FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1982160526> ?p ?o ?g. }

• W1982160526 endingPage "35615" @default.
• W1982160526 startingPage "35604" @default.
• W1982160526 abstract "Chronic myelogenous leukemia (CML) results from a t(9,22) translocation, producing the p210BCR-ABL oncoprotein, a tyrosine kinase that causes transformation and chemotherapy resistance. To further understand mechanisms mediating chemotherapy resistance, we identified 556 differentially regulated genes in HL-60 cells stably expressing p210BCR-ABLversus those expressing an empty vector using cDNA macro- and oligonucleotide microarrays. These BCR-ABL-regulated gene products play diverse roles in cellular function including apoptosis, cell cycle regulation, intracellular signaling, transcription, and cellular adhesion. In particular, we identified up-regulation of the inducible form of heat shock protein 70 (Hsp70), and further explored the mechanism for its up-regulation. In HL-60/BCR-ABL and K562 cells (expressing p210BCR-ABL), abundant cytoplasmic Hsp70 expression was detected by immunoblot analysis. Moreover, cells isolated from bone marrow aspirates of patients in different stages of CML (chronic, aggressive, and blast crisis) express Hsp70. Expression of p210BCR-ABL in BCR-ABL negative cells induced transcription of the proximal Hsp70 promoter. Mutational analysis mapped the major p210BCR-ABL responsive element to a high affinity 5′(A/T)GATA(A/G)-3′ “GATA” response element (GATA-RE) that binds GATA-1 in CML cells. The GATA-RE was sufficient to confer p210BCR-ABL- and p185BCR-ABL-mediated trans-activation to an inert promoter. Short interfering RNA mediated “knockdown” of Hsp70 expression in K562 cells induced marked sensitivity to paclitaxel-induced apoptosis. Together these findings indicate that BCR-ABL confers chemotherapeutic resistance through intracellular signaling to the GATA-RE element found in the promoter region of the anti-apoptotic Hsp70 protein. We suggest that down-regulation of the GATA-Hsp70 pathway may be useful in the treatment of chemotherapy-resistant CML. Chronic myelogenous leukemia (CML) results from a t(9,22) translocation, producing the p210BCR-ABL oncoprotein, a tyrosine kinase that causes transformation and chemotherapy resistance. To further understand mechanisms mediating chemotherapy resistance, we identified 556 differentially regulated genes in HL-60 cells stably expressing p210BCR-ABLversus those expressing an empty vector using cDNA macro- and oligonucleotide microarrays. These BCR-ABL-regulated gene products play diverse roles in cellular function including apoptosis, cell cycle regulation, intracellular signaling, transcription, and cellular adhesion. In particular, we identified up-regulation of the inducible form of heat shock protein 70 (Hsp70), and further explored the mechanism for its up-regulation. In HL-60/BCR-ABL and K562 cells (expressing p210BCR-ABL), abundant cytoplasmic Hsp70 expression was detected by immunoblot analysis. Moreover, cells isolated from bone marrow aspirates of patients in different stages of CML (chronic, aggressive, and blast crisis) express Hsp70. Expression of p210BCR-ABL in BCR-ABL negative cells induced transcription of the proximal Hsp70 promoter. Mutational analysis mapped the major p210BCR-ABL responsive element to a high affinity 5′(A/T)GATA(A/G)-3′ “GATA” response element (GATA-RE) that binds GATA-1 in CML cells. The GATA-RE was sufficient to confer p210BCR-ABL- and p185BCR-ABL-mediated trans-activation to an inert promoter. Short interfering RNA mediated “knockdown” of Hsp70 expression in K562 cells induced marked sensitivity to paclitaxel-induced apoptosis. Together these findings indicate that BCR-ABL confers chemotherapeutic resistance through intracellular signaling to the GATA-RE element found in the promoter region of the anti-apoptotic Hsp70 protein. We suggest that down-regulation of the GATA-Hsp70 pathway may be useful in the treatment of chemotherapy-resistant CML. Chronic myelogenous leukemia (CML), 1The abbreviations used are: CML, chronic myelogenous leukemia; p210BCR-ABL, 210-kDa BCR-ABL fusion oncoprotein; PKC, protein kinase C; Apaf-1, apoptotic protease activation factor-1; Hsp, heat shock protein; GATA-RE, GATA-response element; nt, nucleotide(s); siRNA, short interfering RNA; ANOVA, analysis of variance; EMSA, electrophoretic mobility shift assay; WT, wild type(s); HSE, heat shock element; MOPS, 4-morpholinepropanesulfonic acid.1The abbreviations used are: CML, chronic myelogenous leukemia; p210BCR-ABL, 210-kDa BCR-ABL fusion oncoprotein; PKC, protein kinase C; Apaf-1, apoptotic protease activation factor-1; Hsp, heat shock protein; GATA-RE, GATA-response element; nt, nucleotide(s); siRNA, short interfering RNA; ANOVA, analysis of variance; EMSA, electrophoretic mobility shift assay; WT, wild type(s); HSE, heat shock element; MOPS, 4-morpholinepropanesulfonic acid. a diagnosis given for 15% of adult leukemias, represents a clonal expansion of granulocytic progenitor cells (1Faderl S. Talpaz M. Estrov Z. O'Brien S. Kurzrock R. Kantarjian H. N. Engl. J. Med. 1999; 341: 164-172Crossref PubMed Scopus (1059) Google Scholar). CML is caused by a reciprocal t(9,22) translocation of c-abl from chromosome 9 to the break-point cluster region (bcr) gene on chromosome 22 (1Faderl S. Talpaz M. Estrov Z. O'Brien S. Kurzrock R. Kantarjian H. N. Engl. J. Med. 1999; 341: 164-172Crossref PubMed Scopus (1059) Google Scholar, 2Rowley J.D. Nature. 1973; 243: 290-293Crossref PubMed Scopus (3338) Google Scholar). In 95% of CML cases, translocation involves the major bcr, leading to generation of the 210-kDa BCR-ABL fusion oncoprotein (p210BCR-ABL). A similar BCR-ABL translocation is also be found in 20–30% of cases of adult acute lymphoblastic leukemia and 5% of childhood acute lymphoblastic leukemia (3Raitano A.B. Whang Y.E. Sawyers C.L. Biochim. Biophys. Acta. 1997; 1333: F201-F216PubMed Google Scholar, 4Melo J.V. Blood. 1996; 88: 2375Crossref PubMed Google Scholar). In both cases, the serine-threonine kinase domain from BCR partially replaces the inhibitory NH2-terminal Src homology 3 domain of ABL, producing a fusion protein with constitutive ABL tyrosine kinase activity (3Raitano A.B. Whang Y.E. Sawyers C.L. Biochim. Biophys. Acta. 1997; 1333: F201-F216PubMed Google Scholar, 5Kurzrock R. Gutterman J.U. Talpaz M. N. Engl. J. Med. 1988; 319: 990-998Crossref PubMed Scopus (720) Google Scholar, 6Konopka J. Watanabe S. Witte O. Cell. 1984; 37: 1035Abstract Full Text PDF PubMed Scopus (674) Google Scholar).Dysregulated BCR-ABL signaling induces pleiotropic phenotypic changes in granulocytic cells, including resistance to chemotherapy-induced apoptosis, disruption of cell cycle check-points, induction of growth factor-independent proliferation (7Sirard C. Laneuville P. Dick J.E. Blood. 1994; 83: 1575Crossref PubMed Google Scholar), cellular transformation in vitro (3Raitano A.B. Whang Y.E. Sawyers C.L. Biochim. Biophys. Acta. 1997; 1333: F201-F216PubMed Google Scholar), and production of a CML-like leukemia in vivo (8Daley G.Q. Van Etten R.A. Baltimore D. Science. 1990; 247: 824-830Crossref PubMed Scopus (1913) Google Scholar, 9Van Etten R.A. Oncogene. 2002; 21: 8643-8651Crossref PubMed Scopus (44) Google Scholar). Moreover, BCR-ABL signaling is required to actively maintain cellular viability. For example, down-regulation of BCR-ABL expression (10Wilda M. Fuchs U. Wossmann W. Borkhardt A. Oncogene. 2002; 21: 5716-5724Crossref PubMed Scopus (282) Google Scholar, 11McGahon A. Bissonnette R. Schmitt M. Cotter K.M. Green D.R. Cotter T.G. Blood. 1994; 83: 1179-1187Crossref PubMed Google Scholar) or inhibition of its ABL tyrosine kinase activity using the 2-phenlyaminopyridmidine inhibitor, imatinib (STI571), induces apoptosis in vitro and remissions during the chronic phase of CML in the clinic (10Wilda M. Fuchs U. Wossmann W. Borkhardt A. Oncogene. 2002; 21: 5716-5724Crossref PubMed Scopus (282) Google Scholar, 12Goldman J.M. Druker B.J. Blood. 2001; 98: 2039-2042Crossref PubMed Scopus (207) Google Scholar). A body of work has shown that BCR-ABL regulates diverse signaling pathways including p21ras, phosphatidylinositol 3-kinase, protein kinase C (PKC) (13Jamieson L. Carpenter L. Biden T.J. Fields A.P. J. Biol. Chem. 1999; 274: 3927-3930Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar), Jak-STAT (3Raitano A.B. Whang Y.E. Sawyers C.L. Biochim. Biophys. Acta. 1997; 1333: F201-F216PubMed Google Scholar, 14Zou X. Calame K. J. Biol. Chem. 1999; 274: 18141Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar), and NF-κB (15Reuther J.Y. Reuther G.W. Cortez D. Pendergast A.M. Baldwin Jr., A.S. Genes Dev. 1998; 12: 968-981Crossref PubMed Scopus (350) Google Scholar, 16Lu Y. Jamieson L. Brasier A.R. Fields A.P. Oncogene. 2001; 20: 4777-4792Crossref PubMed Scopus (62) Google Scholar). The relationships of these signaling pathways to specific cellular responses are still being elucidated. Perhaps best understood is the p21ras/Raf pathway in mediating cellular transformation by BCR-ABL. Inhibition of p21ras, either by administration of antisense oligonucleotides or microinjection of blocking antibodies, prevents expression of the c-myc proto-oncogene, thereby blocking cellular transformation (reviewed in Ref. 17Zou X. Calame K. J. Biol. Chem. 1999; 274: 18141-18144Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar).A hallmark of BCR-ABL-expressing cells is the profound resistance to chemotherapeutic agent-induced apoptosis (13Jamieson L. Carpenter L. Biden T.J. Fields A.P. J. Biol. Chem. 1999; 274: 3927-3930Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 16Lu Y. Jamieson L. Brasier A.R. Fields A.P. Oncogene. 2001; 20: 4777-4792Crossref PubMed Scopus (62) Google Scholar, 18Bedi A. Barber J.P. Bedi G.C. el-Deiry W.S. Sidransky D. Vala M.S. Akhtar A.J. Hilton J. Jones R.J. Blood. 1995; 86: 1148-1158Crossref PubMed Google Scholar, 19Amarante-Mendes G.P. McGahon A.J. Nishioka W.K. Afar D.E. Witte O.N. Green D.R. Oncogene. 1998; 16: 1383-1390Crossref PubMed Scopus (198) Google Scholar). Chemotherapy-induced cell death involves proteolytic cleavage of cysteine proteases, called caspases, whose activation can be triggered by cytochrome c release from mitochondria (20Earnshaw W.C. Martins L.M. Kaufmann S.H. Annu. Rev. Biochem. 1999; 68: 383-424Crossref PubMed Scopus (2428) Google Scholar). In the cytosol, cytochrome c binds apoptotic protease activation factor (Apaf)-1, inducing its oligomerization to form the “apoptosome” (21Adams J.M. Cory S. Curr. Opin. Cell Biol. 2002; 14: 715-720Crossref PubMed Scopus (248) Google Scholar), an enzymatically competent Apaf-1·procaspase-9 complex that cleaves procaspase-3, thereby committing the cell to autolysis.BCR-ABL causes chemotherapy resistance, at least in part, by interfering with the caspase activation pathway at multiple steps. Previous studies have shown that Ph+ cells isolated either during CML blast crisis or after ectopic BCR-ABL expression release diminished amounts of cytochrome c into the cytosol after exposure to high dose Ara-C or etoposide (22Martins L.M. Mesner P.W. Kottke T.J. Basi G.S. Sinha S. Tung J.S. Svingen P.A. Madden B.J. Takahashi A. McCormick D.J. Earnshaw W.C. Kaufmann S.H. Blood. 1997; 90: 4283-4296Crossref PubMed Google Scholar, 23Amarante-Mendes G.P. Naekyung K.C. Liu L. Huang Y. Perkins C.L. Green D.R. Bhalla K. Blood. 1998; 91: 1700-1705Crossref PubMed Google Scholar). At the biochemical level, BCR-ABL-transformed cells express increased amounts of the outer mitochondrial membrane protein Bcl-xL, which prevents Bax insertion into the outer mitochrondial membrane, reducing chemotherapy-induced cytochrome c release (23Amarante-Mendes G.P. Naekyung K.C. Liu L. Huang Y. Perkins C.L. Green D.R. Bhalla K. Blood. 1998; 91: 1700-1705Crossref PubMed Google Scholar). In addition, we have recently shown that BCR-ABL signaling through the PKCι-NF-κB pathway is also required for resistance to paclitaxel (Taxol)-induced apoptosis (16Lu Y. Jamieson L. Brasier A.R. Fields A.P. Oncogene. 2001; 20: 4777-4792Crossref PubMed Scopus (62) Google Scholar). NF-κB is an inducible transcription factor that activates expression of several inhibitors of apoptosis proteins, polypeptides that bind and inactivate caspases as well as inducing ubiquitin-mediated degradation of the RHG proteins (Reaper, HID, and Grim, Ref. 24Olson M.R. Holley C.L. Yoo S.J. Huh J.R. Hay B.A. Kornbluth S. J. Biol. Chem. 2003; 278: 4028-4034Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Together these findings suggest that BCR-ABL may induce chemotherapy resistance by controlling expression of proteins that antagonize caspase activation at multiple points.Several studies have begun to identify BCR-ABL-activated genomic programs, focusing on BCR-ABL-activated genes important in cell cycle regulation or molecular signatures (25Jena N. Deng M. Sicinska E. Sicinski P. Daley G.Q. Cancer Res. 2002; 62: 535-541PubMed Google Scholar, 26Salesse S. Verfaillie C.M. Mol. Cancer Ther. 2003; 2: 173-182Crossref PubMed Scopus (28) Google Scholar, 27Nowicki M.O. Pawlowski P. Fischer T. Hess G. Pawlowski T. Skorski T. Oncogene. 2003; 22: 3952-3963Crossref PubMed Scopus (102) Google Scholar). However, whether BCR-ABL activates other genetic targets controlling anti-apoptosis has not been completely resolved. Here we apply discovery based tools to investigate the effects of BCR-ABL on gene expression. Differential expression of a variety of signaling kinases, transcription factors, cell surface receptors, and adhesion molecules was observed in HL-60 cells stably expressing p210BCR-ABLversus empty vector controls. Further investigation focused on the BCR-ABL induced up-regulation of heat shock protein (Hsp)-70 kDa isoform, an anti-apoptotic protein known to bind and inhibit Apaf-1, apoptosis inducing factor, and inhibit the apoptosis signal-inducing kinase-1 (Refs. 28Ravagnan L. Gurbuxani S. Susin S.A. Maisse C. Daugas E. Zamzami N. Mak T. Jaattela M. Penninger J.M. Garrido C. Kroemer G. Nat. Cell Biol. 2001; 3: 839-843Crossref PubMed Scopus (743) Google Scholar, 29Garrido C. Gurbuxani S. Ravagnan L. Kroemer G. Biochem. Biophys. Res. Commun. 2001; 286: 433-442Crossref PubMed Scopus (656) Google Scholar, 30Park H.S. Cho S.G. Kim C.K. Hwang H.S. Noh K.T. Kim M.S. Huh S.H. Kim M.J. Ryoo K. Kim E.K. Kang W.J. Lee J.S. Seo J.S. Ko Y.G. Kim S. Choi E.J. Mol. Cell. Biol. 2002; 22: 7721-7730Crossref PubMed Scopus (139) Google Scholar). After Hsp70 up-regulation was validated in K562 cells and bone marrow aspirates from CML patients, subsequent experiments mapped sequences responsible for BCR-ABL-mediated transactivation to a high affinity GATA response element (GATA-RE) located in the proximal Hsp70 promoter between –82 and –58 nt. Finally, short interfering RNA (siRNA)-mediated down-regulation of Hsp70 expression sensitized K562 cells to paclitaxel-induced apoptosis. Together these findings indicate that p210BCR-ABL transactivates the GATA-RE in the Hsp70 promoter, leading to up-regulation of the anti-apoptotic Hsp70 gene.EXPERIMENTAL PROCEDURESCell Culture and Treatment—Human K562 erythroleukemia (16Lu Y. Jamieson L. Brasier A.R. Fields A.P. Oncogene. 2001; 20: 4777-4792Crossref PubMed Scopus (62) Google Scholar), HepG2 hepatocellular carcinoma (31Brasier A.R. Lu M. Hai T. Lu Y. Boldogh I. J. Biol. Chem. 2001; 276: 32080-32093Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar), and HL-60 acute myeloid leukemia cells stably transfected with BCR-ABL (HL-60/BCR-ABL) or empty vector (HL-60/Neo) were cultured as described (23Amarante-Mendes G.P. Naekyung K.C. Liu L. Huang Y. Perkins C.L. Green D.R. Bhalla K. Blood. 1998; 91: 1700-1705Crossref PubMed Google Scholar). Where indicated, paclitaxel (Sigma) was resuspended in Me2SO and added to a final concentration of 1 μm.In some experiments, cells were isolated from leukemic bone marrow aspirates. Bone marrow aspirates were obtained after informed consent was obtained under an institutional review board-approved protocol at the time of diagnosis or treatment on the Adult Leukemia Service at the Johns Hopkins Hospital. Fractions of mononuclear cells or granulocytes were isolated on double Ficoll-Hypaque gradients (32English D. Andersen B.R. J. Immunol. Methods. 1974; 5: 249-252Crossref PubMed Scopus (575) Google Scholar), washed with RPMI 1640 medium containing 10 mm HEPES (pH 7.4), lysed in 6 m guanidine hydrochloride under reducing conditions, reacted with iodoacetamide, dialyzed into 0.1% (w/v) SDS, and lyophilized as described (33Kaufmann S.H. Mclaughlin S.J. Kastan M. Liu L.F. Karp J.E. Burke P.J. Cancer Res. 1991; 51: 3534-3543PubMed Google Scholar).Membrane Based cDNA Macroarrays—Total RNA was extracted from control (HL-60/Neo) or p210BCR-ABL-expressing (HL-60/BCR-ABL) cells by acid guanidium-phenol extraction (TRI Reagent, Sigma) and treated with DNase. Five micrograms were reverse transcribed in the presence of 35 μCi of [α-33P]dATP and cDNA was purified by column chromatography (Chroma spin-200, Clontech). Atlas 1.2 Arrays (Clontech) were hybridized with 106 cpm/ml of probe at 68 °C and washed as recommended by the manufacturer. Membranes were exposed to a PhosphorImager cassette and relative changes in hybridization intensity were determined by AtlasImage 1.01 software (Clontech). Comparisons of mRNA populations between control and p210BCR-ABL-expressing cells were performed with two different sets of Atlas Array membrane lots in two independent experiments.For each gene, local background was subtracted from the total hybridization intensity and the average signal intensity was determined for duplicate spots. To compare differences in gene expression between arrays, background subtracted average intensity was normalized to that of housekeeping genes. Only those genes that showed an average 3.5-fold up-regulation or down-regulation across duplicate membranes were further considered.High Density Oligonucleotide Arrays—Four independent RNA samples were prepared from the HL-60/Neo and the HL-60/BCR-ABL-transfected cells for hybridization to the Hu95A GeneChip (Affymetrix, Santa Clara, CA). First-strand cDNA synthesis was performed using total RNA (10–25 μg), a T7-(dT)24 oligomer and SuperScript II reverse transcriptase (Invitrogen). Second strand synthesis, target RNA labeling, and hybridization were as previously described (34Zhang Y. Luxon B.A. Casola A. Garofalo R.P. Jamaluddin M. Brasier A.R. J. Virol. 2001; 75: 9044-9058Crossref PubMed Scopus (195) Google Scholar). Gene Chip arrays were scanned using a Gene Array Scanner (Hewlett-Packard) and analyzed using the Gene Chip Analysis Suite 4 software (Affymetrix Inc.). The average difference statistic was retrieved for quantification of mRNA abundance in those samples in which the absolute call indicated that the gene was present.Oligonucleotide Microarray Data Analysis—Reproducibility of the four independent microarrays was determined by calculating the correlation coefficient for the log-transformed average difference values for the probe sets in each array (34Zhang Y. Luxon B.A. Casola A. Garofalo R.P. Jamaluddin M. Brasier A.R. J. Virol. 2001; 75: 9044-9058Crossref PubMed Scopus (195) Google Scholar). For each pairwise comparison, the mean correlation coefficient was 0.945 ± 0.024 (n = 6) in the HL-60/Neo data sets, and 0.977 ± 0.010 (n = 6) for the HL-60/BCR-ABL data sets, indicating that the measurements were highly reproducible (Table I). For comparison of the fluorescence intensity (average difference) values among multiple experiments, the average difference values for each “experimental” GeneChip were scaled to that of the “base” GeneChip (34Zhang Y. Luxon B.A. Casola A. Garofalo R.P. Jamaluddin M. Brasier A.R. J. Virol. 2001; 75: 9044-9058Crossref PubMed Scopus (195) Google Scholar). Genes differentially expressed were identified by one-way ANOVA with replicates comparing the average difference values of a probe sets in HL-60/Neo versus HL-60/BCR-ABL. Genes (probe sets) with a p value (Pr(F)) < 0.0001 were selected for further analysis. Agglomerative hierarchical clustering using the unweighted pair-group method with arithmetic mean (34Zhang Y. Luxon B.A. Casola A. Garofalo R.P. Jamaluddin M. Brasier A.R. J. Virol. 2001; 75: 9044-9058Crossref PubMed Scopus (195) Google Scholar) was performed on the indicated genes (Spotfire Array Explorer, version 7, Spotfire Inc., Cambridge, MA). Data are graphically presented as heat maps in which fluorescence intensity is represented by a color gradient.Table IMeta-analysis of high density oligonucleotide micorarray dataMicroarrayCorrelation coefficientNormal factorNeo-1Neo-2Neo-3Neo-4Neo-11aBy definition.0.9530.9780.9771Neo-21aBy definition.0.9450.9211.102Neo-31aBy definition.0.9831.05Neo-41aBy definition.1.27MicroarrayCorrelation coefficientNormal factorBcr-Abl-1Bcr-Abl-2Bcr-Abl-3Bcr-Abl-4Bcr-Abl-11aBy definition.0.9760.9740.9771.08Bcr-Abl-21aBy definition.0.9660.9971.12Bcr-Abl-31aBy definition.0.9741.07Bcr-Abl-41aBy definition.1.08a By definition. Open table in a new tab Northern Blot Analysis—RNA was isolated from K562, HL-60 Neo, and HL-60 BCR-ABL cells using RNAqueous (Ambion). 20 μg of total RNA was fractionated by electrophoresis on a denaturing formaldehyde, 1% agarose gel (13Jamieson L. Carpenter L. Biden T.J. Fields A.P. J. Biol. Chem. 1999; 274: 3927-3930Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar), transferred to BrightStar membrane (Ambion), and immobilized by UV cross-linking. Full-length, linearized Hsp70 cDNA, glyceraldehyde-3-phosphate dehydrogenase control probe (Ambion), and 18S rRNA control probes were radiolabeled with 32P using the X kit (Amersham Biosciences), hybridized and washed (13Jamieson L. Carpenter L. Biden T.J. Fields A.P. J. Biol. Chem. 1999; 274: 3927-3930Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar).Western Blot Analysis—Western blots were performed as described previously (13Jamieson L. Carpenter L. Biden T.J. Fields A.P. J. Biol. Chem. 1999; 274: 3927-3930Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). Briefly, cells were counted and equal numbers were harvested and lysed directly into Laemmli sample buffer. Equal volumes of sample were then fractionated by a 5–20% SDS-PAGE gradient gel (Invitrogen), transferred to nitrocellulose membranes, and blocked with 5% nonfat dry milk in phosphate-buffered saline, 1% Tween 20. Blots were then probed with the indicated primary antibody; immune complexes were detected by enhanced chemiluminescence (ECL, Amersham) or, where indicated, near-infrared fluorescence (Odyssey Imaging System, LiCor BioSciences).Plasmids—The –259/+37 Hsp70/LUC promoter-driven luciferase reporter plasmid was constructed by PCR of HL60 genomic DNA using the upstream primer –259 5′-ACGGATCCCACCGCCACTCCCCCTTC-3′, and the Hsp70 downstream primer 5′-AAAAAGCTTGTGGACTGTCGCAGCAGCTC-3′ (HindIII site underlined). The restricted gelpurified PCR product was ligated into pOLUC reporter digested with the same endonucleases (35Brasier A.R. Ausubel F.M. Current Protocols in Molecular Biology. John Wiley & Sons, New York1990: 9.6.10-9.6.13Google Scholar). A series of 5′ deletions were constructed by PCR using Hsp70 (–259/+37)/LUC as template with the upstream primers –200, 5′-GTGGATCCCAGAAGACTCTG-3′; –163, 5′-GCGGATCCCTGGCCTCTGATT-3′; –123, 5′-GGGGATCCACGGGAGGCGAAA-3′; –82, 5′-CCTGGATCCCTCATCGAGCTC-3′; –58, 5′-GATTGGATCCGAAGGGAAAAGG-3′, and the Hsp70 downstream primer. Each 5′ deletion was digested with BamHI (site is underlined) and HindIII, gel purified, and ligated into pOLUC. The site-directed mutation of the GATA binding element was constructed by PCR SOEing (36Horton R.M. Cai Z. Ho S.N. Pease L.R. BioTechniques. 1990; 8: 528-535PubMed Google Scholar) using the sense primer 5′-GAGCTCGGTCTCAGGCTCAGGATA-3′ and the antisense primer 5′-TCTGAGCCTGAGACCGAG-3′ (mutations underlined) with the Hsp70 downstream primer.The multimeric GATA (WT) and GATA (Mut)-driven reporter was constructed by annealing the sense and antisense oligonucleotides as: GATA (WT): sense, GATCGAGCTCGGTGATTGGCTCAGAA and anti-sense, CTCGAGCCACTAACCGAGTCTTCTAG; GATA (Mut): sense, GATCGAGCTCGGTCTCAGGCTCAGAA and antisense, CTCGAGCCAGAGTCCGAGTCTTCTAG. Duplex oligonucleotides were then phosphorylated, ligated with T4 DNA ligase, 3 copies were ligated into BamHI linearized –59/+22 rAGT/LUC, driven by the inert angiotensinogen TATA box (35Brasier A.R. Ausubel F.M. Current Protocols in Molecular Biology. John Wiley & Sons, New York1990: 9.6.10-9.6.13Google Scholar). pCMV-FLAG BCR-ABL expression vectors were constructed by ligating the BCR-ABL coding sequences into pCMV-Tag plasmid (37Cortez D. Kadlec L. Pendergast A.M. Mol. Cell. Biol. 1995; 15: 5531Crossref PubMed Scopus (267) Google Scholar). All plasmids were purified by ion exchange chromatography (Qiagen) and cloned inserts were sequenced to confirm authenticity.Cell Transfection and Reporter Assays—Transient transfections in K562 cells were carried out using DMRIE-C reagent (Invitrogen). For reporter plasmids, 4 to 10 μg of plasmid DNA was resuspended into 0.5 ml of OPTI-MEM® I reduced serum medium (Invitrogen), mixed with an equal volume of medium containing 10 μl of DMRIE-C Reagent, and incubated at room temperature for 15 min to allow lipid-DNA complex formation. Logarithmically growing K562 cells (2 × 106 cells) were centrifuged, resuspended in 0.5 ml of reduced serum medium, and added to the lipid-DNA complex and incubated at 37 °C in a CO2 incubator for 5 h. After transfection, growth medium (containing 10% fetal bovine serum) was added and the cells were incubated overnight. For reporter assays, cells were harvested at the indicated time points and washed two times with cold phosphate-buffered saline. Cytoplasmic lysates were prepared and independently measured for luciferase and β-galactosidase activity (Promega, Madison, WI) as described previously (35Brasier A.R. Ausubel F.M. Current Protocols in Molecular Biology. John Wiley & Sons, New York1990: 9.6.10-9.6.13Google Scholar). Luciferase reporter activity was normalized to the internal control of β-galactosidase activity to control for differences in transfection efficiency.Electrophoretic Mobility Shift Assay (EMSA)—Nuclear proteins were purified over a sucrose cushion (31Brasier A.R. Lu M. Hai T. Lu Y. Boldogh I. J. Biol. Chem. 2001; 276: 32080-32093Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar) normalized for protein concentration by the Coomassie G-250 assay (Bio-Rad). The GATA (WT) monomeric duplex was radiolabeled with Klenow polymerase and purified by gel filtration chromatography. DNA-binding reactions were carried out in a mixture of 20 μg of nuclear proteins, 12 mm HEPES (pH 7.9), 40 mm KCl, 120 mm NaCl, 0.2 mm EDTA, 0.2 mm EGTA, 0.4 mm dithiothreitol, 0.5 mm phenylmethylsulfonyl fluoride, 8% glycerol, 2 μg of poly(dA-dT), and 20,000 cpm of α-32P-labeled double-stranded GATA (WT) probe in a total volume of 20 μl. The reaction mixture was incubated on ice for 15 min and then fractionated by 6% nondenaturing PAGE containing 2% glycerol. Gels were dried and subjected to autoradiography using Kodak X-AR film at –70 °C. Competition was performed by the addition of a 100-fold molar excess of nonradioactive double-stranded oligonucleotide competitor at the time of addition of the radioactive probe. For supershift, anti-GATA-1 antibody was added to the gel shift reaction and incubated on ice for 1 h prior to fractionation by nondenaturing PAGE.Apoptosis—Cells were stained with annexin V-phycoerythrin using an Annexin V-Phycoerythrin Apoptosis Detection Kit I (BD Pharmingen). Briefly, 5 × 105 washed cells were collected by centrifugation and resuspended in annexin V-binding buffer. Cell suspensions were then incubated with annexin V-phycoerythrin at 1 μg/ml and 7 aminoactinomycin D at a final concentration of 1 μg/ml for 25 min at room temperature in the dark. The percentage of apoptotic cells was determined by flow cytometry (BD Biosciences FACScan) analysis (38Dive C. Gregory C.D. Phipps D.J. Evans D.L. Milner A.E. Wyllie A.H. Biochim. Biophys. Acta. 1992; 1133: 275-285Crossref PubMed Scopus (498) Google Scholar).SiRNA-mediated Hsp-70 “Knockdown”—Various concentrations from 50 to 200 nm Hsp70 or lamin A/C siRNA (custom SMART pool, HSPA1L-NM,43005346, and siRNA CONTROl, Dharmacon Research Inc., Lafayette, CO) were substituted for the reporter plasmid and transfected into logarithmically growing K562 cells using DIMRIE-C as described above. After 5 h, growth medium was added and cells were returned to culture in the absence or presence of paclitaxel (1 μm final concentration) for the times indicated.RESULTSIdentification of Genes Downstream of the BCR-ABL Pathway—In this study, we initially determined gene expression profiles in HL-60 cells stably expressing p210BCR-ABL because these cells show enhanced Bcl-xL expression and decreased cytochrome c release in response to chemotherapeutic agent administration (23Amarante-Mendes G.P. Naekyung K.C. Liu L. Huang Y. Perkins C.L. Green D.R. Bhalla K. Blood. 1998; 91: 1700-1705Crossref PubMed Google Scholar). To confirm stable p210BCR-ABL expression, Western immunoblot analysis was performed using an anti-c-Abl antibody. HL-60/BCR-ABL cells express amounts of p210BCR-ABL comparable with Ph+ K562 cells, whereas the HL-60/Neo controls have no detectable BCR-ABL antigen (Fig. 1). To identify genomic targets of p210BCR-ABL we systematically examined differences in mRNA expression by cDNA macroarrays and high density oligonucleotide microarrays. Using membrane-based cDNA macroarrays containing 1,176 sequenced human gene probes, we identified 25 genes whose expression was increased by 3.5-fold (or greater), and 34 genes whose expression was reduced by 3.5-fold (or greater) in duplicate pairwise experiments (Table II)" @default.
• W1982160526 created "2016-06-24" @default.
• W1982160526 creator A5025956941 @default.
• W1982160526 creator A5040758762 @default.
• W1982160526 creator A5054370710 @default.
• W1982160526 creator A5056656832 @default.
• W1982160526 creator A5062655427 @default.
• W1982160526 creator A5077467093 @default.
• W1982160526 creator A5081306238 @default.
• W1982160526 creator A5082896068 @default.
• W1982160526 date "2004-08-01" @default.
• W1982160526 modified "2023-09-30" @default.
• W1982160526 title "Genomic Mechanisms of p210BCR-ABL Signaling" @default.
• W1982160526 cites W1501358984 @default.
• W1982160526 cites W1512176361 @default.
• W1982160526 cites W1515506492 @default.
• W1982160526 cites W1585207232 @default.
• W1982160526 cites W161377905 @default.
• W1982160526 cites W1621649724 @default.
• W1982160526 cites W1964445294 @default.
• W1982160526 cites W1967134457 @default.
• W1982160526 cites W1967357725 @default.
• W1982160526 cites W1967912613 @default.
• W1982160526 cites W1971044323 @default.
• W1982160526 cites W1981460612 @default.
• W1982160526 cites W1989911355 @default.
• W1982160526 cites W1998593414 @default.
• W1982160526 cites W1999965011 @default.
• W1982160526 cites W2008267412 @default.
• W1982160526 cites W2015985237 @default.
• W1982160526 cites W2031879122 @default.
• W1982160526 cites W2032164085 @default.
• W1982160526 cites W2042502745 @default.
• W1982160526 cites W2043027439 @default.
• W1982160526 cites W2046184981 @default.
• W1982160526 cites W2047763508 @default.
• W1982160526 cites W2049706987 @default.
• W1982160526 cites W2054498037 @default.
• W1982160526 cites W2059901120 @default.
• W1982160526 cites W2068180652 @default.
• W1982160526 cites W2076372887 @default.
• W1982160526 cites W2106405240 @default.
• W1982160526 cites W2107789276 @default.
• W1982160526 cites W2115524556 @default.
• W1982160526 cites W2122950950 @default.
• W1982160526 cites W2131593588 @default.
• W1982160526 cites W2140277400 @default.
• W1982160526 cites W2142618806 @default.
• W1982160526 cites W2143811868 @default.
• W1982160526 cites W2148573587 @default.
• W1982160526 cites W2157786523 @default.
• W1982160526 cites W2163104931 @default.
• W1982160526 cites W2207680991 @default.
• W1982160526 cites W2227735896 @default.
• W1982160526 cites W2313786846 @default.
• W1982160526 cites W2314938037 @default.
• W1982160526 cites W2319634557 @default.
• W1982160526 cites W2331087852 @default.
• W1982160526 cites W2339475636 @default.
• W1982160526 cites W3111969190 @default.
• W1982160526 cites W3113125785 @default.
• W1982160526 cites W3203413 @default.
• W1982160526 cites W3719606 @default.
• W1982160526 cites W4234701232 @default.
• W1982160526 cites W4236884242 @default.
• W1982160526 doi "https://doi.org/10.1074/jbc.m401851200" @default.
• W1982160526 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15155749" @default.
• W1982160526 hasPublicationYear "2004" @default.
• W1982160526 type Work @default.
• W1982160526 sameAs 1982160526 @default.
• W1982160526 citedByCount "51" @default.
• W1982160526 countsByYear W19821605262012 @default.
• W1982160526 countsByYear W19821605262013 @default.
• W1982160526 countsByYear W19821605262014 @default.
• W1982160526 countsByYear W19821605262015 @default.
• W1982160526 countsByYear W19821605262016 @default.
• W1982160526 countsByYear W19821605262017 @default.
• W1982160526 countsByYear W19821605262018 @default.
• W1982160526 countsByYear W19821605262019 @default.
• W1982160526 countsByYear W19821605262020 @default.
• W1982160526 countsByYear W19821605262021 @default.
• W1982160526 countsByYear W19821605262022 @default.
• W1982160526 crossrefType "journal-article" @default.
• W1982160526 hasAuthorship W1982160526A5025956941 @default.
• W1982160526 hasAuthorship W1982160526A5040758762 @default.
• W1982160526 hasAuthorship W1982160526A5054370710 @default.
• W1982160526 hasAuthorship W1982160526A5056656832 @default.
• W1982160526 hasAuthorship W1982160526A5062655427 @default.
• W1982160526 hasAuthorship W1982160526A5077467093 @default.
• W1982160526 hasAuthorship W1982160526A5081306238 @default.
• W1982160526 hasAuthorship W1982160526A5082896068 @default.
• W1982160526 hasBestOaLocation W19821605261 @default.
• W1982160526 hasConcept C125418893 @default.
• W1982160526 hasConcept C42362537 @default.
• W1982160526 hasConcept C54355233 @default.
• W1982160526 hasConcept C62478195 @default.
• W1982160526 hasConcept C70721500 @default.
• W1982160526 hasConcept C86803240 @default.

• next