FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1982208178> ?p ?o ?g. }

• W1982208178 endingPage "22081" @default.
• W1982208178 startingPage "22075" @default.
• W1982208178 abstract "To investigate the function of subunit D in the vacuolar H+-ATPase (V-ATPase) complex, random and site-directed mutagenesis was performed on the VMA8 gene encoding subunit D in yeast. Mutants were selected for the inability to grow at pH 7.5 but the ability to grow at pH 5.5. Mutations leading to reduced levels of subunit D in whole cell lysates were excluded from the analysis. Seven mutants were isolated that resulted in pH-dependent growth but that contained nearly wild-type levels of subunit D and nearly normal assembly of the V-ATPase as assayed by subunit A levels associated with isolated vacuoles. Each of these mutants contained 2–3 amino acid substitutions and resulted in loss of 60–100% of proton transport and 58–93% of concanamycin-sensitive ATPase activity. To identify the mutations responsible for the observed effects on activity, 14 single amino acid substitutions and 3 double amino acid substitutions were constructed by site-directed mutagenesis and analyzed as described above. Six of the single mutations and all three of the double mutations led to significant (>30%) loss of activity, with the mutations having the greatest effects on activity clustering in the regions Val71–Gly80 and Lys209–Met221. In addition, both M221V and the double mutant V71D/E220V led to significant uncoupling of proton transport and ATPase activity, whereas the double mutant G80D/K209E actually showed increased coupling efficiency. Both a mutant showing reduced coupling and a mutant with only 6% of wild-type proton transport activity showed normal dissociation of the V-ATPase complexin vivo in response to glucose deprivation. These results suggest that subunit D plays an important role in coupling of proton transport and ATP hydrolysis and that only low rates of turnover of the enzyme are required to support in vivo dissociation. To investigate the function of subunit D in the vacuolar H+-ATPase (V-ATPase) complex, random and site-directed mutagenesis was performed on the VMA8 gene encoding subunit D in yeast. Mutants were selected for the inability to grow at pH 7.5 but the ability to grow at pH 5.5. Mutations leading to reduced levels of subunit D in whole cell lysates were excluded from the analysis. Seven mutants were isolated that resulted in pH-dependent growth but that contained nearly wild-type levels of subunit D and nearly normal assembly of the V-ATPase as assayed by subunit A levels associated with isolated vacuoles. Each of these mutants contained 2–3 amino acid substitutions and resulted in loss of 60–100% of proton transport and 58–93% of concanamycin-sensitive ATPase activity. To identify the mutations responsible for the observed effects on activity, 14 single amino acid substitutions and 3 double amino acid substitutions were constructed by site-directed mutagenesis and analyzed as described above. Six of the single mutations and all three of the double mutations led to significant (>30%) loss of activity, with the mutations having the greatest effects on activity clustering in the regions Val71–Gly80 and Lys209–Met221. In addition, both M221V and the double mutant V71D/E220V led to significant uncoupling of proton transport and ATPase activity, whereas the double mutant G80D/K209E actually showed increased coupling efficiency. Both a mutant showing reduced coupling and a mutant with only 6% of wild-type proton transport activity showed normal dissociation of the V-ATPase complexin vivo in response to glucose deprivation. These results suggest that subunit D plays an important role in coupling of proton transport and ATP hydrolysis and that only low rates of turnover of the enzyme are required to support in vivo dissociation. vacuolar proton-translocating adenosine triphosphatase F1F0-ATP synthase 9-amino-6-chloro-2-methoxyacridine disuccinimidyl propionate phosphate-buffered saline yeast extract peptone polyacrylamide gel electrophoresis polymerase chain reaction polyoxyethylene-9-lauryl ether The vacuolar H+-ATPases (or V-ATPases)1 are ATP-dependent proton pumps that function in both intracellular membranes and, in certain cell types, the plasma membrane (1.Forgac M. J. Biol. Chem. 1999; 274: 12951-12954Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar, 2.Stevens T.H. Forgac M. Annu. Rev. Cell Dev. Biol. 1997; 13: 779-808Crossref PubMed Scopus (516) Google Scholar, 3.Margolles-Clark E. Tenney K. Bowman E.J. Bowman B.J. J. Bioenerg. Biomembr. 1999; 31: 29-38Crossref PubMed Scopus (31) Google Scholar, 4.Kane P.M. J. Bioenerg. Biomembr. 1999; 31: 49-56Crossref PubMed Scopus (22) Google Scholar, 5.Nelson N. J. Bioenerg. Biomembr. 1992; 24: 407-414Crossref PubMed Scopus (70) Google Scholar, 6.Anraku Y. Umemoto N. Hirata R. Ohya Y. J. Bioenerg. Biomembr. 1992; 24: 395-405Crossref PubMed Scopus (63) Google Scholar, 7.Sze H. Ward J.M. Lai S. J. Bioenerg. Biomembr. 1992; 21: 371-382Crossref Scopus (179) Google Scholar). V-ATPases within intracellular compartments function in such processes as receptor-mediated endocytosis, intracellular targeting of lysosomal enzymes, protein processing and degradation, viral entry, and coupled transport of small molecules, such as neurotransmitters (1.Forgac M. J. Biol. Chem. 1999; 274: 12951-12954Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar, 2.Stevens T.H. Forgac M. Annu. Rev. Cell Dev. Biol. 1997; 13: 779-808Crossref PubMed Scopus (516) Google Scholar, 3.Margolles-Clark E. Tenney K. Bowman E.J. Bowman B.J. J. Bioenerg. Biomembr. 1999; 31: 29-38Crossref PubMed Scopus (31) Google Scholar, 4.Kane P.M. J. Bioenerg. Biomembr. 1999; 31: 49-56Crossref PubMed Scopus (22) Google Scholar, 5.Nelson N. J. Bioenerg. Biomembr. 1992; 24: 407-414Crossref PubMed Scopus (70) Google Scholar, 6.Anraku Y. Umemoto N. Hirata R. Ohya Y. J. Bioenerg. Biomembr. 1992; 24: 395-405Crossref PubMed Scopus (63) Google Scholar, 7.Sze H. Ward J.M. Lai S. J. Bioenerg. Biomembr. 1992; 21: 371-382Crossref Scopus (179) Google Scholar). Within the plasma membrane, V-ATPases function in such processes as bone resorption (8.Chatterjee D. Chakraborty M. Leit M. Neff L. Jamsa-Kellokumpu S. Fuchs R. Baron R. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6257-6261Crossref PubMed Scopus (130) Google Scholar), renal acidification (9.Gluck S.L. J. Bioenerg. Biomembr. 1992; 21: 351-360Crossref Scopus (53) Google Scholar), pH homeostasis (10.Nanda A. Brumell J.H. Nordstrom T. Kjeldsen L. Sengelov H. Borregaard N. Rotstein O.D. Grinstein S. J. Biol. Chem. 1996; 271: 15963-15970Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar), and K+ secretion (11.Wieczorek H. Gruber G. Harvey W.R. Huss M. Merzendorfer H. J. Bioenerg. Biomemb. 1999; 31: 67-74Crossref PubMed Scopus (54) Google Scholar). The V-ATPases are multisubunit complexes composed of two domains (1.Forgac M. J. Biol. Chem. 1999; 274: 12951-12954Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar, 2.Stevens T.H. Forgac M. Annu. Rev. Cell Dev. Biol. 1997; 13: 779-808Crossref PubMed Scopus (516) Google Scholar, 3.Margolles-Clark E. Tenney K. Bowman E.J. Bowman B.J. J. Bioenerg. Biomembr. 1999; 31: 29-38Crossref PubMed Scopus (31) Google Scholar, 4.Kane P.M. J. Bioenerg. Biomembr. 1999; 31: 49-56Crossref PubMed Scopus (22) Google Scholar, 5.Nelson N. J. Bioenerg. Biomembr. 1992; 24: 407-414Crossref PubMed Scopus (70) Google Scholar, 6.Anraku Y. Umemoto N. Hirata R. Ohya Y. J. Bioenerg. Biomembr. 1992; 24: 395-405Crossref PubMed Scopus (63) Google Scholar, 7.Sze H. Ward J.M. Lai S. J. Bioenerg. Biomembr. 1992; 21: 371-382Crossref Scopus (179) Google Scholar). The V1 domain is a 570-kDa peripheral complex composed of eight different subunits (subunits A–H) of molecular mass 70–14 kDa that is responsible for ATP hydrolysis. The V0domain is a 260-kDa integral complex composed of five different subunits (a, d, c, c′, and c“) of 100 to 17 kDa that is responsible for proton translocation. The V-ATPases are structurally and evolutionarily related to the F-ATPases of mitochondria, chloroplasts, and bacteria that normally function in ATP synthesis (12.Weber J. Senior A. Biochim. Biophys. Acta. 1997; 1319: 19-58Crossref PubMed Scopus (393) Google Scholar, 13.Fillingame R.H. J. Exp. Biol. 2000; 203: 9-17Crossref PubMed Google Scholar, 14.Cross R.L. Duncan T.M. J. Bioenerg. Biomembr. 1996; 28: 403-408Crossref PubMed Scopus (67) Google Scholar, 15.Capaldi R.A. Schulenberg B. Murray J. Aggler R. J. Exp. Biol. 2000; 203: 29-33Crossref PubMed Google Scholar, 16.Pedersen P.L. J. Bioenerg. Biomembr. 1996; 28: 389-395Crossref PubMed Scopus (57) Google Scholar, 17.Futai M. Omote H. J. Bioenerg. Biomembr. 1996; 28: 409-414Crossref PubMed Scopus (31) Google Scholar). Thus sequence homology can be detected between the nucleotide-binding subunits of the V-ATPase (A and B) and the nucleotide-binding subunits of the F-ATPase (β and α) (18.Zimniak L. Dittrich P. Gogarten J.P. Kibak H. Taiz L. J. Biol. Chem. 1988; 263: 9102-9112Abstract Full Text PDF PubMed Google Scholar, 19.Bowman B.J. Allen R. Wechser M.A. Bowman E.J. J. Biol. Chem. 1988; 263: 14002-14007Abstract Full Text PDF PubMed Google Scholar). Sequence homology also exists between the proteolipid c subunits of the two classes (13.Fillingame R.H. J. Exp. Biol. 2000; 203: 9-17Crossref PubMed Google Scholar, 20.Mandel M. Moriyama Y. Hulmes J.D. Pan Y.C. Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5521-5524Crossref PubMed Scopus (237) Google Scholar), although no other sequence similarities have been identified in the remaining subunits. An important question is the mechanism of coupling of proton transport and ATP hydrolysis in the V-ATPases. For the F-ATPases, the availability of high resolution structural data (21.Abrahams J.P. Leslie A.G. Lutter R. Walker J.E. Nature. 1994; 370: 621-628Crossref PubMed Scopus (2718) Google Scholar, 22.Bianchet M.A. Hullihen J. Pedersen P.L. Amzel L.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 11065-11070Crossref PubMed Scopus (224) Google Scholar, 23.Stock D. Leslie A.G. Walker J.E. Science. 1999; 286: 1700-1705Crossref PubMed Scopus (1072) Google Scholar, 24.Hausrath A.C. Gruber G. Matthews B.W. Capaldi R.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13697-13702Crossref PubMed Scopus (82) Google Scholar) together with a series of studies demonstrating rotation within the F-ATPase complex (25.Duncan T.M. Bulygin V.V. Zhou Y. Hutcheon M.L. Cross R.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10964-10968Crossref PubMed Scopus (456) Google Scholar, 26.Sabbert D. Engelbrecht S. Junge W. Nature. 1996; 381: 623-625Crossref PubMed Scopus (459) Google Scholar, 27.Noji H. Yasuda R. Yoshida M. Kazuhiko K Nature. 1997; 386: 299-302Crossref PubMed Scopus (1924) Google Scholar, 28.Sambongi Y. Iko Y. Tanabe M. Omote H. Iwamoto-Kihara A. Ueda I. Yanagida T. Wada Y. Futai M. Science. 1999; 286: 1722-1724Crossref PubMed Scopus (411) Google Scholar) have led to the rotary model for coupling (14.Cross R.L. Duncan T.M. J. Bioenerg. Biomembr. 1996; 28: 403-408Crossref PubMed Scopus (67) Google Scholar, 29.Vik S.B. Antonio B.J. J. Biol. Chem. 1994; 269: 30364-30369Abstract Full Text PDF PubMed Google Scholar, 30.Junge W. Sabbert D. Engelbrecht S. Ber. Bunsen-Ges. Phys. Chem. 1996; 100: 2014-2019Crossref Google Scholar). In this model, ATP hydrolysis within the α3β3head of the F1 domain drives rotation of a central γ subunit, which is tightly linked to a ring of c subunits in the F0 domain. Rotation of the ring of c subunits relative to the a subunit of F0 (which is held fixed relative to the α3β3 head by a peripheral stator) in turn leads to unidirectional proton transport. Central to this coupling mechanism is the role of the γ subunit, which has been shown to rotate relative to α3β3 hexamer (25.Duncan T.M. Bulygin V.V. Zhou Y. Hutcheon M.L. Cross R.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10964-10968Crossref PubMed Scopus (456) Google Scholar, 26.Sabbert D. Engelbrecht S. Junge W. Nature. 1996; 381: 623-625Crossref PubMed Scopus (459) Google Scholar, 27.Noji H. Yasuda R. Yoshida M. Kazuhiko K Nature. 1997; 386: 299-302Crossref PubMed Scopus (1924) Google Scholar). In addition, mutations have been identified in the γ subunit that lead to uncoupling of ATP hydrolysis and proton transport by the F-ATPases (31.Shin K. Nakamoto R.K. Maeda M. Futai M. J. Biol. Chem. 1992; 267: 20835-20839Abstract Full Text PDF PubMed Google Scholar, 32.Nakamoto R.K. Maeda M. Futai M. J. Biol. Chem. 1993; 268: 867-872Abstract Full Text PDF PubMed Google Scholar). Whereas no subunits in the V-ATPase complex show homology to the γ subunit, two subunits (D and E) are predicted from sequence analysis to have a similarly high α-helical content (33.Nelson H. Mandiyan S. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 497-501Crossref PubMed Scopus (77) Google Scholar, 34.Bowman E.J. Steinhart A. Bowman B.J. Biochim. Biophys. Acta. 1995; 1237: 95-98Crossref PubMed Scopus (28) Google Scholar). To investigate the possible role of subunit D in coupling within the V-ATPase, random mutagenesis of the gene encoding subunit D in yeast (VMA8(35.Graham L.A. Hill K.J. Stevens T.H. J. Biol. Chem. 1995; 270: 15037-15044Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar)) was performed. Mutations that lead to significant loss of V-ATPase function in yeast lead to a conditional growth phenotype in which cells are unable to grow at neutral pH (36.Kane P.M. Yamashiro C.T. Wolczyk D.F. Neff N. Goebl M. Stevens T.H. Science. 1990; 250: 651-657Crossref PubMed Scopus (382) Google Scholar, 37.Hirata R. Ohsumi Y. Nakano A. Kawasaki H. Suzuki K. Anraku Y. J. Biol. Chem. 1990; 265: 6726-6733Abstract Full Text PDF PubMed Google Scholar, 38.Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 3503-3507Crossref PubMed Scopus (245) Google Scholar). Sequencing and analysis of mutants isolated by this procedure together with analysis of subsequent mutations constructed by site-directed mutagenesis have led us to suggest that subunit D plays a role in coupling of proton transport and ATP hydrolysis by the V-ATPases. In addition, we have further analyzed the activity and coupling requirements for in vivo dissociation of the V-ATPase, a process believed to play an important role in regulation of V-ATPase activity in the cell (39.Kane P.M. J. Biol. Chem. 1995; 270: 17025-17032Abstract Full Text Full Text PDF PubMed Google Scholar,40.Sumner J.P. Dow J.A. Early F.G. Klein U. Jager D. Wieczorek H. J. Biol. Chem. 1995; 270: 5649-5653Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar). Leupeptin, aprotinin, and pepstatin were obtained from Roche Molecular Biochemicals. Tran35S-label was purchased from ICN Biochemicals. Zymolase 100T was from Sekagaku America Inc. Concanamycin A was purchased from Fluka Chemical Corp. Yeast extract, dextrose, peptone, and yeast nitrogen base were from Difco. Molecular biological reagents were from New England Biolabs, Promega, and Life Technologies, Inc. 9-Amino-6-chloro-2-methoxyacridine (ACMA) was from Molecular Probes, Inc. All other chemicals were of analytical grade and most were from Sigma. Yeast strain KHY105 (leu2-3, 112, ura3-52,ade6, his4-519,vma8Δ::LEU2) was the generous gift of Dr. Tom Stevens, Institute of Molecular Biology, University of Oregon. Plasmid pKH3203 containing the VMA8 gene subcloned into the shuttle vector pRS316 was also from the Stevens laboratory. Random mutagenesis of VMA8 gene was performed using a PCR-based method as described previously (41.Staples R.R. Dieckmann C.L. Genetics. 1993; 135: 981-991Crossref PubMed Google Scholar). Briefly, the entire encoding region of VMA8 flanked by additional 5′- and 3′-noncoding sequence (approximately 50 bases in length) in pKH3203 was amplified by PCR under mutagenic conditions. The first 10 cycles of PCR were done in the presence of 0.25 mmMn2+ and 4.25 mm Mg2+. The product was then diluted 1:100 into the same buffer but containing 3 mm Mg2+ in the absence of Mn2+ and amplified for another 30 cycles. The PCR products were purified using a Qiagen PCR purification kit. Site-directed mutagenesis of the VMA8 gene was performed using the Altered Sites II in vitro mutagenesis kit (Promega) following the manufacturer's protocol. The following mutagenesis oligonucleotides were employed to introduce the indicated mutations: R198G, GATGAGTTGGACGGAGAAGAATTTT; L149V, TTTAGTTGAAGTAGCCTCTTT; M221V, GGATGCTGAGGTGAAATTGAA; V71D, TTGGCCGAAGATTCCTATGCA; L106M, TGGTGTGTATATGTCTCAATT; P179S, CACGTTATTATCTCAAGAACTGAAA; D249G, CATTGGTTGCTGGTCAAGAAGACGA; V104E, AACGTTAGTGGTGAGTATTTGTCTCA; E220V, TTGGATGCTGTGATGAAATTG; K210E, CCAAGAAAAGGAGCAAAATGA; G80D, GAAAACATTGACTATCAAGTG; N100I, CGTCAAGAAATCGTTAGTGGT; K209E, AGGTCCAAGAAGAGAAGCAAAAT; D218V, TGCAAAATTGGTTGCTGAGATGA; and I188N, AATTGCTTACAATAACAGTGAGT. All mutations (underlined) were confirmed by automated DNA sequencing. The PCR products ofVMA8, which were produced under the mutagenic conditions described above, were used to co-transform yeast strain KHY105 using anin vivo recombination method as described previously (41.Staples R.R. Dieckmann C.L. Genetics. 1993; 135: 981-991Crossref PubMed Google Scholar). Unique BamHI and XbaI sites flanking theVMA8-coding sequence were introduced into pKH3203 by site-directed mutagenesis. pKH3203 was cleaved with BamHI and XbaI, and the large 6.6-kilobase pair fragment lacking the VMA8 gene was purified by agarose gel electrophoresis. The mutagenized PCR products (0.2 μg) and the 6.6-kilobase pair vector fragment (1 μg) were mixed and used to co-transform the KHY105 strain using the lithium acetate method (42.Gietz D. St. Jean A. Woods R.A. Schiestl R.H. Nucleic Acids Res. 1992; 20: 1425Crossref PubMed Scopus (2863) Google Scholar). The transformants were then selected on Ura− plates. To screen forVMA8 mutants leading to defective V-ATPase function, colonies were replica-plated on YPD plates buffered by 50 mm KH2PO4 and succinate to pH 5.5 and 7.5. Mutants unable to grow at pH 7.5 were selected, and the mutant plasmids were recovered and used to retransform KHY105 to verify that the observed phenotype was due to a mutation in VMA8. The mutant forms of VMA8 constructed by site-directed mutagenesis were subcloned into pRS316 and transformed into KHY105 followed by selection of transformants on Ura− plates. Whole cell lysates were prepared from overnight cultures in Ura− medium as described previously (43.Kane P.M. Kuehn M.C. Howald-Stevenson I. Stevens T. J. Biol. Chem. 1992; 267: 447-454Abstract Full Text PDF PubMed Google Scholar), and the proteins were separated by SDS-PAGE on 10% acrylamide gels. The expression of subunit D was detected by Western blotting using a polyclonal antibody raised against Vma8p (a generous gift of Dr. Tom Stevens). Assembly of the V-ATPase was assessed by measurement of the amount of subunit A present on isolated vacuolar membranes and by immunoprecipitation of the V-ATPase complex from whole cell lysates. Vacuolar membrane vesicles were isolated as described previously (44.Roberts C.J. Raymond C.K. Yamashiro C.T. Stevens T.H. Methods Enzymol. 1991; 194: 644-661Crossref PubMed Scopus (287) Google Scholar). Following separation of the proteins on 12% acrylamide gels, Western blotting was performed using the monoclonal antibody 8B1-F3 against the A subunit (obtained from Molecular Probes, Inc.). It has previously been shown that the V1 domain (including the A subunit) only associates with the vacuolar membrane if V-ATPase assembly is normal. Western blots were developed using a horseradish peroxidase-conjugated secondary antibody and visualized by a chemiluminescent detection system from Kirkegaard & Perry Laboratories. Metabolic labeling of the V-ATPase using Tran35S-label, solubilization, and immunoprecipitation of V-ATPase using 8B1-F3 were carried out as described previously (45.Leng X.H. Manolson M. Liu Q. Forgac M. J. Biol. Chem. 1996; 271: 22487-22493Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). Cells were grown overnight in methionine-free media to an absorbance at 600 nm of 0.6–0.8. The cells were converted to spheroplasts by treatment with Zymolyase and incubated with Trans35S-label (50 μCi/5 × 106 spheroplasts) for 1 h at 30 °C. Spheroplasts were pelleted, washed, and lysed in PBS (135 mm NaCl, 2 mm KCl, 10 mm sodium phosphate, 1.75 mm potassium phosphate (pH 7.4)) with 1% C12E9 and 1 mm DSP. The V-ATPase complex was then immunoprecipitated using the antibody 8B1-F3 against subunit A and protein A-Sepharose followed by separation of proteins by SDS-PAGE on 12% acrylamide gels and autoradiography. Dissociation of the V-ATPase in response to glucose depletion was detected as described previously (39.Kane P.M. J. Biol. Chem. 1995; 270: 17025-17032Abstract Full Text Full Text PDF PubMed Google Scholar) with some modifications. The Δvma8 yeast strain expressing the wild-type or mutant forms ofVMA8 was grown overnight to an absorbance at 600 nm of 0.6–0.8. The cells were converted to spheroplasts and incubated in YEP media or YEP media containing 2% glucose for 40 min at 30 °C. Spheroplasts were pelleted and lysed in PBS containing 1% C12E9 and 1 mmDSP. The V-ATPase complex was then immunoprecipitated using 8B1-F3 and protein A-Sepharose followed by separation on 12% acrylamide gels and transfer to nitrocellulose. Western blotting was then performed separately using the antibodies 8B1-F3 against the A subunit and 10D7 against the 100-kDa a subunit of the V0 domain. Dissociation results in the disappearance of the 100-kDa a subunit from the complex immunoprecipitated with the antibody against the V1 A subunit. Western blots were developed using a horseradish peroxidase-conjugated secondary antibody and visualized by a chemiluminescent detection system from Kirkegaard & Perry Laboratories. Protein concentrations were determined by the method of Lowry et al. (46.Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). ATPase activity was measured using a coupled spectrophotometric assay as described previously (47.Feng Y. Forgac M. J. Biol. Chem. 1992; 267: 5817-5822Abstract Full Text PDF PubMed Google Scholar). V-ATPase activity was defined as the ATPase activity of isolated vacuoles (10 μg of protein) that was inhibitable by 0.2 μm concanamycin (48.Drose S. Bindseil K.U. Bowman E.J. Siebers A. Zeeck A. Altendorf K. Biochemistry. 1993; 32: 3902-3906Crossref PubMed Scopus (368) Google Scholar). Vacuoles isolated from the Δvma8 strain expressing the wild-type VMA8 gene had a specific activity of 1.3–1.5 μmol of ATP/min/mg protein. Typically, concanamycin inhibited approximately 90–95% of the ATPase activity in isolated vacuoles. ATP-dependent proton transport was measured by quenching of ACMA fluorescence using a Perkin-Elmer LS50B spectrofluorimeter (47.Feng Y. Forgac M. J. Biol. Chem. 1992; 267: 5817-5822Abstract Full Text PDF PubMed Google Scholar). Vacuoles isolated from the Δvma8 strain expressing the vector alone showed no ATP-dependent quenching of ACMA fluorescence. To evaluate the functional role of subunit D in the V-ATPase complex, PCR-based random mutagenesis of the VMA8 gene encoding subunit D in yeast was performed. Disruption of V-ATPase function leads to a conditional growth phenotype in yeast in which cells are unable to grow at pH 7.5 but retain the ability to grow at pH 5.5 (36.Kane P.M. Yamashiro C.T. Wolczyk D.F. Neff N. Goebl M. Stevens T.H. Science. 1990; 250: 651-657Crossref PubMed Scopus (382) Google Scholar, 37.Hirata R. Ohsumi Y. Nakano A. Kawasaki H. Suzuki K. Anraku Y. J. Biol. Chem. 1990; 265: 6726-6733Abstract Full Text PDF PubMed Google Scholar, 38.Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 3503-3507Crossref PubMed Scopus (245) Google Scholar). Following mutagenesis and transformation, transformants were selected for the inability to grow at pH 7.5. Screening of approximately 10,000 transformants resulted in the selection of 29 colonies unable to grow at neutral pH. These mutants were then further screened for stable expression of Vma8p by Western blotting of whole cell lysates using a polyclonal antibody specific for the yeast subunit D. Of the initial isolates, 15 colonies showed nearly normal levels of subunit D in whole cell lysates. Plasmids from these mutants were recovered, amplified in Escherichia coli, and reintroduced into the vma8-deficient strain. Fourteen of the mutant plasmids still led to the vma− phenotype and were sequenced. All of the mutant plasmids contained multiple point mutations. Seven plasmids, containing either 2 or 3 mutations, were subjected to further analysis. Previous attempts to isolate mutants inVMA8 causing the vma− phenotype had also resulted in only mutants containing multiple point mutations. 2T. Xu and M. Forgac, unpublished observations. Fig. 1 shows a Western blot of whole cell lysates isolated from each of the mutant strains using a polyclonal antibody directed against Vma8p. As can be seen, all seven of the mutants showed nearly normal levels of subunit D relative to cells expressing the wild-type VMA8 gene. Several of the mutants showed slightly lower mobility (i.e. higher apparent molecular weight) relative to the wild-type protein, which might be due to altered SDS binding as a result of the mutations introduced. To evaluate the effects of the mutations on activity of the V-ATPase, vacuoles were isolated from cells expressing the wild-type and mutant forms of subunit D, and ATPase activity and proton transport were measured using a coupled spectrophotometric assay and uptake of the fluorescent dye ACMA, respectively. V-ATPase activity was defined as that fraction of the ATPase activity that was inhibited by 0.2 μm concanamycin (48.Drose S. Bindseil K.U. Bowman E.J. Siebers A. Zeeck A. Altendorf K. Biochemistry. 1993; 32: 3902-3906Crossref PubMed Scopus (368) Google Scholar), typically approximately 90–95% in isolated vacuoles. ATPase activities are expressed relative to that measured for vacuoles isolated from cells expressing the wild-typeVMA8 gene (1.3–1.5 μmol of ATP/min/mg of protein). As can be seen from Table I, all of the mutants showed loss of at least 58% of ATPase activity and 60% of ACMA quenching. Generally the loss of proton transport paralleled loss of ATPase, although for mutants 2 and 2′, loss of proton transport was slightly greater than loss of ATPase, whereas for mutant 3′ the opposite was true. Several point mutations appeared in more than one mutant, including G80D, I188N, E220V, and M221V, and the mutations generally clustered in two regions, from Val71 to Gly80 and from Lys209 to Met221.Table IV-ATPase activity and proton transport of vacuoles isolated from cells expressing mutant forms of vma8 selected by random mutagenesisMutantMutations invma8V-ATPase activity aV-ATPase activity was defined as the ATPase activity of isolated vacuoles (10 μg of protein) that was inhibitable by 0.2 μm concanamycin. Values are expressed relative to that measured for vacuoles isolated from theΔvma8 strain expressing the wild type VMA8 gene (1.3–1.5 μmol of ATP/min/mg protein). Typically, concanamycin inhibited approximately 90–95% of the ATPase activity in isolated vacuoles. ATP hydrolysis was measured using a coupled spectrophotometric assay as described previously. Values represent the average of at least two independent determinations with the numbers in parentheses corresponding to the average deviation from the mean.ACMA quenching bProton transport of isolated vacuoles (2.5 μg of protein) was measured as ATP-dependent quenching of ACMA fluorescence as previously described (47). Values are expressed relative to that measured for vacuoles isolated from the Δvma8 strain expressing the wild type VMA8 gene (defined as 100%). Vacuoles isolated from the Δvma8 strain expressing the vector alone showed no ATP-dependent quenching of ACMA fluorescence. Values represent the average of at least two independent determinations with the numbers in parentheses corresponding to the average deviation from the mean.%%2G80D/E220V/M221V10 (±5)6 (±3)4L149V/E182D/D249G35 (±7)40 (±10)7K210E/D218V42 (±5)40 (±20)10I188N/R198G15 (±3)25 (±15)2′V71D/E220V/M221V7 (±2)03′G80D/K209E15 (±4)34 (±8)4′I188N/I173N/A232T20 (±2)15 (±8)a V-ATPase activity was defined as the ATPase activity of isolated vacuoles (10 μg of protein) that was inhibitable by 0.2 μm concanamycin. Values are expressed relative to that measured for vacuoles isolated from theΔvma8 strain expressing the wild type VMA8 gene (1.3–1.5 μmol of ATP/min/mg protein). Typically, concanamycin inhibited approximately 90–95% of the ATPase activity in isolated vacuoles. ATP hydrolysis was measured using a coupled spectrophotometric assay as described previously. Values represent the average of at least two independent determinations with the numbers in parentheses corresponding to the average deviation from the mean.b Proton transport of isolated vacuoles (2.5 μg of protein) was measured as ATP-dependent quenching of ACMA fluorescence as previously described (47.Feng Y. Forgac M. J. Biol. Chem. 1992; 267: 5817-5822Abstract Full Text PDF PubMed Google Scholar). Values are expressed relative to that measured for vacuoles isolated from the Δvma8 strain expressing the wild type VMA8 gene (defined as 100%). Vacuoles isolated from the Δvma8 strain expressing the vector alone showed no ATP-dependent quenching of ACMA fluorescence. Values represent the average of at least two independent determinations with the numbers in parentheses corresponding to the average deviation from the mean. Open table in a new tab To determine whether loss of V-ATPase activity was due to a disruption of assembly of the V-ATPase complex, Western blot analysis of purified vacuoles was performed using a monoclonal antibody directed a" @default.
• W1982208178 created "2016-06-24" @default.
• W1982208178 creator A5066510631 @default.
• W1982208178 creator A5082973060 @default.
• W1982208178 date "2000-07-01" @default.
• W1982208178 modified "2023-09-29" @default.
• W1982208178 title "Subunit D (Vma8p) of the Yeast Vacuolar H+-ATPase Plays a Role in Coupling of Proton Transport and ATP Hydrolysis" @default.
• W1982208178 cites W1497812043 @default.
• W1982208178 cites W1525965421 @default.
• W1982208178 cites W1544439362 @default.
• W1982208178 cites W1557391975 @default.
• W1982208178 cites W1570668744 @default.
• W1982208178 cites W1578803116 @default.
• W1982208178 cites W1590488648 @default.
• W1982208178 cites W1592537807 @default.
• W1982208178 cites W1592768266 @default.
• W1982208178 cites W1593015025 @default.
• W1982208178 cites W1604488369 @default.
• W1982208178 cites W1625553880 @default.
• W1982208178 cites W1647338923 @default.
• W1982208178 cites W1747506719 @default.
• W1982208178 cites W1775749144 @default.
• W1982208178 cites W1905245955 @default.
• W1982208178 cites W1924285665 @default.
• W1982208178 cites W1964044497 @default.
• W1982208178 cites W1964051078 @default.
• W1982208178 cites W1964277147 @default.
• W1982208178 cites W1969094677 @default.
• W1982208178 cites W1974750678 @default.
• W1982208178 cites W1974781841 @default.
• W1982208178 cites W1977120851 @default.
• W1982208178 cites W1978120045 @default.
• W1982208178 cites W1983962372 @default.
• W1982208178 cites W1996855641 @default.
• W1982208178 cites W1996931402 @default.
• W1982208178 cites W2004953882 @default.
• W1982208178 cites W2006176190 @default.
• W1982208178 cites W2010239636 @default.
• W1982208178 cites W2021864436 @default.
• W1982208178 cites W2024798671 @default.
• W1982208178 cites W2026773322 @default.
• W1982208178 cites W2031098293 @default.
• W1982208178 cites W2039037981 @default.
• W1982208178 cites W2040521298 @default.
• W1982208178 cites W2045890776 @default.
• W1982208178 cites W2046800456 @default.
• W1982208178 cites W2046818599 @default.
• W1982208178 cites W2062872843 @default.
• W1982208178 cites W2063339521 @default.
• W1982208178 cites W2068634955 @default.
• W1982208178 cites W2069643007 @default.
• W1982208178 cites W2071950147 @default.
• W1982208178 cites W2074033410 @default.
• W1982208178 cites W2077330262 @default.
• W1982208178 cites W2082402874 @default.
• W1982208178 cites W2082629421 @default.
• W1982208178 cites W2085285008 @default.
• W1982208178 cites W2086660631 @default.
• W1982208178 cites W2087236107 @default.
• W1982208178 cites W2122023595 @default.
• W1982208178 cites W2131220361 @default.
• W1982208178 cites W2134807208 @default.
• W1982208178 cites W2156154530 @default.
• W1982208178 cites W2158112793 @default.
• W1982208178 cites W2172029110 @default.
• W1982208178 cites W2461323686 @default.
• W1982208178 cites W2616345050 @default.
• W1982208178 cites W2767821344 @default.
• W1982208178 cites W4231487984 @default.
• W1982208178 cites W43340927 @default.
• W1982208178 cites W71056251 @default.
• W1982208178 cites W97777674 @default.
• W1982208178 doi "https://doi.org/10.1074/jbc.m002983200" @default.
• W1982208178 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10801866" @default.
• W1982208178 hasPublicationYear "2000" @default.
• W1982208178 type Work @default.
• W1982208178 sameAs 1982208178 @default.
• W1982208178 citedByCount "51" @default.
• W1982208178 countsByYear W19822081782012 @default.
• W1982208178 countsByYear W19822081782014 @default.
• W1982208178 countsByYear W19822081782015 @default.
• W1982208178 countsByYear W19822081782018 @default.
• W1982208178 countsByYear W19822081782020 @default.
• W1982208178 countsByYear W19822081782022 @default.
• W1982208178 countsByYear W19822081782023 @default.
• W1982208178 crossrefType "journal-article" @default.
• W1982208178 hasAuthorship W1982208178A5066510631 @default.
• W1982208178 hasAuthorship W1982208178A5082973060 @default.
• W1982208178 hasConcept C104292427 @default.
• W1982208178 hasConcept C104317684 @default.
• W1982208178 hasConcept C112243037 @default.
• W1982208178 hasConcept C121332964 @default.
• W1982208178 hasConcept C12554922 @default.
• W1982208178 hasConcept C131584629 @default.
• W1982208178 hasConcept C141315368 @default.
• W1982208178 hasConcept C171357686 @default.
• W1982208178 hasConcept C181199279 @default.
• W1982208178 hasConcept C185592680 @default.

• next