 βl containing 10 ng DNA, 1.6 βM primer, and 5 βl SYBR Green Master Mix. Control primers were placed in the albumin gene. Metaphase spreads and nuclei were obtained from phytohemagglutinin-stimulated peripheral lymphocytes of individuals 6498 and 6840 by standard procedures. FISH experiments were performed using fosmid WIBR2-6022g13 (NCBI May 2004 assembly [hg17] coordinates chr17:32364308–32399464), directly labeled by nick-translation with Cy3-dCTP (Perkin-Elmer), as described elsewhere,17Lichter P Tang CJ Call K Hermanson G Evans GA Housman D Ward DC High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones.Science. 1990; 247: 64-69Crossref PubMed Scopus (1307) Google Scholar with minor modifications. Fosmids WIBR2-3001A12 (hg17 coordinates chr17:32309158–32347025; not duplicated in either case) and WIBR2-946N02 (hg17 coordinates chr17:33156592–33197819; duplicated in both cases) were used in control experiments. We evaluated 155 fetuses with one or more congenital anomalies and no known cytogenetic abnormalities in this study (128 with normal karyotype, 12 of whom also had normal FISH results for 22q11 deletion, and 27 of whom had no karyotype information reported). To minimize false-positive results, we focused on microdeletions and microduplications defined by two or more adjacent BAC clones on our targeted array that were not observed as copy-number polymorphisms in >400 control individuals either on our BAC array platform8Locke DP Sharp AJ McCarroll SA McGrath SD Newman TL Cheng Z Schwartz S Albertson DG Pinkel D Altshuler DM et al.Linkage disequilibrium and heritability of copy-number polymorphisms within duplicated regions of the human genome.Am J Hum Genet. 2006; 79: 275-290Abstract Full Text Full Text PDF PubMed Scopus (250) Google Scholar, 9Sharp AJ Locke DP McGrath SD Cheng Z Bailey JA Vallente RU Pertz LM Clark RA Schwartz S Segraves R et al.Segmental duplications and copy-number variation in the human genome.Am J Hum Genet. 2005; 77: 78-88Abstract Full Text Full Text PDF PubMed Scopus (690) Google Scholar or in studies of full-tiling path microarrays.18Redon R Ishikawa S Fitch KR Feuk L Perry GH Andrews TD Fiegler H Shapero MH Carson AR Chen W et al.Global variation in copy number in the human genome.Nature. 2006; 444: 444-454Crossref PubMed Scopus (3066) Google Scholar, 19Wong KK deLeeuw RJ Dosanjh NS Kimm LR Cheng Z Horsman DE MacAulay C Ng RT Brown CJ Eichler EE et al.A comprehensive analysis of common copy-number variations in the human genome.Am J Hum Genet. 2007; 80: 91-104Abstract Full Text Full Text PDF PubMed Scopus (395) Google Scholar We identified nine individuals (6%) with detectable deletions or duplications, eight of which may be pathogenic (table 1). Analysis using whole-genome tiling-path BAC arrays or high-density oligonucleotide arrays allowed refinement of the breakpoints. Three of the alterations are microdeletions with breakpoints in flanking segmental duplications: a 1.8-Mb deletion at 17q12 in a fetus with multicystic renal dysplasia (FA-275 in fig. 1), a 2.5-Mb deletion at 15q25.2 in a fetus with congenital diaphragmatic hernia and mild hydrocephalus (fig. 2b), and a 2-Mb deletion at 16p13.11 in a fetus with posthemorrhagic hydrocephalus, cleft lip, preauricular tags, and two cleft vertebrae (fig. 2c). In each case, the regions flanking the microdeletions are polymorphic in copy number (on the basis of an analysis of 270 unaffected individuals). The smallest rearrangement we detected was a 157-kb duplication (case FA-142 in fig. 2a).Table 1Abnormalities Detected by Array CGH in a Series of 155 Fetal Cases with One or More Congenital Anomalieshg17 CoordinatesCaseFetal AnomaliesAlterationStartStopAlteration SizeVerificationa32K = whole-genome tiling-path BAC array (n=32,433 BAC clones) (see the “Material and Methods” section).CommentsFA-142Multicystic dysplastic kidneysdup17q235506160055218400157 kbOligo arrayProximal breakpoint in CLTC gene; distal breakpoint in TMEM49; alteration within hotspot region but not mediated by segmental duplications (fig. 2a)FA-180Posthemorrhagic hydrocephalus and craniofacial and vertebral anomaliesdel16p13.1114780000167700001.9 MbOligo arrayBreakpoints in polymorphic segmental duplications (fig. 2c)FA-275Multicystic dysplastic kidneysdel17q1231836750335827501.8 MbOligo arrayBreakpoints in polymorphic segmental duplications (see text for details)FA-328Organomegaly and intrauterine demiseTrisomy 9p, mosaicp-armNonePrenatal karyotype reported as normal; evidence of trisomy 9p in fetal liver tissue (average log2 ratio of 0.34 for 9p clones and 0.53 for X clones); no trisomy in placental tissue from same case.FA-430Multicystic dysplastic kidneys47, XXYX chromosomeNoneLikely an incidental finding; fetal karyotype was not obtained because culture failed to growFA-441Holoprosencephalydup5p15.2-pter del7q36.1-qter1 14860000012100000 15855000012.1 Mb 10 Mb32KLikely unbalanced translocation; prenatal karyotype reported as normal; 7q deleted region contains SHH gene, known to cause holoprosencephalyFA-457Tetralogy of Fallotdel1p36.23-p36.13 dup1p36.138700000 1645000016000000 169500007.3 Mb 500 kb32KLarge interstitial deletion with additional 500-kb duplication at proximal breakpoint; breakpoints in unique sequenceFA-460Craniosynostosis and gastrointestinal and limb anomaliesdupXq137160000071800000200 kb32KProximal breakpoint in unique sequence; distal in large duplicated regionFA-602Congenital diaphragmatic herniadel15q2581011700835407002.5 MbOligo arrayBreakpoints in polymorphic segmental duplications; region contains 22 genes (fig. 2b)a 32K = whole-genome tiling-path BAC array (n=32,433 BAC clones) (see the “Material and Methods” section). Open table in a new tab Figure 2Structural resolution of additional rearrangements in the fetal autopsy series. a, A 157-kb duplication of chromosome 17q23 in FA-142, a fetus with multicystic dysplastic kidneys. Paired segmental duplications (seg dups) with >99% identity are indicated. Breakpoints of this duplication are in CLTC (proximal) and TMEM49 (distal). PTHR2 (BIT1) is entirely within the duplicated region. b, A 2.5-Mb microdeletion of chromosome 15q25.2 (hg17 coordinates chr15:81011700–83540700) in FA-602, a fetus with congenital diaphragmatic hernia and mild hydrocephalus. c, A 2-Mb deletion of 16p13.12-p12.3 in FA-180 (hg17 coordinates chr16:14200000–17200000). Regions of known copy-number polymorphism (CNP) in unaffected individuals are indicated (blue bars). Plots show the log2 ratio (Y-axis) for probes (X-axis) in the region depicted. Deviations of probe log2 ratios from zero are depicted as in figure 1c.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Case FA-275 represents a fetus with bilateral multicystic renal dysplasia, bilateral ureteropelvic junction stenosis, atretic right ureter, and hypoplastic bladder (fig. 1a). We detected a deletion of seven BACs spanning nearly 2 Mb of sequence on our targeted BAC array (fig. 1b). Fine mapping with a customized oligonucleotide array (average probe spacing 53 bp) showed that the deleted region spans 1.8 Mb and involves 19 known genes, including CCL3L1 (MIM 601395), CCL4L1 (MIM 603782), and TBC1D3 (MIM 607741), which are present in multiple copies (fig. 1c). Because of copy-number polymorphism in the flanking regions (figs. 3 and 4), it is difficult to predict the exact breakpoints of the deletion; however, both proximal and distal breakpoints are within segmental-duplication clusters with multiple regions of high identity—the most significant has >99% identity across 76 kb (hg17 coordinates chr17:31808172–31883983 and chr17:33529232–33604211).Figure 4Copy-number polymorphism of the segmental duplications at the breakpoint regions. An expanded view of figure 2, showing eight additional control individuals (controls C6–C13) analyzed on a custom oligonucleotide array targeted to segmental duplications (Seg dups) and five additional patients with 17q12 deletion. Controls C1–C5 are the same as in figure 2. For each individual, deviations of probe log2 ratios from zero are depicted as in figures 1 and 2. The patients with 17q12 deletion shown are FR40, FR99, FR45, FR35, and FA-275.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The deleted region in case FA-275 includes the TCF2 gene (MIM 189907), mutations of which are known to cause MODY5,20Horikawa Y Iwasaki N Hara M Furuta H Hinokio Y Cockburn BN Lindner T Yamagata K Ogata M Tomonaga O et al.Mutation in hepatocyte nuclear factor-1β gene (TCF2) associated with MODY.Nat Genet. 1997; 17: 384-385Crossref PubMed Scopus (707) Google Scholar as well as both pediatric11Ulinski T Lescure S Beaufils S Guigonis V Decramer S Morin D Clauin S Deschenes G Bouissou F Bensman A et al.Renal phenotypes related to hepatocyte nuclear factor-1β (TCF2) mutations in a pediatric cohort.J Am Soc Nephrol. 2006; 17: 497-503Crossref PubMed Scopus (189) Google Scholar, 21Muller D Klopocki E Neumann LM Mundlos S Taupitz M Schulze I Ropers HH Querfeld U Ullmann R A complex phenotype with cystic renal disease.Kidney Int. 2006; 70: 1656-1660Crossref PubMed Scopus (17) Google Scholar and prenatally detectable10Decramer S Parant O Beaufils S Clauin S Guillou C Kessler S Aziza J Bandin F Schanstra JP Bellanne-Chantelot C Anomalies of the TCF2 gene are the main cause of fetal bilateral hyperechogenic kidneys.J Am Soc Nephrol. 2007; 18: 923-933Crossref PubMed Scopus (148) Google Scholar cystic renal disease. One third of a series of MODY5-affected individuals with TCF2 alterations have deletions of the entire TCF2 gene and surrounding sequence.12Bellanne-Chantelot C Clauin S Chauveau D Collin P Daumont M Douillard C Dubois-Laforgue D Dusselier L Gautier JF Jadoul M et al.Large genomic rearrangements in the hepatocyte nuclear factor-1β (TCF2) gene are the most frequent cause of maturity-onset diabetes of the young type 5.Diabetes. 2005; 54: 3126-3132Crossref PubMed Scopus (198) Google Scholar Similar deletions have been found in pediatric cystic renal disease.10Decramer S Parant O Beaufils S Clauin S Guillou C Kessler S Aziza J Bandin F Schanstra JP Bellanne-Chantelot C Anomalies of the TCF2 gene are the main cause of fetal bilateral hyperechogenic kidneys.J Am Soc Nephrol. 2007; 18: 923-933Crossref PubMed Scopus (148) Google Scholar, 11Ulinski T Lescure S Beaufils S Guigonis V Decramer S Morin D Clauin S Deschenes G Bouissou F Bensman A et al.Renal phenotypes related to hepatocyte nuclear factor-1β (TCF2) mutations in a pediatric cohort.J Am Soc Nephrol. 2006; 17: 497-503Crossref PubMed Scopus (189) Google Scholar, 21Muller D Klopocki E Neumann LM Mundlos S Taupitz M Schulze I Ropers HH Querfeld U Ullmann R A complex phenotype with cystic renal disease.Kidney Int. 2006; 70: 1656-1660Crossref PubMed Scopus (17) Google Scholar Because the deletion in case FA-275 appeared to overlap the deletions reported in patients with MODY5, we used oligonucleotide arrays to refine the deletion breakpoints in five patients with pediatric renal disease without diabetes and three patients with MODY5 (diabetes and renal disease) who had previously been shown to have deletions encompassing the TCF2 gene (table 2).Table 2Phenotypes Associated with 17q12 RearrangementsIndividual or CaseDel or DupRenal PhenotypeDiabetes, Age at Onset (years)Cognitive AbilitySeizuresOtherDe Novo or InheritedFA-275DelMCDK, prenatal onsetNANANA…UnknownFR40DelSingle kidney with isolated cysts, onset at age 7 yearsYes, 22NormalNoneCryptorchidism, pancreatic atrophy, and elevated liver enzymes (2.5×)De novoFR92DelBilateral cysts and hypoplasia, onset at age 1 yearYes, 10NormalNoneElevated liver enzymes (2×)De novoFR99DelAbnormal renal function, onset at age 27 yearsYes, 23NormalNoneElevated liver enzymes (4×)De novoFR45DelBilateral MCDK, prenatal onset; GFR < 80NoaThe father of FR45 has diabetes (onset at age 27 years) and renal cysts, and the brother of FR45 also has MCDK (prenatal onset).NormalNone…InheritedFR12DelPrenatal hyperechogenic kidneys and postnatal MCDK; GFR=95NoNormalNone…De novoFR37DelPrenatal hyperechogenic kidneys and postnatal MCDK, pelvic dilatation, and hyperuricemiaNoNormalNone…De novoFR35DelPrenatal hyperechogenic kidneys and bilateral MCDK; GFR=96NoNormalNone…De novoFR09DelBilateral MCDK, prenatal onsetNoNormalNone…De novoIMR379DupNone knownNoMRUnknown…UnknownbPresumed inheritance from the father, who was unavailable for analysis.5812DupNone knownNoMRFocal complex…Inherited6498DupcDuplication of TCF2 and LHX1 genes (see text).None knownNoMRFocal complex…InheriteddTCF2 duplication inherited from the unaffected mother; duplication of LHX1 is likely also inherited from the mother, who is mosaic (see text).Note.—Del = deletion; Dup = duplication; GFR = glomerular filtration rate (in ml/min/1.73 m2); MCDK = multicystic dysplastic kidneys; MR = mental retardation.a The father of FR45 has diabetes (onset at age 27 years) and renal cysts, and the brother of FR45 also has MCDK (prenatal onset).b Presumed inheritance from the father, who was unavailable for analysis.c Duplication of TCF2 and LHX1 genes (see text).d TCF2 duplication inherited from the unaffected mother; duplication of LHX1 is likely also inherited from the mother, who is mosaic (see text). Open table in a new tab Note.— Del = deletion; Dup = duplication; GFR = glomerular filtration rate (in ml/min/1.73 m2); MCDK = multicystic dysplastic kidneys; MR = mental retardation. Our results show that four of the five pediatric patients and all three of the patients with MODY5 have deletions that are nearly identical to that of our fetal case, with breakpoints in all cases mapping to flanking segmental-duplication blocks (fig. 1c). Case FR09 provides the greatest breakpoint resolution, with a proximal breakpoint at 31,835,000 ± 1 kb and a distal breakpoint at 33,357,000 ± 1 kb defining the common minimal deletion region. The extensive and variable copy-number polymorphism in the flanking regions (figs. 3 and 4) and the presence of a sequence assembly gap make it difficult to define the breakpoints more precisely in the other three cases, but they all occur within the large segmental duplication blocks (proximal: 31,500,000–31,900,000 bp; distal: 33,300,000–33,600,000 bp). One case (FR35) is atypical, with a larger de novo deletion at least 2.1 Mb in size. The distal breakpo" @default.
• W1981504013 created "2016-06-24" @default.
• W1981504013 creator A5003975992 @default.
• W1981504013 creator A5007946034 @default.
• W1981504013 creator A5009225418 @default.
• W1981504013 creator A5010530881 @default.
• W1981504013 creator A5014870107 @default.
• W1981504013 creator A5027561780 @default.
• W1981504013 creator A5033872267 @default.
• W1981504013 creator A5040184602 @default.
• W1981504013 creator A5041429809 @default.
• W1981504013 creator A5064065701 @default.
• W1981504013 creator A5071894755 @default.
• W1981504013 creator A5073039943 @default.
• W1981504013 creator A5079745174 @default.
• W1981504013 date "2007-11-01" @default.
• W1981504013 modified "2023-10-14" @default.
• W1981504013 title "Recurrent Reciprocal Genomic Rearrangements of 17q12 Are Associated with Renal Disease, Diabetes, and Epilepsy" @default.
• W1981504013 cites W1971321176 @default.
• W1981504013 cites W1981913177 @default.
• W1981504013 cites W2000971189 @default.
• W1981504013 cites W2002079712 @default.
• W1981504013 cites W2002969945 @default.
• W1981504013 cites W2022276281 @default.
• W1981504013 cites W2043522420 @default.
• W1981504013 cites W2044110911 @default.
• W1981504013 cites W2049643291 @default.
• W1981504013 cites W2080292758 @default.
• W1981504013 cites W2088848325 @default.
• W1981504013 cites W2094145003 @default.
• W1981504013 cites W2095123953 @default.
• W1981504013 cites W2101446132 @default.
• W1981504013 cites W2106982327 @default.
• W1981504013 cites W2110793364 @default.
• W1981504013 cites W2111453238 @default.
• W1981504013 cites W2111746502 @default.
• W1981504013 cites W2125847325 @default.
• W1981504013 cites W2128115913 @default.
• W1981504013 cites W2129087747 @default.
• W1981504013 cites W2140331829 @default.
• W1981504013 cites W2142701631 @default.
• W1981504013 cites W2146948473 @default.
• W1981504013 cites W2151566815 @default.
• W1981504013 cites W2155677754 @default.
• W1981504013 cites W2155707112 @default.
• W1981504013 cites W2160868309 @default.
• W1981504013 cites W2161409513 @default.
• W1981504013 cites W2163177727 @default.
• W1981504013 doi "https://doi.org/10.1086/522591" @default.
• W1981504013 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2265663" @default.
• W1981504013 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17924346" @default.
• W1981504013 hasPublicationYear "2007" @default.
• W1981504013 type Work @default.
• W1981504013 sameAs 1981504013 @default.
• W1981504013 citedByCount "222" @default.
• W1981504013 countsByYear W19815040132012 @default.
• W1981504013 countsByYear W19815040132013 @default.
• W1981504013 countsByYear W19815040132014 @default.
• W1981504013 countsByYear W19815040132015 @default.
• W1981504013 countsByYear W19815040132016 @default.
• W1981504013 countsByYear W19815040132017 @default.
• W1981504013 countsByYear W19815040132018 @default.
• W1981504013 countsByYear W19815040132019 @default.
• W1981504013 countsByYear W19815040132020 @default.
• W1981504013 countsByYear W19815040132021 @default.
• W1981504013 countsByYear W19815040132022 @default.
• W1981504013 countsByYear W19815040132023 @default.
• W1981504013 crossrefType "journal-article" @default.
• W1981504013 hasAuthorship W1981504013A5003975992 @default.
• W1981504013 hasAuthorship W1981504013A5007946034 @default.
• W1981504013 hasAuthorship W1981504013A5009225418 @default.
• W1981504013 hasAuthorship W1981504013A5010530881 @default.
• W1981504013 hasAuthorship W1981504013A5014870107 @default.
• W1981504013 hasAuthorship W1981504013A5027561780 @default.
• W1981504013 hasAuthorship W1981504013A5033872267 @default.
• W1981504013 hasAuthorship W1981504013A5040184602 @default.
• W1981504013 hasAuthorship W1981504013A5041429809 @default.
• W1981504013 hasAuthorship W1981504013A5064065701 @default.
• W1981504013 hasAuthorship W1981504013A5071894755 @default.
• W1981504013 hasAuthorship W1981504013A5073039943 @default.
• W1981504013 hasAuthorship W1981504013A5079745174 @default.
• W1981504013 hasBestOaLocation W19815040131 @default.
• W1981504013 hasConcept C126322002 @default.
• W1981504013 hasConcept C134018914 @default.
• W1981504013 hasConcept C138885662 @default.
• W1981504013 hasConcept C169760540 @default.
• W1981504013 hasConcept C2777742833 @default.
• W1981504013 hasConcept C2778186239 @default.
• W1981504013 hasConcept C2779134260 @default.
• W1981504013 hasConcept C41895202 @default.
• W1981504013 hasConcept C54355233 @default.
• W1981504013 hasConcept C555293320 @default.
• W1981504013 hasConcept C60644358 @default.
• W1981504013 hasConcept C71924100 @default.
• W1981504013 hasConcept C86803240 @default.
• W1981504013 hasConceptScore W1981504013C126322002 @default.
• W1981504013 hasConceptScore W1981504013C134018914 @default.
• W1981504013 hasConceptScore W1981504013C138885662 @default.

• next