FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1981574139> ?p ?o ?g. }

• W1981574139 endingPage "38053" @default.
• W1981574139 startingPage "38043" @default.
• W1981574139 abstract "Insulin activation of mTOR complex 1 is accompanied by enhanced binding of substrates. We examined the mechanism and contribution of this enhancement to insulin activation of mTORC1 signaling in 293E and HeLa cells. In 293E, insulin increased the amount of mTORC1 retrieved by the transiently expressed nonphosphorylatable 4E-BP[5A] to an extent that varied inversely with the amount of PRAS40 bound to mTORC1. RNAi depletion of PRAS40 enhanced 4E-BP[5A] binding to ∼70% the extent of maximal insulin, and PRAS40 RNAi and insulin together did not increase 4E-BP[5A] binding beyond insulin alone, suggesting that removal of PRAS40 from mTORC1 is the predominant mechanism of an insulin-induced increase in substrate access. As regards the role of increased substrate access in mTORC1 signaling, RNAi depletion of PRAS40, although increasing 4E-BP[5A] binding, did not stimulate phosphorylation of endogenous mTORC1 substrates S6K1(Thr389) or 4E-BP (Thr37/Thr46), the latter already ∼70% of maximal in amino acid replete, serum-deprived 293E cells. In HeLa cells, insulin and PRAS40 RNAi also both enhanced the binding of 4E-BP[5A] to raptor but only insulin stimulated S6K1 and 4E-BP phosphorylation. Furthermore, Rheb overexpression in 293E activated mTORC1 signaling completely without causing PRAS40 release. In the presence of Rheb and insulin, PRAS40 release is abolished by Akt inhibition without diminishing mTORC1 signaling. In conclusion, dissociation of PRAS40 from mTORC1 and enhanced mTORC1 substrate binding results from Akt and mTORC1 activation and makes little or no contribution to mTORC1 signaling, which rather is determined by Rheb activation of mTOR catalytic activity, through mechanisms that remain to be fully elucidated. Insulin activation of mTOR complex 1 is accompanied by enhanced binding of substrates. We examined the mechanism and contribution of this enhancement to insulin activation of mTORC1 signaling in 293E and HeLa cells. In 293E, insulin increased the amount of mTORC1 retrieved by the transiently expressed nonphosphorylatable 4E-BP[5A] to an extent that varied inversely with the amount of PRAS40 bound to mTORC1. RNAi depletion of PRAS40 enhanced 4E-BP[5A] binding to ∼70% the extent of maximal insulin, and PRAS40 RNAi and insulin together did not increase 4E-BP[5A] binding beyond insulin alone, suggesting that removal of PRAS40 from mTORC1 is the predominant mechanism of an insulin-induced increase in substrate access. As regards the role of increased substrate access in mTORC1 signaling, RNAi depletion of PRAS40, although increasing 4E-BP[5A] binding, did not stimulate phosphorylation of endogenous mTORC1 substrates S6K1(Thr389) or 4E-BP (Thr37/Thr46), the latter already ∼70% of maximal in amino acid replete, serum-deprived 293E cells. In HeLa cells, insulin and PRAS40 RNAi also both enhanced the binding of 4E-BP[5A] to raptor but only insulin stimulated S6K1 and 4E-BP phosphorylation. Furthermore, Rheb overexpression in 293E activated mTORC1 signaling completely without causing PRAS40 release. In the presence of Rheb and insulin, PRAS40 release is abolished by Akt inhibition without diminishing mTORC1 signaling. In conclusion, dissociation of PRAS40 from mTORC1 and enhanced mTORC1 substrate binding results from Akt and mTORC1 activation and makes little or no contribution to mTORC1 signaling, which rather is determined by Rheb activation of mTOR catalytic activity, through mechanisms that remain to be fully elucidated. The mammalian target of rapamycin (TOR) 2The abbreviations used are: TORtarget of rapamycinmTORC1mammalian target of rapamycin complex 1TSCtuberous sclerosis complexIPimmunoprecipitationDPBSDulbecco's phosphate-buffered salineS6K1S6 kinase 1TOSTOR signaling. complex 1 (mTORC1) controls cell size by signaling to the transcriptional apparatus, by regulating the translation of a cohort of mRNAs critical to the enlargement of cell size, and by control of autophagy (1Wullschleger S. Loewith R. Hall M.N. Cell. 2006; 124: 471-484Abstract Full Text Full Text PDF PubMed Scopus (4743) Google Scholar). mTORC1 is composed of three tightly bound polypeptides in a 1:1:1 stoichiometry, i.e. mTOR, raptor, and mLst8 (also known as GβL) (2Hara K. Maruki Y. Long X. Yoshino K. Oshiro N. Hidayat S. Tokunaga C. Avruch J. Yonezawa K. Cell. 2002; 110: 177-189Abstract Full Text Full Text PDF PubMed Scopus (1457) Google Scholar, 3Kim D.H. Sarbassov D.D. Ali S.M. King J.E. Latek R.R. Erdjument-Bromage H. Tempst P. Sabatini D.M. Cell. 2002; 110: 163-175Abstract Full Text Full Text PDF PubMed Scopus (2390) Google Scholar, 4Loewith R. Jacinto E. Wullschleger S. Lorberg A. Crespo J.L. Bonenfant D. Oppliger W. Jenoe P. Hall M.N. Mol. Cell. 2002; 10: 457-468Abstract Full Text Full Text PDF PubMed Scopus (1484) Google Scholar), retrieved largely as a homodimer of this trimer (5Wang L. Rhodes C.J. Lawrence Jr., J.C. J. Biol. Chem. 2006; 281: 24293-24303Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Many other polypeptides can be retrieved with mTORC1 as the stringency of washing is reduced; among the most intriguing is PRAS40 (6Sancak Y. Thoreen C.C. Peterson T.R. Lindquist R.A. Kang S.A. Spooner E. Carr S.A. Sabatini D.M. Mol. Cell. 2007; 25: 903-915Abstract Full Text Full Text PDF PubMed Scopus (1005) Google Scholar, 7Vander Haar E. Lee S.I. Bandhakavi S. Griffin T.J. Kim D.H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (935) Google Scholar, 8Wang L. Harris T.E. Roth R.A. Lawrence Jr., J.C. J. Biol. Chem. 2007; 282: 20036-20044Abstract Full Text Full Text PDF PubMed Scopus (380) Google Scholar, 9Thedieck K. Polak P. Kim M.L. Molle K.D. Cohen A. Jenö P. Arrieumerlou C. Hall M.N. PLoS One. 2007; 2: e1217Crossref PubMed Scopus (236) Google Scholar), a protein first identified as a preferred substrate of insulin-stimulated, Akt-catalyzed phosphorylation (10Kovacina K.S. Park G.Y. Bae S.S. Guzzetta A.W. Schaefer E. Birnbaum M.J. Roth R. A J. Biol. Chem. 2003; 278: 10189-10194Abstract Full Text Full Text PDF PubMed Scopus (288) Google Scholar). PRAS40 is also a substrate of mTORC1 (11Oshiro N. Takahashi R. Yoshino K. Tanimura K. Nakashima A. Eguchi S. Miyamoto T. Hara K. Takehana K. Avruch J. Kikkawa U. Yonezawa K. J. Biol. Chem. 2007; 282: 20329-20339Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar, 12Fonseca B.D. Smith E.M. Lee V.H. MacKintosh C. Proud C.G. J. Biol. Chem. 2007; 282: 24514-24524Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar, 13Wang L. Harris T.E. Lawrence Jr., J.C. J. Biol. Chem. 2008; 283: 15619-15627Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar), however, the physiologic function(s) of PRAS40 and thus of its phosphorylations remains unclear. Perhaps the best characterized direct substrates of mTORC1 are the translational regulatory proteins, S6 kinase 1 and 4E-BP. These bind directly to raptor (14Nojima H. Tokunaga C. Eguchi S. Oshiro N. Hidayat S. Yoshino K. Hara K. Tanaka N. Avruch J. Yonezawa K. J. Biol. Chem. 2003; 278: 15461-15464Abstract Full Text Full Text PDF PubMed Scopus (515) Google Scholar, 15Beugnet A. Wang X. Proud C.G. J. Biol. Chem. 2003; 278: 40717-40722Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 16Choi K.M. McMahon L.P. Lawrence Jr., J.C. J. Biol. Chem. 2003; 278: 19667-19673Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 17Schalm S.S. Fingar D.C. Sabatini D.M. Blenis J. Curr. Biol. 2003; 13: 797-806Abstract Full Text Full Text PDF PubMed Scopus (397) Google Scholar), and their association with raptor is crucial to their phosphorylation by mTORC1 in vivo and in vitro. Binding occurs through one or more short motifs on these substrates, the best characterized being the so-called TOS motif (18Schalm S.S. Blenis J. Curr. Biol. 2002; 12: 632-639Abstract Full Text Full Text PDF PubMed Scopus (388) Google Scholar), which in S6K1 and 4E-BP has the form Phe-Ac-φ-Ac-φ (where Ac = Glu/Asp and φ = Leu/Ile/Met); mutation of Phe in this motif eliminates the ability of 4E-BP or S6K1 to bind raptor and to be phosphorylated in a rapamycin-sensitive manner in cells. The binding of PRAS40 to raptor depends on a variant TOS motif, Phe-Val-Met-Asp-Glu (11Oshiro N. Takahashi R. Yoshino K. Tanimura K. Nakashima A. Eguchi S. Miyamoto T. Hara K. Takehana K. Avruch J. Kikkawa U. Yonezawa K. J. Biol. Chem. 2007; 282: 20329-20339Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar). In turn, mTOR-catalyzed phosphorylation strongly promotes the dissociation of these substrates from raptor. target of rapamycin mammalian target of rapamycin complex 1 tuberous sclerosis complex immunoprecipitation Dulbecco's phosphate-buffered saline S6 kinase 1 TOR signaling. The activity of mTORC1 is controlled by a variety of inputs; insulin and growth factors up-regulate mTORC1 activity, whereas stressors such as hypoxia, energy depletion, glucocorticoids, and TNFα suppress mTORC1 activity (1Wullschleger S. Loewith R. Hall M.N. Cell. 2006; 124: 471-484Abstract Full Text Full Text PDF PubMed Scopus (4743) Google Scholar). This regulation is accomplished primarily or exclusively by regulating the activity of the tuberous sclerosis complex (TSC1/TSC2), which is the GTPase activator for the small GTPase Rheb (19Huang J. Manning B.D. Biochem. J. 2008; 412: 179-190Crossref PubMed Scopus (937) Google Scholar). Rheb-GTP is a proximal activator of mTORC1, through its direct binding to the mTOR catalytic domain (20Long X. Lin Y. Ortiz-Vega S. Yonezawa K. Avruch J. Curr. Biol. 2005; 15: 702-713Abstract Full Text Full Text PDF PubMed Scopus (758) Google Scholar) and by additional mechanisms, such as the generation of phosphatidic acid by Rheb activation of PL-D1 (21Sun Y. Chen J. Cell Cycle. 2008; 7: 3118-3123Crossref PubMed Scopus (71) Google Scholar) and perhaps by Rheb displacement of the mTOR inhibitor FKBP38 (22Bai X. Ma D. Liu A. Shen X. Wang Q.J. Liu Y. Jiang Y. Science. 2007; 318: 977-980Crossref PubMed Scopus (313) Google Scholar). In cells deficient in TSC function, mTORC1 is constitutively active and the impact of these upstream inputs is greatly attenuated or eliminated. By contrast, withdrawal of amino acids (or just leucine) is a potent inhibitor of mTORC1 signaling (23Hara K. Yonezawa K. Weng Q.P. Kozlowski M.T. Belham C. Avruch J. J. Biol. Chem. 1998; 273: 14484-14494Abstract Full Text Full Text PDF PubMed Scopus (1132) Google Scholar, 24Avruch J. Long X. Ortiz-Vega S. Rapley J. Papageorgiou A Dai N. Am. J. Physiol. Endocrinol. Metab. 2009; 296: E592-602Crossref PubMed Scopus (309) Google Scholar) that does not significantly alter Rheb GTP charging, and whose inhibitory potency is only modestly diminished in TSC-deficient cells (25Roccio M. Bos J.L. Zwartkruis F.J. Oncogene. 2006; 25: 657-664Crossref PubMed Scopus (120) Google Scholar). Thus, amino acid withdrawal interferes with the ability of Rheb-GTP to bind and activate mTORC1 (26Long X. Ortiz-Vega S. Lin Y. Avruch J. J. Biol. Chem. 2005; 280: 23433-23436Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar); the inhibitory effect of amino acid withdrawal on mTORC1 can be overcome by overexpression of mutant active forms of the rag GTPases (27Kim E. Goraksha-Hicks P Li L. Neufeld T.P. Guan K.L. Nat. Cell Biol. 2008; 10: 935-945Crossref PubMed Scopus (1001) Google Scholar, 28Sancak Y. Peterson T.R. Shaul Y.D. Lindquist R.A. Thoreen C.C. Bar-Peled L. Sabatini D.M. Science. 2008; 320: 1496-1501Crossref PubMed Scopus (1972) Google Scholar), which bind raptor and couple mTORC1 with Rheb (28Sancak Y. Peterson T.R. Shaul Y.D. Lindquist R.A. Thoreen C.C. Bar-Peled L. Sabatini D.M. Science. 2008; 320: 1496-1501Crossref PubMed Scopus (1972) Google Scholar). Several observations point to the possibility that the activation of mTORC1 signaling, i.e. mTORC1 kinase activity in vivo, in addition to an activation/disinhibition of the mTOR catalytic domain, involves an enhancement of mTORC1 substrate binding capacity. Early work demonstrated that overexpression of S6K1 inhibited the mTORC1-catalyzed phosphorylation of 4E-BP (29von Manteuffel S.R. Dennis P.B. Pullen N. Gingras A.C. Sonenberg N. Thomas G. Mol. Cell. Biol. 1997; 17: 5426-5436Crossref PubMed Scopus (212) Google Scholar) and more recently, it was shown that mTORC1 substrates S6K1, 4E-BP, and PRAS40 were each mutually competitive in their binding to raptor (6Sancak Y. Thoreen C.C. Peterson T.R. Lindquist R.A. Kang S.A. Spooner E. Carr S.A. Sabatini D.M. Mol. Cell. 2007; 25: 903-915Abstract Full Text Full Text PDF PubMed Scopus (1005) Google Scholar, 7Vander Haar E. Lee S.I. Bandhakavi S. Griffin T.J. Kim D.H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (935) Google Scholar, 8Wang L. Harris T.E. Roth R.A. Lawrence Jr., J.C. J. Biol. Chem. 2007; 282: 20036-20044Abstract Full Text Full Text PDF PubMed Scopus (380) Google Scholar, 11Oshiro N. Takahashi R. Yoshino K. Tanimura K. Nakashima A. Eguchi S. Miyamoto T. Hara K. Takehana K. Avruch J. Kikkawa U. Yonezawa K. J. Biol. Chem. 2007; 282: 20329-20339Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar, 12Fonseca B.D. Smith E.M. Lee V.H. MacKintosh C. Proud C.G. J. Biol. Chem. 2007; 282: 24514-24524Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar, 13Wang L. Harris T.E. Lawrence Jr., J.C. J. Biol. Chem. 2008; 283: 15619-15627Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). RNAi-induced depletion of endogenous PRAS40 has been reported to promote some increase in mTORC1-dependent phosphorylation of S6K1 and 4E-BP in serum-deprived cells (6Sancak Y. Thoreen C.C. Peterson T.R. Lindquist R.A. Kang S.A. Spooner E. Carr S.A. Sabatini D.M. Mol. Cell. 2007; 25: 903-915Abstract Full Text Full Text PDF PubMed Scopus (1005) Google Scholar, 7Vander Haar E. Lee S.I. Bandhakavi S. Griffin T.J. Kim D.H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (935) Google Scholar), although impaired mTORC1 signaling after PRAS40 depletion has also been observed (7Vander Haar E. Lee S.I. Bandhakavi S. Griffin T.J. Kim D.H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (935) Google Scholar, 12Fonseca B.D. Smith E.M. Lee V.H. MacKintosh C. Proud C.G. J. Biol. Chem. 2007; 282: 24514-24524Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar, 30Hong-Brown L.Q. Brown C.R. Kazi A.A. Huber D.S. Pruznak A.M. Lang C.H. J. Cell. Biochem. 2010; 109: 1172-1184PubMed Google Scholar). The finding that depletion of one mTORC1 substrate enhances the mTORC1-catalyzed phosphorylation of others suggests that even during insulin/nutrient stimulation, the availability of substrate binding sites on endogenous raptor may be limiting for mTORC1-catalyzed substrate phosphorylation. Wang et al. (5Wang L. Rhodes C.J. Lawrence Jr., J.C. J. Biol. Chem. 2006; 281: 24293-24303Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar) provided the most direct evidence that raptor-mediated substrate binding is regulated, demonstrating that the activation of mTORC1 signaling by insulin treatment of 3T3-L1 adipocytes is accompanied by an increased ability of the extracted mTORC1 complex to bind to the 4E-BP polypeptide in vitro. In the present studies, we sought to characterize the regulation of substrate binding to mTORC1, gain insight into the underlying mechanism, and evaluate the contribution of this alteration to mTORC1 signaling. 293E cells (kindly provided by Dr Ramnik Xavier) and 293T cells were grown in high glucose Dulbecco's modified Eagle's medium (DMEM) (Invitrogen) supplemented with 10% fetal bovine serum (Sigma) and gentamycin (50 mg/ml, Invitrogen) at 37 °C in a 5% CO2 atmosphere. Cells were plated on 6-cm plates and plasmid constructs were transiently transfected 24 h later using either Lipofectamine, or Lipofectamine 2000 for co-transfection experiments involving both plasmids and siRNA oligos according to the manufacturer's instructions (Invitrogen). For all treatments (48 h post-transfection) 293E cells were initially serum starved in DMEM for 16 h, for insulin stimulation fresh DMEM was added for 1 h, then fresh DMEM was added again for a further 30 min in the presence or absence of 1 μm insulin (Sigma). For amino acid starvation, DPBS (Invitrogen, number 14040) was added for 1 h supplemented with 25 mm glucose (Sigma) and 1 mm sodium pyruvate (Invitrogen), fresh DPBS containing glucose and sodium pyruvate was then added for a further 30 min in the presence or absence of 1 μm insulin. To inhibit mTOR by Torin (31Liu Q. Chang J.W. Wang J. Kang S.A. Thoreen C.C. Markhard A. Hur W. Zhang J. Sim T. Sabatini D.M. Gray N.S. J. Med. Chem. 2010; 53: 7146-7155Crossref PubMed Scopus (185) Google Scholar) (a kind gift from N. Gray and D. M. Sabatini) or rapamycin (LC Laboratories), and AKT by Akt inhibitor VIII, isozyme selective, Akti-1/2 (32Logie L. Ruiz-Alcaraz A.J. Keane M. Woods Y.L. Bain J. Marquez R. Alessi D.R. Sutherland C. Diabetes. 2007; 56: 2218-2227Crossref PubMed Scopus (79) Google Scholar) (Chemdea), fresh DMEM was supplemented with the appropriate inhibitor for 1 h, fresh DMEM was then added for a further 30 min with the inhibitor in the presence or absence of 1 μm insulin. For 293T cells (40 h post-transfection), fresh DMEM was added supplemented with 1 μm insulin for 30 min or DPBS supplemented with 25 mm glucose, 1 mm sodium pyruvate, and 25 μm LY294002 (Calbiochem) for 2 h. HeLa cells were plated on 6-cm plates and siRNA oligos were transiently transfected 24 h later using Oligofectamine according to the manufacturers instructions (Invitrogen). For co-transfection experiments plasmid constructs were transfected 24 h after siRNA oligos using Lipofectamine 2000 according to the manufacturers instructions (Invitrogen). 48 h post-siRNA transfection the medium was replace with DMEM lacking serum; 1 h later fresh DMEM ± insulin (1 μm) was added and the cells were extracted 30 min later. For amino acid starvation, the medium was replaced with DPBS supplemented with glucose and sodium pyruvate for 1 h, followed by fresh DPBS containing glucose and sodium pyruvate for a further 30 min prior to extraction. After their respective treatment, cells were washed in PBS and lysed in 500 μl of ice-cold lysis buffer (20 mm Tris, pH 7.4, 20 mm NaCl, 1 mm EDTA, 5 mm EGTA, 50 mm NaF, 1 mm DTT, protein inhibitor mixture tablet (Roche applied Science), and 0.2% CHAPS or 0.2% Triton X-100) and harvested by scraping, lysates were then spun at 13,200 × g for 10 min at 4 °C in a tabletop centrifuge. For GST pull downs lysates were combined with 30 μl of glutathione-Sepharose (GE Healthcare) and rotated for 1 h and 30 min at 4 °C. GST pulldown assays were washed five times in 500 μl of ice-cold lysis buffer, and then 30 μl of Laemmli buffer was added for immunoblot analysis. For immunoprecipitates, 1 μg of anti-raptor or anti-PRAS40 was coupled to 10 μl of protein A-Sepharose (GE Healthcare), whereas 1 μg of anti-mTOR was coupled to 10 μl of protein G-Sepharose (GE Healthcare) in lysis buffer while rotating for 1 h at 4 °C. FLAG immunoprecipitations used 20 μl of FLAG-agarose (Sigma). Immunoprecipitates were then processed as described for GST pulldown assays. Expression vectors of eukaryotic GST-tagged proteins (pEBG-4E-BP[5A], pEBG-4E-BP[5A/F114A]), prokaryotic GST-tagged proteins (pGEX-4E-BP and pGEX-P70(355–505)), FLAG-tagged proteins (pCMV5-FLAG-P70, pCMV5-FLAG-Rheb, and pCMV5-Flag-mTOR) and Myc-tagged proteins (pcDNA3-Myc-raptor) were constructed as previously described (2Hara K. Maruki Y. Long X. Yoshino K. Oshiro N. Hidayat S. Tokunaga C. Avruch J. Yonezawa K. Cell. 2002; 110: 177-189Abstract Full Text Full Text PDF PubMed Scopus (1457) Google Scholar, 11Oshiro N. Takahashi R. Yoshino K. Tanimura K. Nakashima A. Eguchi S. Miyamoto T. Hara K. Takehana K. Avruch J. Kikkawa U. Yonezawa K. J. Biol. Chem. 2007; 282: 20329-20339Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar, 14Nojima H. Tokunaga C. Eguchi S. Oshiro N. Hidayat S. Yoshino K. Hara K. Tanaka N. Avruch J. Yonezawa K. J. Biol. Chem. 2003; 278: 15461-15464Abstract Full Text Full Text PDF PubMed Scopus (515) Google Scholar, 20Long X. Lin Y. Ortiz-Vega S. Yonezawa K. Avruch J. Curr. Biol. 2005; 15: 702-713Abstract Full Text Full Text PDF PubMed Scopus (758) Google Scholar). Due to more robust expression of pcDNA3-Myc-raptor, pcDNA3-Myc-raptor[6A] was generated by cutting a fragment of pRK7-Myc-raptor[6A] (33Foster K.G. Acosta-Jaquez H.A. Romeo Y. Ekim B. Soliman G.A. Carriere A. Roux P.P. Ballif B.A. Fingar D.C. J. Biol. Chem. 2010; 285: 80-94Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar) (a kind gift from Diane Fingar) using SbfI and FseI. PRAS40 siRNA duplexes with 3′ dTdT overhangs and scrambled controls have previously been described. To generate FLAG-raptor[4A] (S722A, S859A, S863A, S877A), three sequential PCR were performed using mutagenic primers at Ser722 (CGTTCTGTGAGCGCCTATGGAAACATC), Ser859/Ser863 (CTCACTCAGGCGGCCCCCGCCGCCCCCACCAAC), and Ser877 (CAGGCGGGGGGCGCCCCTCCGGCGTCC). For immunoprecipitation experiments, anti-mTOR, anti-PRAS40 (Pro238), and anti-raptor (R1) were produced by Immuno-Biological Laboratories as previously described (11Oshiro N. Takahashi R. Yoshino K. Tanimura K. Nakashima A. Eguchi S. Miyamoto T. Hara K. Takehana K. Avruch J. Kikkawa U. Yonezawa K. J. Biol. Chem. 2007; 282: 20329-20339Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar), whereas anti-FLAG was purchased from Sigma. For Western blotting antibodies were purchased from Sigma (anti-FLAG), Cell Signaling (anti-mTOR, anti-P70-T389, anti-4E-BP, anti-4E-BP-Thr37/Thr46, anti-4E BP-Ser65, anti-4E-BP-Thr70, anti-AKT, anti-AKT-Thr473, anti-GSK3β-Ser9, and anti-Myc), Santa Cruz Biotechnology (anti-P70) and Millipore (anti-PRAS40-Thr246 and anti-GST). Anti-raptor (Arg984), anti-PRAS40 (Pro238), and anti-PRAS40-Ser183 were produced by Immuno-Biological Laboratories as previously described (11Oshiro N. Takahashi R. Yoshino K. Tanimura K. Nakashima A. Eguchi S. Miyamoto T. Hara K. Takehana K. Avruch J. Kikkawa U. Yonezawa K. J. Biol. Chem. 2007; 282: 20329-20339Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar). Polyclonal phosphospecific anti-raptor antibodies were produced by immunizing rabbits with the following peptides coupled to KLH: Ser722 (CRSVSpSYGNIamide), Ser863 (CAPApSPTNKGamide), and Ser877 (CQAGGpSPPASamide), where pS represents phosphoserine. Phosphospecific antibodies were purified by initially coupling synthetic peptides (both phospho and nonphospho) to Sulfo-link coupling gel (Thermo Scientific) via an N-terminal cysteine residue. Sera was first passed over the nonphospho column then the phospho column, antibodies were then eluted according to the manufacturers instructions. Lysates, GST pulldowns, and immunoprecipitates were separated by SDS-PAGE and then transferred onto polyvinylidene difluoride membrane (PerkinElmer Life Sciences). The membranes were blocked in phosphate-buffered saline containing 0.1% Tween 20 (PBST) and 5% powdered milk, primary antibodies were then diluted in the same solution and incubated overnight at 4 °C. Membranes were washed in PBST and secondary antibodies (horseradish peroxidase conjugated, Jackson ImmunoResearch Laboratories) were then added, which were diluted in PBST containing 5% powdered milk for 1 h at room temperature. Membranes were finally washed in PBST then analyzed by chemiluminescence (Thermo Scientific) using imaging film (Kodak). For multiple analysis membranes were stripped using 1 m NaOH for 10 min at room temperature, followed by three washes in PBS. These were performed essentially as previously described (6Sancak Y. Thoreen C.C. Peterson T.R. Lindquist R.A. Kang S.A. Spooner E. Carr S.A. Sabatini D.M. Mol. Cell. 2007; 25: 903-915Abstract Full Text Full Text PDF PubMed Scopus (1005) Google Scholar) using 0.3% CHAPS or 0.3% Triton X-100 in the lysis and wash buffers. The phosphate transfer reaction used 200 ng of substrate, a final volume of 40 μl, and a 10-min incubation with agitation at 30 °C. Substrates were expressed and purified from Escherichia coli as previously described (20Long X. Lin Y. Ortiz-Vega S. Yonezawa K. Avruch J. Curr. Biol. 2005; 15: 702-713Abstract Full Text Full Text PDF PubMed Scopus (758) Google Scholar). Western blots were quantified using Adobe Photoshop. Subsaturating exposures were scanned and for each experiment in a series the scan value of one condition was divided into itself (and thus assigned the invariant value of 1) and into each of the other scan values. To evaluate, in a statistically valid manner, the data from a series of experiments thus normalized, each of the mean ratios was compared with its expected value under the hypothesis of no effect (which is 1), using a one-sample t test. This takes into account that the value of one condition is without variation. The use of normalization is appropriate inasmuch as the absolute scan value is an artifact of the blotting condition and exposure time. We sought to devise a probe for the availability of the mTORC1 substrate binding site in intact cells using the well characterized substrate 4E-BP. Inasmuch as the ability of mTORC1 substrates such as 4E-BP and PRAS40 to bind to raptor is strongly inhibited by their phosphorylation, we employed a mutant of 4E-BP wherein all five of the mTORC1-catalyzed phosphorylation sites (Thr37, Thr46, Ser65, Thr70, and Ser83) were substituted with Ala, fused to the carboxyl terminus of GST to make GST-4E-BP[5A]. We showed previously that elimination of these phosphorylation sites enhances the ability of 4E-BP to bind raptor (2Hara K. Maruki Y. Long X. Yoshino K. Oshiro N. Hidayat S. Tokunaga C. Avruch J. Yonezawa K. Cell. 2002; 110: 177-189Abstract Full Text Full Text PDF PubMed Scopus (1457) Google Scholar); more importantly, the inability of GST-4E-BP[5A] to be phosphorylated renders its association with raptor sensitive only to perturbations of mTORC1 or regulators of substrate binding to mTORC1. The interaction of GST-4E-BP[5A] with raptor is lost by mutation of the 4E-BP TOS motif (Phe114 to Ala), indicating that GST-4E-BP[5A] binds to raptor at the physiologic substrate binding site (Fig. 1A). In an initial series of experiments, we introduced increasing amounts of cDNA encoding GST-4E-BP[5A] into 293T cells. Two hours prior to extraction, some cells were transferred from complete medium (DMEM + 10% FBS) to DPBS + glucose and pyruvate, followed by the addition of LY294002 30 min prior to extraction; this treatment sought to eliminate both the amino acid and Type 1 PI 3-kinase inputs to mTORC1. The cells were then extracted with either 0.2% CHAPS, which does not disrupt the raptor interaction with mTOR, or with 0.2% Triton X-100, which completely dissociates raptor from mTOR. The recombinant GST-4E-BP[5A] was then retrieved from the extracts with GSH-Sepharose, and the copurified raptor and mTOR were estimated by extracting the beads with SDS sample buffer followed by SDS-PAGE and immunoblot. As seen in Fig. 1, B and C, GST-4E-BP[5A] retrieves endogenous raptor in a dose-dependent manner (Fig. 1B, top two panels). Extraction of the cells with Triton X-100, which causes a dissociation of mTOR/hLst8 from raptor (Fig. 1B, compare 3rd and 4th panels from top), increases the amount of raptor recovered at each dose of GST-4E-BP[5A] when compared with CHAPS extraction (Fig. 1B, compare the top two panels), confirming that mTOR itself restricts the ability of GST-4E-BP[5A] to bind raptor. In addition, exposing the cells to amino acid withdrawal plus LY294002 prior to extraction significantly reduces the amount of raptor bound to GST-4E-BP[5A] when the cells are extracted in 0.2% CHAPS, but has little or no effect on raptor recovery when the cells are extracted in Triton X-100 (Fig. 1, B and C). This suggests that the cell state regulates substrate binding to raptor, but primarily when mTOR complex 1 is intact. To explore the mechanism(s) underlying the regulation of substrate binding to mTORC1 we turned to the 293E cell line where the activity of the insulin-PI 3-kinase pathway in serum-deprived cells is quite low and is strongly activated by insulin. This is reflected by the absence of detectable phosphorylation of Akt(Ser473) and Akt substrates PRAS40(Thr246) and GSK3β(Ser9) after overnight serum withdrawal, and the robust stimulation of these phosphorylations by insulin (Fig. 2A). In contrast, the level of phosphorylation of 4E-BP(Thr37/Thr46) and PRAS40(Ser183) in serum-deprived 293E cells is ∼70 and 50%, respectively, that seen after insulin stimulation (Fig. 2B); these high basal phosphorylations, which are catalyzed directly by mTORC1, are abolished by a brief withdrawal of medium amino acids (Fig. 2A) and thus reflect the ability of amino acids, independent of insulin, to stimulate mTORC1 activity. The much lower basal phosphorylation of S6K1(Thr389), another direct mTORC1 substrate, appears to reflect the need for a higher level of mTORC1 catalytic activity, as indicated by the much greater sensitivity of S6K1(Thr389) phosphorylation to inhibition by mTOR catalytic inhibitor Torin 1 as compared with the inhibition of 4E-BP(Thr37/Thr46) and PRAS40(Ser183) phosphorylation (Fig. 2A). As in 293T cells, extraction of serum-deprived 293E cells with Triton X-100 results in a much greater recovery of endogenous raptor with transiently expressed GST-4E-BP[5A] than does extraction in CHAPS (Fig. 3A). Extraction in Triton X-100, i.e. removal of mTOR from raptor, does not itself alter the amount of PRAS40 bound to raptor as shown by the raptor immunoprecipitate (Fig. 3C, third panel from top), so that the Triton X-100-induced increase in GST-4E-BP[5A] binding to raptor is not attributable to the displacement of PRAS40, consistent with the view that mTOR itself restricts acce" @default.
• W1981574139 created "2016-06-24" @default.
• W1981574139 creator A5003459148 @default.
• W1981574139 creator A5031714701 @default.
• W1981574139 creator A5071170327 @default.
• W1981574139 creator A5082058048 @default.
• W1981574139 date "2011-11-01" @default.
• W1981574139 modified "2023-09-27" @default.
• W1981574139 title "The Mechanism of Insulin-stimulated 4E-BP Protein Binding to Mammalian Target of Rapamycin (mTOR) Complex 1 and Its Contribution to mTOR Complex 1 Signaling" @default.
• W1981574139 cites W1970707895 @default.
• W1981574139 cites W1975861025 @default.
• W1981574139 cites W1977893138 @default.
• W1981574139 cites W1987951940 @default.
• W1981574139 cites W1989964807 @default.
• W1981574139 cites W1992480202 @default.
• W1981574139 cites W1993431258 @default.
• W1981574139 cites W1993642204 @default.
• W1981574139 cites W1995496043 @default.
• W1981574139 cites W2001669618 @default.
• W1981574139 cites W2002031023 @default.
• W1981574139 cites W2004582874 @default.
• W1981574139 cites W2005066107 @default.
• W1981574139 cites W2006559495 @default.
• W1981574139 cites W2008239768 @default.
• W1981574139 cites W2009971361 @default.
• W1981574139 cites W2011437516 @default.
• W1981574139 cites W2012142261 @default.
• W1981574139 cites W2023012828 @default.
• W1981574139 cites W2023834045 @default.
• W1981574139 cites W2025176940 @default.
• W1981574139 cites W2031398283 @default.
• W1981574139 cites W2041353665 @default.
• W1981574139 cites W2050036331 @default.
• W1981574139 cites W2054683873 @default.
• W1981574139 cites W2056570604 @default.
• W1981574139 cites W2066659565 @default.
• W1981574139 cites W2071131807 @default.
• W1981574139 cites W2081920342 @default.
• W1981574139 cites W2085950149 @default.
• W1981574139 cites W2086239621 @default.
• W1981574139 cites W2089632625 @default.
• W1981574139 cites W2093916539 @default.
• W1981574139 cites W2115479382 @default.
• W1981574139 cites W2120281136 @default.
• W1981574139 cites W2134138119 @default.
• W1981574139 cites W2136676465 @default.
• W1981574139 cites W2139856846 @default.
• W1981574139 cites W2152600551 @default.
• W1981574139 cites W2153497031 @default.
• W1981574139 cites W2158368342 @default.
• W1981574139 doi "https://doi.org/10.1074/jbc.m111.245449" @default.
• W1981574139 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3207408" @default.
• W1981574139 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21914810" @default.
• W1981574139 hasPublicationYear "2011" @default.
• W1981574139 type Work @default.
• W1981574139 sameAs 1981574139 @default.
• W1981574139 citedByCount "35" @default.
• W1981574139 countsByYear W19815741392012 @default.
• W1981574139 countsByYear W19815741392013 @default.
• W1981574139 countsByYear W19815741392014 @default.
• W1981574139 countsByYear W19815741392015 @default.
• W1981574139 countsByYear W19815741392016 @default.
• W1981574139 countsByYear W19815741392018 @default.
• W1981574139 countsByYear W19815741392019 @default.
• W1981574139 countsByYear W19815741392020 @default.
• W1981574139 countsByYear W19815741392021 @default.
• W1981574139 countsByYear W19815741392022 @default.
• W1981574139 countsByYear W19815741392023 @default.
• W1981574139 crossrefType "journal-article" @default.
• W1981574139 hasAuthorship W1981574139A5003459148 @default.
• W1981574139 hasAuthorship W1981574139A5031714701 @default.
• W1981574139 hasAuthorship W1981574139A5071170327 @default.
• W1981574139 hasAuthorship W1981574139A5082058048 @default.
• W1981574139 hasBestOaLocation W19815741391 @default.
• W1981574139 hasConcept C112446052 @default.
• W1981574139 hasConcept C121332964 @default.
• W1981574139 hasConcept C134018914 @default.
• W1981574139 hasConcept C185592680 @default.
• W1981574139 hasConcept C2777391703 @default.
• W1981574139 hasConcept C2779306644 @default.
• W1981574139 hasConcept C43060935 @default.
• W1981574139 hasConcept C62478195 @default.
• W1981574139 hasConcept C62520636 @default.
• W1981574139 hasConcept C86554907 @default.
• W1981574139 hasConcept C86803240 @default.
• W1981574139 hasConcept C89611455 @default.
• W1981574139 hasConcept C95444343 @default.
• W1981574139 hasConceptScore W1981574139C112446052 @default.
• W1981574139 hasConceptScore W1981574139C121332964 @default.
• W1981574139 hasConceptScore W1981574139C134018914 @default.
• W1981574139 hasConceptScore W1981574139C185592680 @default.
• W1981574139 hasConceptScore W1981574139C2777391703 @default.
• W1981574139 hasConceptScore W1981574139C2779306644 @default.
• W1981574139 hasConceptScore W1981574139C43060935 @default.
• W1981574139 hasConceptScore W1981574139C62478195 @default.
• W1981574139 hasConceptScore W1981574139C62520636 @default.
• W1981574139 hasConceptScore W1981574139C86554907 @default.
• W1981574139 hasConceptScore W1981574139C86803240 @default.

• next