FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1982173676> ?p ?o ?g. }

• W1982173676 endingPage "48763" @default.
• W1982173676 startingPage "48755" @default.
• W1982173676 abstract "Gastrin is a hormone produced by G-cells in the normal gastric antrum. However, colorectal carcinoma cells may aberrantly produce gastrin and exhibit increased expression of cholecystokinin B (CCK-B)/gastrin receptors. Gastrin is trophic for the normal gastric oxyntic mucosa and exerts a growth-promoting action on gastrointestinal malignancy. Thus, gastrin may act as an autocrine/paracrine or endocrine factor in the initiation and progression of colorectal carcinoma. The molecular mechanisms involved have not been elucidated. Hypergastrinemia induced byHelicobacter pylori infection is associated with increased cyclooxygenase-2 (COX-2) expression in gastric and colorectal tissues, suggesting the possibility that gastrin up-regulates COX-2 expression in these tissues; this has not been confirmed. We report here that gastrin significantly increases the expression of COX-2 mRNA and protein, the activity of the COX-2 promoter, and the release of prostaglandin E2 from a rat intestinal epithelial cell line transfected with the CCK-B receptor. These actions were dependent upon the activation of multiple MAPK signal pathways, including ERK5 kinase; transactivation of the epidermal growth factor receptor; and the increased expression and activities of transcription factors ELK-1, activating transcription factor-2, c-Fos, c-Jun, activator protein-1, and myocyte enhancer factor-2. Thus, our findings identify the signaling pathways coupling the CCK-B receptor with up-regulation of COX-2 expression. This effect may contribute to this hormone-dependent gastrointestinal carcinogenesis, especially in the colon. Gastrin is a hormone produced by G-cells in the normal gastric antrum. However, colorectal carcinoma cells may aberrantly produce gastrin and exhibit increased expression of cholecystokinin B (CCK-B)/gastrin receptors. Gastrin is trophic for the normal gastric oxyntic mucosa and exerts a growth-promoting action on gastrointestinal malignancy. Thus, gastrin may act as an autocrine/paracrine or endocrine factor in the initiation and progression of colorectal carcinoma. The molecular mechanisms involved have not been elucidated. Hypergastrinemia induced byHelicobacter pylori infection is associated with increased cyclooxygenase-2 (COX-2) expression in gastric and colorectal tissues, suggesting the possibility that gastrin up-regulates COX-2 expression in these tissues; this has not been confirmed. We report here that gastrin significantly increases the expression of COX-2 mRNA and protein, the activity of the COX-2 promoter, and the release of prostaglandin E2 from a rat intestinal epithelial cell line transfected with the CCK-B receptor. These actions were dependent upon the activation of multiple MAPK signal pathways, including ERK5 kinase; transactivation of the epidermal growth factor receptor; and the increased expression and activities of transcription factors ELK-1, activating transcription factor-2, c-Fos, c-Jun, activator protein-1, and myocyte enhancer factor-2. Thus, our findings identify the signaling pathways coupling the CCK-B receptor with up-regulation of COX-2 expression. This effect may contribute to this hormone-dependent gastrointestinal carcinogenesis, especially in the colon. Cyclooxygenase-2 (COX-2) 1The abbreviations used are: COX-2, cyclooxygenase-2; CCK-BR, cholecystokinin B receptor; EGFR, epidermal growth factor receptor; ERK, extracellular signal-regulated kinase; MEF2, myocyte enhancer factor-2; MAPK, mitogen-activated protein kinase; ATF2, activating transcription factor-2; AP-1, activator protein-1; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; JNK, c-Jun N-terminal kinase; PGE2, prostaglandin E2; MKK, mitogen-activated protein kinase kinase; GPCR, G protein-coupled receptor; STAT, signal transducer and activator of transcription; dn, dominant-negative; HB-EGF, heparin-binding epidermal growth factor-like growth factor. is an inducible enzyme catalyzing the rate-limiting step in prostaglandin synthesis, converting arachidonic acid to prostaglandin H2 (1Williams C.S. Mann M. DuBois R.N. Oncogene. 1999; 18: 7908-7916Google Scholar). A large body of genetic and biochemical evidence supports the important role of COX-2 in tumorigenesis, particularly in colorectal cancer (1Williams C.S. Mann M. DuBois R.N. Oncogene. 1999; 18: 7908-7916Google Scholar). COX-2 is overexpressed in cancer cells and is associated with enhanced invasiveness (1Williams C.S. Mann M. DuBois R.N. Oncogene. 1999; 18: 7908-7916Google Scholar). However, the molecular mechanisms leading to up-regulation of COX-2 in intestinal cells are not completely understood. Gastrointestinal hormones regulate gastrointestinal homeostasis by affecting cell proliferation, differentiation, apoptosis, and gene expression. Aberrant control of these biological processes is thought to play an important role in establishment of intestinal neoplasia (2Podolsky D.K. Am. J. Physiol. 1993; 264: G179-G186Google Scholar,3Guo Y.-S. Townsend Jr., C.M. J. Hepatobiliary Pancreat. Surg. 2000; 7: 276-285Google Scholar). Gastrin is a gastrointestinal hormone that is produced by G-cells in the normal gastric antrum (4Rozengurt E. Walsh J.H. Annu. Rev. Physiol. 2001; 63: 49-76Google Scholar). We (5Upp Jr., J.R. Singh P. Townsend Jr., C.M. Thompson J.C. Cancer Res. 1989; 49: 488-492Google Scholar) and others (6Schmitz F. Otte J.M. Stechele H.U. Reimann B. Banasiewicz T. Folsch U.R. Schmidt W.E. Herzig K.H. Eur. J. Clin. Invest. 2001; 31: 812-820Google Scholar) have shown that expression of cholecystokinin B/gastrin receptors is increased in most colon cancers. Gastrin is trophic for the normal gastric oxyntic mucosa and exerts a growth-promoting action on gastrointestinal malignancy (3Guo Y.-S. Townsend Jr., C.M. J. Hepatobiliary Pancreat. Surg. 2000; 7: 276-285Google Scholar,4Rozengurt E. Walsh J.H. Annu. Rev. Physiol. 2001; 63: 49-76Google Scholar, 7Guo Y.-S. Townsend Jr., C.M. Greeley Jr., G.H. Gastrointestinal Endocrinology. Humana Press, Inc., Totowa, NJ1999: 189Google Scholar, 8Guo Y.-S. Baijal M. Jin G.-F. Thompson J.C. Townsend Jr., C.M. Singh P. In Vitro Cell. Dev. Biol. 1990; 26: 871-877Google Scholar). Ciccotosto et al. (9Ciccotosto G.D. McLeish A. Hardy K.J. Shulkes A. Gastroenterology. 1995; 109: 1142-1153Google Scholar) reported that 69% of colon cancers contain fully processed gastrin and that 100% have detectable amounts of progastrin, reflecting aberrant production of both gastrin and progastrin by colon cancer. Watson et al. (10Watson S.A. Michaeli D. Morris T.M. Clarke P. Varro A. Griffin N. Smith A. Justin T. Hardcastle J.D. Eur. J. Cancer. 1999; 35: 1286-1291Google Scholar, 11Watson S.A. Clarke P.A. Morris T.M. Caplin M.E. Cancer Res. 2000; 60: 5902-5907Google Scholar) showed that immune neutralization of gastrin or its cognate receptor by antisera inhibits the growth, invasion, and metastasis of colorectal tumors. These findings suggest that gastrin plays a crucial role in colorectal cancer development; however, the molecular mechanisms have not been defined. Helicobacter pylori infects >50% of the world population, results in chronic antral gastritis with prolonged hypergastrinemia, and may play a role in development of gastric cancer (12Konturek S.J. Konturek P.C. Hartwich A. Hahn E.G. Regul. Pept. 2000; 93: 13-19Google Scholar). Recent evidence shows that 85% of colorectal cancer patients have H. pylori infection and that these patients consistently overexpress COX-2 in the colonic cancer tissue, but not in normal mucosa, where only COX-1 is detected. These data suggest thatH. pylori infection may contribute to colorectal carcinogenesis by enhancing colonic expression of gastrin and COX-2 (12Konturek S.J. Konturek P.C. Hartwich A. Hahn E.G. Regul. Pept. 2000; 93: 13-19Google Scholar, 13Hartwich J. Konturek S.J. Pierzchalski P. Zuchowicz M. Konturek P.C. Bielanski W. Marlicz K. Starzynska T. Lawniczak M. Med. Sci. Monit. 2001; 7: 1171-1181Google Scholar). The fact that H. pylori induced hypergastrinemia is associated with increased COX-2 expression in gastric and colonic tissues suggests that gastrin may regulate COX-2 expression, but this possibility has not been confirmed (14Konturek S.J. Konturek P.C. Plonka A. Duda A. Sito E. Zuchowicz M. Hahn E.G. Prostaglandins Other Lipid Mediat. 2001; 66: 39-51Google Scholar). The purpose of this study was to examine whether the activation of the cholecystokinin B receptor (CCK-BR) by gastrin leads to up-regulation of COX-2 expression in intestinal epithelial cells and, if so, to determine the signaling pathways linking CCK-BR to the expression of COX-2. To test this hypothesis, we developed a cell line derived from RIE-1 rat intestinal epithelial cells transfected with human CCK-BR (RIE/CCKBR cells). Using this cell model, we report here, for the first time, that 1) gastrin significantly stimulates COX-2 expression; 2) this action requires ligand-independent activation of the epidermal growth factor receptor (EGFR); and 3) up-regulation of the ERK5/MEF2 pathway is involved. In addition, gastrin activates other MAPK-dependent pathways and increases the expression and activities of other transcription factors such as ELK-1, activating transcription factor-2 (ATF2), c-Fos, c-Jun, and activator protein-1 (AP-1). Thus, our findings identify the signaling pathways coupling CCK-BR with up-regulation of COX-2 expression, which may contribute to gastrin-mediated gastrointestinal carcinogenesis, especially in the colon. A 2.0-kb EcoRI/HindIII fragment of human full-length CCK-BR cDNA was a gift from Dr. Alan S. Kopin (Tufts University, School of Medicine, Boston, MA) and subcloned into the EcoRI/HindIII sites of the pcDNA3.1 vector (Invitrogen). The vectors MEF2-luc, Gal4-MEF2A, Gal4-MEF2B, Gal4-MEF2C, Gal4-MEF2D, and MEK5AA and a hemagglutinin-tagged form of ERK5 were prepared as described previously (15Marinissen M.J. Chiariello M. Pallante M. Gutkind J.S. Mol. Cell. Biol. 1999; 19: 4289-4301Google Scholar, 16Coso O.A. Montaner S. Fromm C. Lacal J.C. Prywes R. Teramoto H. Gutkind J.S. J. Biol. Chem. 1997; 272: 20691-20697Google Scholar). Wild-type Gal4-c-Jun and its mutant were provided by Dr. Michael Karin (University of California, La Jolla, CA). Gal4-ATF2-(1–109) was provided by Dr. Roger J. Davis (Howard Hughes Institute, Worcester, MA). Other plasmids were described previously (17Guo Y.-S. Hellmich M.R. Wen X.D. Townsend Jr., C.M. J. Biol. Chem. 2001; 276: 22941-22947Google Scholar). The anti-COX-2 antibodies were obtained from Cayman Chemical Co., Inc. (Ann Arbor, MI). The anti-active ERK1/2 antibody (pTEpY) was purchased from Promega (Madison, WI). Anti-phospho-p38MAPK, anti-phospho-JNK, anti-phospho-ELK-1, and anti-phospho-ATF2 antibodies were obtained fromCell Signaling (Beverly, MA). The anti-phospho-ERK5 antibody was purchased from Sigma. The anti-EGFR and anti-phosphotyrosine (4G10) antibodies were provided by Upstate Biotechnology, Inc. (Lake Placid, NY). RIE-1 cells were a gift from Dr. Kenneth D. Brown (Cambridge Research Station, Babraham, Cambridge, UK) and were transfected with human CCK-BR using LipofectAMINE (Invitrogen) according to the manufacturer's recommendations. G418-resistant colonies were selected as described previously (18Guo Y.-S. Jin G.-F. Houston C.W. Thompson J.C. Townsend Jr., C.M. J. Cell. Physiol. 1998; 175: 141-148Google Scholar). The number of binding sites (Bmax) and their binding affinities (Kd) were determined using125I-labeled gastrin binding assays as described (19Guo Y.-S. Beauchamp R.D. Jin G.-F. Townsend Jr., C.M. Thompson J.C. Gastroenterology. 1993; 104: 1595-1604Google Scholar). Agonist-induced changes in [Ca2+]i were detected using the Ca2+-sensitive dye Fura-2/AM (Molecular Probe, Inc., Eugene, OR) as previously described (17Guo Y.-S. Hellmich M.R. Wen X.D. Townsend Jr., C.M. J. Biol. Chem. 2001; 276: 22941-22947Google Scholar). Cells were cultured at 37 °C in a humidified atmosphere of 95% air and 5% CO2in Dulbecco's modified Eagle's medium supplemented with 5% heat-inactivated fetal bovine serum (Hyclone Laboratories, Logan, UT) and 400 μg/ml Geneticin (G418, Invitrogen). Total cellular RNA was extracted as previously described (17Guo Y.-S. Hellmich M.R. Wen X.D. Townsend Jr., C.M. J. Biol. Chem. 2001; 276: 22941-22947Google Scholar). RNA samples (30 μg/lane) were separated on formaldehyde-containing 1.25% agarose gels and blotted onto Nytran Plus filters (Schleicher & Schüll). The blots were hybridized with cDNA probes labeled with [α-32P]dATP by random primer extension. Specific hybridization was visualized by autoradiography. To ensure RNA integrity and to confirm equal loading between lanes, the filters were stripped and rehybridized with a probe for 18 S rRNA. Immunoblot analysis was performed as described previously (17Guo Y.-S. Hellmich M.R. Wen X.D. Townsend Jr., C.M. J. Biol. Chem. 2001; 276: 22941-22947Google Scholar, 18Guo Y.-S. Jin G.-F. Houston C.W. Thompson J.C. Townsend Jr., C.M. J. Cell. Physiol. 1998; 175: 141-148Google Scholar). The cells were lysed for 30 min on ice in radioimmune precipitation assay (RIPA) buffer consisting of 50 mm Tris-HCl (pH 7.4), 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mm NaCl, 1 mm EGTA, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, and 1 mm sodium orthovanadate. Cellular proteins were denatured by heating, resolved by SDS-PAGE, transferred to nitrocellulose membranes, and probed with the indicated antibodies and then with peroxidase-coupled secondary antibodies. Proteins were detected using the enhanced chemiluminescence system (ECL, Amersham Biosciences). RIE/CCKBR cells were plated in 24-well plates. Thirty-six hours later, the medium was replaced with serum-free Dulbecco's modified Eagle's medium. The cells were then incubated with or without gastrin for the indicated times. The medium was collected from each well and analyzed for PGE2 by enzyme-linked immunosorbent assay (Cayman Chemical Co., Inc.). RIE/CCKBR cells were seeded in six-well plates at a density of 2 × 105 cells/well. After overnight adhesion, cells were transfected with 2 μg of promoter-luciferase reporter DNA and 0.02 μg of pRL-TKluc vector (Promega) using FuGENE 6 (Roche Molecular Biochemicals). Prior to assaying for luciferase activity, cells were incubated in Dulbecco's modified Eagle's medium without serum (24 h) and treated with gastrin for 6 h. Luciferase activity in 20 μl of cell extract was assayed using the Dual-Luciferase assay system (Promega) with a Monolight 2010 luminometer (Analytical Luminescence Laboratory). The activity of the pRL-TKluc plasmid is distinguished from that of the other firefly luciferase reporters and was used to normalize for variation in transfection efficiency. Nuclear extracts were prepared as previously described (17Guo Y.-S. Hellmich M.R. Wen X.D. Townsend Jr., C.M. J. Biol. Chem. 2001; 276: 22941-22947Google Scholar). An oligonucleotide corresponding to the AP-1-binding site consensus sequence was purchased from Stratagene (La Jolla, CA). The double-stranded oligonucleotide of the MEF2 DNA-binding site in the mouse COX-2 promoter (CATTTCATTAAAAATAGAAGAA) was synthesized by Genosys Biotechnologies, Inc. (The Woodlands, TX). The oligonucleotides were end-labeled with [γ-32P]ATP and T4 polynucleotide kinase. Electrophoretic mobility shift assay reaction mixtures contained 50,000 cpm of 32P-end-labeld oligonucleotide, 20 μg of nuclear protein extract, and 1.0 μg of poly(dI·dC) (Amersham Biosciences) in a final volume of 20 μl. Reaction mixtures were resolved on 4% nondenaturing polyacrylamide gel at 200 V for 2 h. Gels were dried and visualized by autoradiography. All experiments were repeated on at least three separate occasions. Results from Northern and Western blotting were quantified by densitometry. Values are expressed as means ± S.E. Differences between means were compared using the analysis of variance test and were considered significantly different at p < 0.05. To determine whether gastrin can regulate endogenous COX-2 expression in RIE-1 cells, cells were stably transfected with an expression vector containing a human CCK-BR cDNA downstream of the cytomegalovirus promoter. After selection with G418, surviving cell clones were evaluated for the level of receptor expression using radiolabeled ligand binding and Ca2+ imaging with the Ca2+ indicator dye Fura-2/AM. The binding affinity of 125I-gastrin was calculated in terms of the equilibrium dissociation constant (Kd) from the Scatchard plot of specific binding data. The clone of RIE/CCKBR cells used in this study exhibits aKd value of 0.3 nm with 8000 binding sites/cell. Fura-2 imaging experiments revealed that >92 and 97% of these cells exhibited an increase in [Ca2+]i upon stimulation with 1 and 100 nm gastrin, respectively (Fig. 1, B–E). Gastrin significantly induced time- and dose-dependent increases in the expression of COX-2 mRNA and protein in RIE/CCKBR cells. Compared with untreated cells, the steady-state COX-2 mRNA levels increased in cells treated with gastrin (100 nm) by 2.8-, 3.8-, 4.5-, 5.6-, and 1.3-fold at 1, 2, 4, 8, and 24 h, respectively (Fig. 2A). Gastrin also increased COX-2 mRNA abundance in a dose-dependent fashion. Treatment with 1 and 10 nm gastrin for 8 h revealed 3.2- and 4.8-fold increases in COX-2 mRNA abundance, respectively, whereas 100 and 1000 nm induced maximum responses (6.8-fold) (Fig. 2B). Moreover, gastrin treatment evoked a time-dependent increase in COX-2 protein levels. Western blots exhibited no detectable expression of COX-2 protein in untreated RIE/CCKBR cells, but showed an increase in COX-2 protein by 6 h, reaching a maximum intensity at 12–24 h after stimulation (Fig. 2C). COX converts arachidonic acid, released from the cell lipid bilayer by the action of phospholipase A2, to prostaglandin H2, the common precursor of all prostaglandins (1Williams C.S. Mann M. DuBois R.N. Oncogene. 1999; 18: 7908-7916Google Scholar). To examine whether increased COX-2 expression is associated with elevated prostaglandin synthesis, the levels of PGE2 released from RIE/CCKBR cells were measured using an enzyme-linked immunosorbent assay. Compared with untreated control cultures, PGE2levels in the medium of RIE/CCKBR cells treated with gastrin rose 1.3-fold at 12 h and continued to increase to 6.2-fold at 48 h (Fig. 2D). COX-2 expression is controlled by both transcriptional and post-transcriptional mechanisms (17Guo Y.-S. Hellmich M.R. Wen X.D. Townsend Jr., C.M. J. Biol. Chem. 2001; 276: 22941-22947Google Scholar, 20Xie W. Herschman H.R. J. Biol. Chem. 1996; 271: 31742-31748Google Scholar, 21Sheng H. Shao J. Dixon D.A. Williams C.S. Prescott S.M. DuBois R.N. Beauchamp R.D. J. Biol. Chem. 2000; 275: 6628-6635Google Scholar). To determine whether gastrin regulates COX-2 promoter activity, RIE/CCKBR cells were transfected with different sized fragments of the mouse COX-2 promoter coupled with a luciferase reporter gene. Gastrin (100 nm) evoked a 3.2-fold increase in luciferase activity in cells transiently expressing TIS10L-luc (−963/+70) compared with untreated control cultures. A 2.0-fold induction was observed when using a shorter fragment of the COX-2 promoter (TIS10−80luc, −80/+70). Gastrin did not stimulate an increase in luciferase activity in cells containing the shortest COX-2 promoter construct (TIS10−40luc, −40/+70) (Fig. 2E). Thus, these data demonstrate that CCK-BR-mediated signaling pathways are linked to regulation of COX-2 promoter activity in RIE/CCKBR cells. MAPK signal transduction pathways constitute one of the major mechanisms by which extracellular stimuli are converted into specific nuclear responses. Four families of MAPK kinases have been identified, including the ERKs (which were initially known simply as MAPKs), JNK, p38MAPK, and big MAPK1 (BMK1 or ERK5). These kinases are regulated by their upstream specific MAPK kinases,i.e. MEK1, MKK4/7, MKK3/6, and MEK5, respectively (22Marinissen M.J. Gutkind J.S. Trends Pharmacol. Sci. 2001; 22: 368-376Google Scholar). To determine whether gastrin activates MAPK pathways in RIE/CCKBR cells, the levels of phosphorylation of the four MAPKs were determined by immunoblotting. We found that gastrin treatment stimulated the activation all of four MAPKs (Fig. 3). Western blots of RIE/CCKBR cell extracts, probed with antibodies selective for phosphorylated (activated forms) ERK1 and ERK2, showed that gastrin induced a time-dependent increase in phosphorylated ERK1 and ERK2 (Fig. 3A). This phosphorylation was increased 1 min after gastrin administration and reached a peak at 5 min before returning to the base-line level at 15 and 30 min. A second peak was detected at 60 min and was maintained at the same level for 120 min (Fig. 3A). The second peak may result from EGFR transactivation (phosphorylation) induced by gastrin because preincubation with the EGFR tyrosine kinase inhibitor AG1478 prevented the gastrin-elicited second peak (Fig. 3B), but not the first peak (data not shown), of ERK activation. Moreover, gastrin induced a time-dependent increase in tyrosine phosphorylation of EGFR (Fig. 3C). Gastrin also increased the phosphorylation of p38MAPK in a time-dependent manner. The phosphorylation of p38MAPK increased from 1 to 30 min and decreased thereafter (Fig. 3D). In addition, JNK activity was stimulated by gastrin. JNK phosphorylation was first noted at 1 min, reached peak levels at 5–15 min, and then returned to the basal level (Fig. 3E). The active status of JNK was further confirmed by a transactivation luciferase assay. We cotransfected RIE/CCKBR cells with an expression vector for the transactivation domain of c-Jun fused with the DNA-binding domain of Gal4 together with the Gal4-luc construct, a luciferase reporter gene under the control of five Gal4-responsive elements. In this system, Gal4-c-Jun can transactivate and stimulate luciferase activity only if serines 63 and 73 of c-Jun are phosphorylated by JNK and thus provide an indirect measure of JNK (23Hibi M. Lin A. Smeal T. Minden A. Karin M. Genes Dev. 1993; 7: 2135-2148Google Scholar). As shown in Fig. 3F, gastrin induced a 4.2-fold increase in luciferase activity in cells transfected with wild-type Gal4-c-Jun, but not with its mutant (serines 63 and 73 of c-Jun in the Gal4-c-Jun plasmid changed to alanines). In addition, ERK5 may participate in gastrin-dependent signaling transduction in RIE/CCKBR cells. ERK5, a novel type of MAPK with 816 amino acids, is about twice the size of other MAPKs, is regulated by activation of G protein-coupled receptors (GPCRs) and oxidative stresses, and is phosphorylated by MEK5 (16Coso O.A. Montaner S. Fromm C. Lacal J.C. Prywes R. Teramoto H. Gutkind J.S. J. Biol. Chem. 1997; 272: 20691-20697Google Scholar, 24Kato Y. Kravchenko V.V. Tapping R.I. Han J. Ulevitch R.J. Lee J.D. EMBO J. 1997; 16: 7054-7066Google Scholar). Whether gastrin activates ERK5 has not been reported. Immunoblotting using the anti-phospho-ERK5 antibody demonstrated that ERK5 phosphorylation after gastrin treatment was detected as early as 1 min, continued to increase up to 30 min, and declined subsequently (Fig. 3G). To determine whether MAPK activation is required for gastrin-induced COX-2 gene expression, RIE/CCKBR cells were pretreated for 30 min with selective inhibitors of MEK (PD98059) and p38MAPK(SB203580). PD98059 (10 μm) and SB203580 (5 μm) significantly suppressed gastrin-stimulated COX-2 mRNA abundance and promoter activity (Fig. 4, A and B). Because the gastrin-mediated ERK phosphorylation resulted partly from transactivation of EGFR (Fig. 3, A–C), we next examined the role of AG1487 in COX-2 protein expression using Western blotting. As shown in Fig. 4C, AG1487 inhibited, but not completely, gastrin-stimulated COX-2 protein levels. Moreover, in cells cotransfected with a vector containing the COX-2 promoter coupled with a luciferase reporter gene and a dominant-negative mutant vector for JNK or for MEK5, we found that these dominant-negative vectors significantly inhibited gastrin-elicited COX-2 promoter activity compared with the control cultures cotransfected with empty vector (Fig. 4D). Taken together, these results suggest that transactivation of the EGFR-, MEK/ERK1/2-, p38MAPK-, JNK-, and MEK5/ERK5-dependent pathways is involved in CCK-BR-mediated regulation of COX-2 gene expression. The COX-2 promoter contains multiple potentialcis-activating elements. To date, AP-1, cAMP-responsive element, E-box, NF-IL6 (CAAT/enhancer-binding protein-β), and NF-κB transcriptional elements have been reported to be involved in receptor-mediated COX-2 expression (17Guo Y.-S. Hellmich M.R. Wen X.D. Townsend Jr., C.M. J. Biol. Chem. 2001; 276: 22941-22947Google Scholar, 20Xie W. Herschman H.R. J. Biol. Chem. 1996; 271: 31742-31748Google Scholar, 25Yamamoto K. Arakawa T. Ueda N. Yamamoto S. J. Biol. Chem. 1995; 270: 31315-31320Google Scholar). Additionally, numerous other cis-activating consensus sequences have been identified within the COX-2 promoter, including AP-2, SP-1, MEF2, STAT1, and STAT3 sites (20Xie W. Herschman H.R. J. Biol. Chem. 1996; 271: 31742-31748Google Scholar, 25Yamamoto K. Arakawa T. Ueda N. Yamamoto S. J. Biol. Chem. 1995; 270: 31315-31320Google Scholar). Whether these cis-elements contribute to gastrin-induced COX-2 transcription is unknown. In several cell models, gastrin is a potent stimulator of the AP-1 transcription factor complex (26Hocker M. Zhang Z. Merchant J.L. Wang T.C. Am. J. Physiol. 1997; 272: G822-G830Google Scholar, 27Stepan V.M. Tatewaki M. Matsushima M. Dickinson C.J. del Valle J. Todisco A. Am. J. Physiol. 1999; 276: G415-G424Google Scholar). The AP-1 complex is composed of either homodimers of Jun protein or heterodimers of Jun and Fos proteins, which bind to a specific DNA consensus sequence (TGA(C/G)TCA) (28Pennypacker K.R. Hong J.S. McMillian M.K. FASEB J. 1994; 8: 475-478Google Scholar). Electrophoretic mobility shift assay using an end-labeled oligonucleotide probe containing the AP-1-binding consensus sequence showed an increase in AP-1-binding activity with gastrin (Fig. 5A). The AP-1-binding activity stimulated by gastrin was detected by 2 h, reached a maximum at 4 h, and diminished thereafter. To ensure specificity of binding, a competition experiment was performed using a 100-fold molar excess of unlabeled probe, which effectively competed the protein-DNA band (Fig. 5A, lane 6). Gastrin-stimulated expression of c-fos and c-junmRNAs preceded the increase in AP-1-binding activity. The mRNA abundance of both transcription factors was rapidly increase at 0.5 h and declined after 1–2 h of stimulation (Fig. 5B). Moreover, RIE/CCKBR cells transfected with luciferase gene reporters driven by either the serum response element located in the c-fos gene promoter or the 12-O-tetradecanoylphorbol-13-acetate response element within the c-jun gene promoter showed 1.8- and 2.2-fold increases in luciferase activity, respectively, compared with untreated cells (Fig. 5C), indicating that gastrin transactivated the activities of the c-fos and c-jun promoters. Expression of the c-fos and c-jun genes is regulated, in part, by ternary complex factors and ATF2, respectively. Ternary complex factors belong to the Ets domain family of DNA-binding proteins, including ELK-1, Sap-1A, and Sap-1B. The phosphorylation of ELK-1 or Sap-1 by MAPKs increases its ability to form complexes with the serum response factor and results in serum response element-dependent activation of the c-fospromoter (29Janknecht R. Cahill M.A. Nordheim A. Carcinogenesis. 1995; 16: 443-450Google Scholar, 30Whitmarsh A.J. Davis R.J. J. Mol. Med. 1996; 74: 589-607Google Scholar). The phosphorylation of ATF2 by p38MAPKand JNK increases the 12-O-tetradecanoylphorbol-13-acetate response element-dependent transcriptional activity of c-jun (29Janknecht R. Cahill M.A. Nordheim A. Carcinogenesis. 1995; 16: 443-450Google Scholar). To determine whether these transcription factors are involved in gastrin signaling, we determined the effect of gastrin on their phosphorylation state using antibodies directed against the phosphorylated (activated) forms of ELK-1 and ATF2. The phosphorylated ELK-1 was detected 1 min after gastrin treatment and was maintained at higher levels at 5–10 min before returning to the base-line level at 15 and 30 min, followed by an increase again at 60 min and a second peak at 90–120 min (Fig. 6A). Interestingly, the time course of ELK-1 phosphorylation is parallel to that observed for ERK1/2 phosphorylation induced by gastrin (Fig. 3A). Gastrin-activated ATF2 was observed within 5 min, reached a maximum at 30 min, and then returned to the basal level (Fig. 6B). To further confirm these findings, we examined the effect of gastrin on the transactivation of these factors. RIE/CCKBR cells were cotransfected with plasmids carrying genes for fusion proteins, including Gal4-ELK-1, Gal4-Sap-1, and Gal4-ATF2, and the 5×Gal4-luc reporter genes. As shown in Fig. 6C, ELK-1- and ATF2-dependent (but not Sap-1-dependent) reporter gene expression was activated by gastrin. Together, these results indicate that gastrin activates transcription factors ELK-1 and ATF2, which may participate in the regulation of gastrin-dependent c-fos and c-junexpression in RIE/CCKBR cells. To ascertain whether AP-1 activation is required for gastrin-mediated COX-2 expression, we treated RIE/CCKBR cells with diferuloylmethane (curcumin), which is an inhibitor of AP-1 binding (17Guo Y.-S. Hellmich M.R. Wen X.D. Townsend Jr., C.M. J. Biol. Chem. 2001; 276: 22941-22947Google Scholar, 31Mohan R. Sivak J. Ashton P. Russo L.A. Pham B.Q. Kasahara N. Raizman M.B. Fini M.E. J. Biol. Chem. 2000; 275: 10405-10412Google Scholar). RIE/CCKBR cells were transiently transfected with a plasmid containing the COX-2 promoter coupled with a luciferase reporter gene, pretreated w" @default.
• W1982173676 created "2016-06-24" @default.
• W1982173676 creator A5026863549 @default.
• W1982173676 creator A5031856756 @default.
• W1982173676 creator A5038753309 @default.
• W1982173676 creator A5058992243 @default.
• W1982173676 creator A5072184582 @default.
• W1982173676 creator A5079971195 @default.
• W1982173676 date "2002-12-01" @default.
• W1982173676 modified "2023-10-11" @default.
• W1982173676 title "Gastrin Stimulates Cyclooxygenase-2 Expression in Intestinal Epithelial Cells through Multiple Signaling Pathways" @default.
• W1982173676 cites W1498554246 @default.
• W1982173676 cites W1532016378 @default.
• W1982173676 cites W1965613925 @default.
• W1982173676 cites W1966243693 @default.
• W1982173676 cites W1967751882 @default.
• W1982173676 cites W1968444137 @default.
• W1982173676 cites W1981493299 @default.
• W1982173676 cites W1986782337 @default.
• W1982173676 cites W1988818065 @default.
• W1982173676 cites W1994816216 @default.
• W1982173676 cites W2002708977 @default.
• W1982173676 cites W2007780460 @default.
• W1982173676 cites W2010385665 @default.
• W1982173676 cites W2011182719 @default.
• W1982173676 cites W2013443154 @default.
• W1982173676 cites W2016515552 @default.
• W1982173676 cites W2026579495 @default.
• W1982173676 cites W2027377224 @default.
• W1982173676 cites W2027401155 @default.
• W1982173676 cites W2031272027 @default.
• W1982173676 cites W2048635128 @default.
• W1982173676 cites W2058118671 @default.
• W1982173676 cites W2061358441 @default.
• W1982173676 cites W2063837738 @default.
• W1982173676 cites W2068319865 @default.
• W1982173676 cites W2069539829 @default.
• W1982173676 cites W2070905430 @default.
• W1982173676 cites W2075141756 @default.
• W1982173676 cites W2077880395 @default.
• W1982173676 cites W2078647937 @default.
• W1982173676 cites W2086217063 @default.
• W1982173676 cites W2090369267 @default.
• W1982173676 cites W2092916198 @default.
• W1982173676 cites W2095495874 @default.
• W1982173676 cites W2109838780 @default.
• W1982173676 cites W2123190981 @default.
• W1982173676 cites W2131871435 @default.
• W1982173676 cites W2140215864 @default.
• W1982173676 cites W2151312020 @default.
• W1982173676 cites W2155744736 @default.
• W1982173676 cites W2186770219 @default.
• W1982173676 cites W4232995978 @default.
• W1982173676 doi "https://doi.org/10.1074/jbc.m209016200" @default.
• W1982173676 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12239223" @default.
• W1982173676 hasPublicationYear "2002" @default.
• W1982173676 type Work @default.
• W1982173676 sameAs 1982173676 @default.
• W1982173676 citedByCount "87" @default.
• W1982173676 countsByYear W19821736762012 @default.
• W1982173676 countsByYear W19821736762013 @default.
• W1982173676 countsByYear W19821736762014 @default.
• W1982173676 countsByYear W19821736762015 @default.
• W1982173676 countsByYear W19821736762016 @default.
• W1982173676 countsByYear W19821736762019 @default.
• W1982173676 countsByYear W19821736762020 @default.
• W1982173676 countsByYear W19821736762022 @default.
• W1982173676 crossrefType "journal-article" @default.
• W1982173676 hasAuthorship W1982173676A5026863549 @default.
• W1982173676 hasAuthorship W1982173676A5031856756 @default.
• W1982173676 hasAuthorship W1982173676A5038753309 @default.
• W1982173676 hasAuthorship W1982173676A5058992243 @default.
• W1982173676 hasAuthorship W1982173676A5072184582 @default.
• W1982173676 hasAuthorship W1982173676A5079971195 @default.
• W1982173676 hasBestOaLocation W19821736761 @default.
• W1982173676 hasConcept C181199279 @default.
• W1982173676 hasConcept C185592680 @default.
• W1982173676 hasConcept C2776986829 @default.
• W1982173676 hasConcept C2779689624 @default.
• W1982173676 hasConcept C49039625 @default.
• W1982173676 hasConcept C55493867 @default.
• W1982173676 hasConcept C62478195 @default.
• W1982173676 hasConcept C86803240 @default.
• W1982173676 hasConcept C95444343 @default.
• W1982173676 hasConceptScore W1982173676C181199279 @default.
• W1982173676 hasConceptScore W1982173676C185592680 @default.
• W1982173676 hasConceptScore W1982173676C2776986829 @default.
• W1982173676 hasConceptScore W1982173676C2779689624 @default.
• W1982173676 hasConceptScore W1982173676C49039625 @default.
• W1982173676 hasConceptScore W1982173676C55493867 @default.
• W1982173676 hasConceptScore W1982173676C62478195 @default.
• W1982173676 hasConceptScore W1982173676C86803240 @default.
• W1982173676 hasConceptScore W1982173676C95444343 @default.
• W1982173676 hasIssue "50" @default.
• W1982173676 hasLocation W19821736761 @default.
• W1982173676 hasOpenAccess W1982173676 @default.
• W1982173676 hasPrimaryLocation W19821736761 @default.
• W1982173676 hasRelatedWork W1641042124 @default.

• next