FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1982455287> ?p ?o ?g. }

• W1982455287 endingPage "22916" @default.
• W1982455287 startingPage "22907" @default.
• W1982455287 abstract "Fibronectin (Fn) is involved in the early stages of bone formation, and prostaglandin E (PGE) is an important factor regulating osteogenesis. Here we found that PGE2 enhanced extracellular Fn assembly in rat primary osteoblasts, as shown by immunofluorescence staining and enzyme-linked immunosorbent assay. PGE2 also increased the protein levels of Fn by using Western blotting analysis. By using pharmacological inhibitors or activators or genetic inhibition by the EP receptor, antisense oligonucleotides revealed that the EP1 receptor but not other PGE receptors is involved in PGE2-mediated up-regulation of Fn. At the mechanistic level, Ca2+ chelator (1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid tetrakis(acetoxymethyl ester)), phosphatidylinositol-phospholipase C inhibitor (U73122), or Src inhibitor (PP2) attenuated the PGE2-induced Fn expression. Protein kinase C (PKC) inhibitor (GF109203X) also inhibited the potentiating action of PGE2. Furthermore, treatment with antisense oligonucleotides of various PKC isoforms, including α, β, ϵ, and δ, demonstrated that α isozyme plays an important role in the enhancement action of PGE2 on Fn assembly. Flow cytometry and reverse transcription-PCR showed that PGE2 and 17-phenyl trinor PGE2 (EP1/EP3 agonist) increased the surface expression and mRNA level of α5 or β1 integrins. Fn promoter activity was enhanced by PGE2 and 17-phenyl trinor PGE2 in cells transfected with pGL2F1900-Luc. Cotransfection with dominant negative mutants of PKCα or c-Src inhibited the potentiating action of PGE2 on Fn promoter activity. Local administration of PGE2 or 17-phenyl trinor PGE2 into the metaphysis of the tibia via the implantation of a needle cannula significantly increased the Fn and α5β1 integrin immunostaining and bone volume of secondary spongiosa in tibia. Taken together, our results provided evidence that PGE2 increased Fn and promoted bone formation in rat osteoblasts via the EP1/phospholipase C/PKCα/c-Src signaling pathway. Fibronectin (Fn) is involved in the early stages of bone formation, and prostaglandin E (PGE) is an important factor regulating osteogenesis. Here we found that PGE2 enhanced extracellular Fn assembly in rat primary osteoblasts, as shown by immunofluorescence staining and enzyme-linked immunosorbent assay. PGE2 also increased the protein levels of Fn by using Western blotting analysis. By using pharmacological inhibitors or activators or genetic inhibition by the EP receptor, antisense oligonucleotides revealed that the EP1 receptor but not other PGE receptors is involved in PGE2-mediated up-regulation of Fn. At the mechanistic level, Ca2+ chelator (1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid tetrakis(acetoxymethyl ester)), phosphatidylinositol-phospholipase C inhibitor (U73122), or Src inhibitor (PP2) attenuated the PGE2-induced Fn expression. Protein kinase C (PKC) inhibitor (GF109203X) also inhibited the potentiating action of PGE2. Furthermore, treatment with antisense oligonucleotides of various PKC isoforms, including α, β, ϵ, and δ, demonstrated that α isozyme plays an important role in the enhancement action of PGE2 on Fn assembly. Flow cytometry and reverse transcription-PCR showed that PGE2 and 17-phenyl trinor PGE2 (EP1/EP3 agonist) increased the surface expression and mRNA level of α5 or β1 integrins. Fn promoter activity was enhanced by PGE2 and 17-phenyl trinor PGE2 in cells transfected with pGL2F1900-Luc. Cotransfection with dominant negative mutants of PKCα or c-Src inhibited the potentiating action of PGE2 on Fn promoter activity. Local administration of PGE2 or 17-phenyl trinor PGE2 into the metaphysis of the tibia via the implantation of a needle cannula significantly increased the Fn and α5β1 integrin immunostaining and bone volume of secondary spongiosa in tibia. Taken together, our results provided evidence that PGE2 increased Fn and promoted bone formation in rat osteoblasts via the EP1/phospholipase C/PKCα/c-Src signaling pathway. The extracellular matrix (ECM) 1The abbreviations used are: ECM, extracellular matrix; PGE, prostaglandins; Fn, fibronectin; AS, antisense; MM, missense; ODN, oligonucleotide; BMD, bone mineral density; BMC, bone mineral content; PI-PLC, phosphatidylinositol-phospholipase C; PKC, protein kinase C; ELISA, enzyme-linked immunosorbent assay; BAPTA-AM, 1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid tetrakis(acetoxymethyl ester); RT, reverse transcription; PBS, phosphate-buffered saline; BSA, bovine serum albumin; fluo-3-AM, fluo-3-acetoxymethyl ester. 1The abbreviations used are: ECM, extracellular matrix; PGE, prostaglandins; Fn, fibronectin; AS, antisense; MM, missense; ODN, oligonucleotide; BMD, bone mineral density; BMC, bone mineral content; PI-PLC, phosphatidylinositol-phospholipase C; PKC, protein kinase C; ELISA, enzyme-linked immunosorbent assay; BAPTA-AM, 1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid tetrakis(acetoxymethyl ester); RT, reverse transcription; PBS, phosphate-buffered saline; BSA, bovine serum albumin; fluo-3-AM, fluo-3-acetoxymethyl ester. provides positional and environmental information that is essential for tissue function. The ECMs produced by osteoblasts are complex and consist of several different classes of molecules that may regulate the modeling and remodeling of bone. The ECMs also serve as a reservoir for growth factors, including members of the prostaglandins (PGEs) and fibroblast growth factor superfamily (1Canalis E. Pash J. Varghese S. Crit. Rev. Eukaryotic Gene Expression. 1993; 3: 155-166PubMed Google Scholar, 2Erlebacher A. Filvaroff E.H. Gitelman S.E. Derynck R. Cell. 1995; 80: 371-378Abstract Full Text PDF PubMed Scopus (614) Google Scholar). Acting either alone or together, these components of the ECM produced by osteoblasts may subsequently regulate the cell adhesion, migration, proliferation, differentiation, survival, as well as the rate of bone formation. Fibronectin (Fn) is an extracellular matrix component that is also present as a soluble protein in plasma and other body fluids (3Potts J.R. Campbell I.D. Curr. Opin. Biol. 1994; 6: 648-655Crossref PubMed Scopus (184) Google Scholar). The matrix form of Fn is believed to support cell adhesion and migration during embryogenesis, tumor growth, wound healing, angiogenesis, and inflammation (4Wierzbicka-Patynowski I. Schwarzbauer J.E. J. Cell Sci. 2003; 116: 3269-3276Crossref PubMed Scopus (386) Google Scholar). Assembly of soluble Fn into matrix is a multistep process under cellular control (5Mosher D.F. Sottile J. Wu C. McDonald J.A. Curr. Opin. Cell Biol. 1992; 4: 810-818Crossref PubMed Scopus (136) Google Scholar). Among the membrane components implicated in Fn matrix assembly, integrins have been demonstrated to have a central role (6Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1172) Google Scholar). Integrins, composed of α and β subunits, are a family of transmembrane receptors mediating adhesion to both ECM and cell surface molecules (7Heino J. Ann. Med. 1993; 25: 335-342Crossref PubMed Scopus (39) Google Scholar, 8Hynes R.O. Cell. 1992; 69: 11-25Abstract Full Text PDF PubMed Scopus (8988) Google Scholar). The specific adhesion depends on the interaction between the cell-binding domain of Fn and cell surface integrin receptors. However, the mechanisms regarding how integrins modulate Fn assembly are not well understood. Transfection of α5 integrin and expression of α5β1 integrin by Chinese hamster ovary cells results in a large increase in Fn assembly, whereas α5-deficient Chinese hamster ovary B2 cells failed to assemble plasma Fn into the ECM (9Wu C. Bauer J.S. Juliano R.L. McDonald J.A. J. Biol. Chem. 1993; 268: 21883-21888Abstract Full Text PDF PubMed Google Scholar, 10Giancotti F.G. Ruoslahti E. Cell. 1990; 60: 849-859Abstract Full Text PDF PubMed Scopus (694) Google Scholar). Osteoblast differentiation is an essential part of bone formation, because active osteoblasts should be recruited at the site of osteoclastic bone resorption to compensate for the continuous loss of bone matrix and to maintain the structural integrity of the skeletal system. The biology of this process is also of considerable interest when applying therapies to promote bone repair after injury or during disease processes. Furthermore, integrins are involved in the signal transduction of translating the strain in the organic matrix to the biochemical signals in the bone cells (11Juliano R.L. Varner J.A. Curr. Opin. Cell Biol. 1993; 5: 812-818Crossref PubMed Scopus (256) Google Scholar). However, the role of cytokine in the cell-matrix interactions in osteoblasts has not been extensively studied. PGEs are considered important local factors that modulate bone metabolism through their effects on osteoblastic cells and osteoclasts (12Kaneki H. Takasugi I. Fujieda M. Kiriu M. Mizuoch S. Ide H. J. Cell. Biochem. 1999; 73: 36-48Crossref PubMed Scopus (67) Google Scholar). PGE2 is a major eicosanoid produced by osteoblasts. To explain the diverse effects of PGE2, the presence of multiple receptors for PGE2 in osteoblasts was postulated. Recent cloning of four subtypes of PGE receptor has made it possible to analyze the PGE receptor subtypes (EP1–EP4) on osteoblasts (13Suzawa T. Miyaura C. Inada M. Maruyama T. Sugimoto Y. Ushikubo F. Ichikaw A. Narumiya S. Suda T. Endocrinology. 2000; 141: 1554-1559Crossref PubMed Scopus (318) Google Scholar, 14Weinreb M. Machwate M. Shir N. Abramovitz M. Rodan G.A. Harada S. Bone. 2001; 28: 275-281Crossref PubMed Scopus (48) Google Scholar). EP1 is coupled to Ca2+ mobilization; EP2 and EP4 activate adenylate cyclase, and EP3 inhibits adenylate cyclase (15Watabe A. Sugimoto Y. Honda A. Irie A. Namba T. Negishi M. Ito S. Narumiya S. Ichikawa A. J. Biol. Chem. 1993; 268: 20175-20178Abstract Full Text PDF PubMed Google Scholar, 16Katsuyama M. Nishigaki N. Sugimoto Y. Morimoto K. Negishi M. Narumiya S. Ichikawa A. FEBS Lett. 1995; 372: 151-156Crossref PubMed Scopus (161) Google Scholar, 17Sugimoto Y. Namba T. Honda A. Hayashi Y. Negishi M. Ichikawa A. Narumiya S. J. Biol. Chem. 1992; 267: 6463-6466Abstract Full Text PDF PubMed Google Scholar). An EP1 agonist stimulated cell growth, whereas an EP4 agonist reduced cell growth and increased alkaline phosphatase activity in MC3T3-E1 osteoblast-like cells (18Suda M. Tanaka K. Natsui K. Usui T. Tanaka I. Fukushima M. Shigeno C. Konishi J. Narumiya S. Chikawa A. Nakao K. Endocrinology. 1996; 137: 1698-1705Crossref PubMed Scopus (99) Google Scholar). These studies indicate that osteoblasts express multiple subtypes of the PGE receptor and that each subtype might be linked to different actions of PGE2. The distribution of Fn in areas of skeletogenesis suggests that it may be involved in early stages of bone formation (19Moursi A.M. Globus R.K. Damsky C.H. J. Cell Sci. 1997; 110: 2187-2196Crossref PubMed Google Scholar). However, the effect of PGE2 on Fn fibrillogenesis in osteoblasts is mostly unknown. Here we found that PGE2 enhanced Fn fibrillogenesis of osteoblasts by increasing the synthesis and assembly of Fn. Furthermore, the increase of clustering of α5 and β1 integrins is involved in the action mechanism of PGE2. EP1 receptor, PI-PLC, PKCα, and c-Src-dependent pathways may be involved in the increase of osteoblast Fn expression and bone formation by PGE2. Materials—Mouse monoclonal antibody for PKCα was purchased from BD Transduction Laboratories. Mouse monoclonal antibody for α-tubulin was purchased from Oncogene Science (Cambridge, MA). Protein-A/G beads, anti-mouse and anti-rabbit IgG-conjugated horseradish peroxidase, rabbit polyclonal antibodies specific for fibronectin, phosphotyrosine residues (PY20), and c-Src were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit polyclonal antibodies specific for α5, β1, and α5β1 integrin and type I collagen were purchased from Chemicon (Temecula, CA). PGE2, 17-phenyl trinor PGE2, butaprost, sulprostone, 11-deoxy-PGE1, and SC19220 were purchased from Cayman Chemical (Ann Arbor, MI). U73122, U73343, D609, and GF109203X were purchased from Calbiochem. Avidin-biotin-peroxidase detection system was purchased from Vector Laboratories. The fibronectin promoter construct (pGL2F1900-Luc) was a gift from Dr. I. S. Kim (Kyungpook National University, Korea). The PKCα dominant negative mutant was a gift from Dr. V. Martin (Louis Pasteur de Strasbourg University, France). The c-Src dominant negative mutant was a gift from Dr. S. Parsons (University of Virginia Health System, Charlottesville, VA). pSV-β-galactosidase vector and luciferase assay kit were purchased from Promega (Madison, MA). All other chemicals were obtained from Sigma. Primary Osteoblast Cultures—Primary osteoblastic cells were prepared by the method described previously (20Tang C.H. Yang R.S. Liou H.C. Fu W.M. J. Bone Miner. Res. 2003; 18: 502-511Crossref PubMed Scopus (46) Google Scholar). The calvaria of fetal rats were dissected from fetal rats, divided into small pieces, and then treated with 0.1% type I collagenase solution for 10 min at 37 °C. The next two 20-min sequential collagenase digestions were then pooled and filtered through 70-μm nylon filters (Falcon). The cells were grown on the plastic cell culture dishes in 95% air, 5% CO2 with α-minimum Eagle's medium (Invitrogen) that was supplemented with 20 mm HEPES and 10% heat-inactivated fetal calf serum, 2 mm-glutamine, penicillin (100 units/ml), and streptomycin (100 μg/ml) (pH adjusted to 7.6). The characteristics of osteoblasts were confirmed by morphology and the expression of alkaline phosphatase. Immunocytochemistry—Osteoblasts were grown on glass coverslips. Cultures were rinsed once with phosphate-buffered saline (PBS) and fixed for 15 min at room temperature in phosphate buffer containing 4% paraformaldehyde. Cells were then rinsed three times with PBS. After blocking with 4% BSA for 15 min, cells were incubated with rabbit anti-rat Fn (1:1000) for 1 h at room temperature. Cells were then washed again and labeled with fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (1:150, Leinco Technologies, St. Louis, MO) for 1 h. Finally, cells were washed, mounted, and examined with a Zeiss confocal microscope (LSM 410) as soon as possible. The mean fluorescence under 10–15 cells (3–5 fields per culture) was measured by using a Zeiss confocal microscope. The focus of the z axis was on the substratum of the monolayer cells. The value for contrast and offset adjustment of confocal microscope was fixed so that the variation of the relative fluorescence of control experiments was rather small. Quantification of Extracellular Immobilized Fn by ELISA—The level of extracellular immobilized Fn was also determined by an enzymelinked immunosorbent assay (ELISA). After treatment with PGE2 at 37 °C, the cells were washed twice with PBS and fixed at room temperature with 1% paraformaldehyde for 30 min. After washing with PBS, the cultures were then blocked with 1% BSA in PBS for 15 min before being incubated sequentially with rabbit anti-rat Fn antibody (1:150) for 1 h and horseradish peroxidase-labeled anti-rabbit antibody (1: 1000) for 30 min. After each incubation, the cells were washed two times with PBS. o-Phenylenediamine dihydrochloride substrate (0.4 mg/ml in phosphate/citrate buffer, pH 5.0; 24.3 mm citric acid; 51.4 mm Na2HPO4·12 H2O; 12% H2O2 (v/v)) was then applied to the cells for 30 min, and 3 m sulfuric acid was added to stop the reaction. The absorbance was measured at 450 nm by an ELISA reader (Bio-Tek, Burlington, VA). Each assay was performed in triplicate. Oligonucleotide (ODN) Transfection—Osteoblasts were cultured to confluence; the complete medium was replaced with Opti-MEM (Invitrogen) containing the antisense phosphorothioate oligonucleotides (5 μg/ml) that had been preincubated with Lipofectamine 2000 (10 μg/ml) (LF2000; Invitrogen) for 30 min. The cells were washed after 24 h of incubation at 37 °C and washed prior to the addition of medium containing PGE2. All antisense ODNs were synthesized and high pressure liquid chromatography-purified by MDBio (Taipei, Taiwan). The sequences used are as follows: EP1 AS-ODN, CTGCAGTTTCATTTCTCC, and MM-ODN, CGACAATTGAATTCATCT; EP2 AS-ODN, GCCTGGAGTCATTGA, and MM-ODN, CGCGTGAGTCTATGA; EP3 AS-ODN, ACACGCCGGCCATAGTGG, and MM-ODN, AGACCCCGCCGAGAGTGT; EP4 AS-ODN, GACTCCGGGGATGGA, and MM-ODN, GACCTCGGGAGTGAG (21Yamaguchi T. Kubota T. Watanabe S. Yamamoto T. J. Neurochem. 2004; 88: 148-154Crossref PubMed Scopus (14) Google Scholar, 22Southall M.D. Vasko M.R. J. Biol. Chem. 2001; 276: 16083-16091Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar); PKCα AS-ODN, AAAACGTCAGCCATG; PKCβ AS-ODN, AAGATGGCTGACCCGGCTCGC; PKCδ AS-ODN, GTGCCATGATGGAGCCTTTT; and PKCϵ AS-ODN, TTGAACACTACCATG (23Tang C.H. Yang R.S. Huang T.H. Liu S.H. Fu W.M. Mol. Pharmacol. 2004; 66: 440-449PubMed Google Scholar). mRNA Analysis by Reverse Transcription (RT)-PCR—Total RNA was extracted from osteoblasts using a TRIzol kit (MDBio Inc.). The reverse transcription reaction was performed using 2 μg of total RNA that was reverse-transcribed into cDNA using an oligo(dT) primer and then amplified for 33 cycles using two oligonucleotide primers as follows: EP1 (336 bp), CGCAGGGTTCACGCACACGA and CACTGTGCCGGGAACTACGC; EP2 (369 bp), CCGCGCGTGTACCTATTTCGC and GCTCCGAAGCTGCATGCGAA; EP3 (537 bp), GCCGGGAGAGCAAACGCAAAAA and ACACCAGGGCTTTGATGGTCGCCAGG; EP4 (423 bp), TTCCGCTCGTGGTGCGAGTGTTC and GAGGTGGTGTCTGCTTGGGTCAGGAPDH (452 bp) ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA (21Yamaguchi T. Kubota T. Watanabe S. Yamamoto T. J. Neurochem. 2004; 88: 148-154Crossref PubMed Scopus (14) Google Scholar, 22Southall M.D. Vasko M.R. J. Biol. Chem. 2001; 276: 16083-16091Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar); α5 integrin (369 bp), GATGAGGAACAGTGAACCGAAGG and AGCAAAAGCAGGATAGAGGACAA; β1 integrin (701 bp), GGAGGAATGTAACACGACTGC and CAGATGAACTGAAGGACCACC (24Kaiser E. Sato M. Onyia J.E. Chandrasekhar S. J. Cell. Biochem. 2001; 83: 617-630Crossref PubMed Scopus (12) Google Scholar, 25Zent R. Bush K.T. Pohl M.L. Quaranta V. Koshikawa N. Wang Z. Kreidberg J.A. Sakurai H. Stuart R.O. Nigam S.K. Dev. Biol. 2001; 238: 289-302Crossref PubMed Scopus (77) Google Scholar). Each PCR cycle was carried out for 30 s at 94 °C, 30 s at 55 °C, and 1 min at 68 °C. PCR products were then separated electrophoretically in a 2% agarose DNA gel and stained with ethidium bromide. Immunoprecipitation and Western Blot Analysis—The cellular lysates were prepared as described previously (20Tang C.H. Yang R.S. Liou H.C. Fu W.M. J. Bone Miner. Res. 2003; 18: 502-511Crossref PubMed Scopus (46) Google Scholar). Equal amounts of protein were incubated with specific antibody immobilized onto protein-A/G-Sepharose for 12 h at 4 °C with gentle rotation. Beads were washed extensively with lysis buffer, boiled, and microcentrifuged. Proteins were resolved on SDS-PAGE and transferred to Immobilon polyvinylidene difluoride membranes. The blots were blocked with 4% BSA for 1 h at room temperature and then probed with rabbit anti-rat antibodies against Fn (1:1500) or c-Src (1:1000) for 1 h at room temperature. After three washes, the blots were subsequently incubated with a donkey anti-rabbit peroxidase-conjugated secondary antibody (1:1000) for 1 h at room temperature. The blots were visualized by enhanced chemiluminescence using Kodak X-Omat LS film (Eastman Kodak Co.). For normalization purposes, the same blot was also probed with mouse anti-rat α-tubulin antibody (1:1000). Quantitative data were obtained by using a computing densitometer and ImageQuant software (Amersham Biosciences). Determination of Cytosolic Ca2+ with Fluo-3-AM—Fluo-3-acetoxymethyl ester (fluo-3-AM) was used to measure cytosolic free Ca2+. Cells were incubated for 60 min in the dark at room temperature with fluo-3-AM (4 μm), and the cells were then washed, and cytosolic Ca2+ was measured by FACSCalibur (CellQuest software, BD Biosciences). Excitation and emission wavelengths were 488 and 530 nm, respectively. Quantification of Integrin Expression—Osteoblasts were plated in 6-well (35-mm) dishes. The cells were then washed with PBS and detached with trypsin at 37 °C. Cells were fixed for 10 min in PBS containing 1% paraformaldehyde. After rinsing in PBS, the cells were incubated with rabbit anti-rat α5or β1 integrin antibody (1:100) for 1 h at 4 °C. Cells were then washed again, incubated with fluorescein isothiocyanate-conjugated secondary IgG for 45 min, and analyzed by flow cytometry using FACSCalibur. Transfection and Reporter Gene Assay—Osteoblasts were cotransfected with 1 μg of Fn promoter plasmid and 1 μg of β-galactosidase expression vector. Osteoblasts were grown to 60% confluence in 12-well plates and were transfected the following day by LF2000, premixed DNA with OPTI-MEM, and LF2000 with OPTI-MEM, respectively, for 5 min. The mixture was then incubated for 25 min at room temperature and added to each well. After a 24-h incubation, transfection was complete, and the cells were incubated with the indicated agents. After 24 h of incubation, the media were removed, and cells were washed once with cold PBS. To prepare lysates, 100 μl of reporter lysis buffer (Promega, Madison, WI) was added to each well, and cells were scraped from dishes. The supernatant was collected after centrifugation at 13,000 rpm for 30 s. Aliquots of cell lysates (10 μl) containing equal amounts of protein (10–20 μg) were placed into wells of an opaque black 96-well microplate. An equal volume of luciferase substrate was added to all samples, and luminescence was measured in a microplate luminometer. The luciferase activity value was normalized to transfection efficiency monitored by the cotransfected β-galactosidase expression vector. In experiments using dominant negative mutants, cells were cotransfected with reporter (0.5 μg) and β-galactosidase (0.25 μg) and either the PKCα or c-Src mutant or the empty vector (1.0 μg). Measurement of Bone Mineral Density (BMD) and Bone Volume—The local injection of young rats was prepared by the method described previously (23Tang C.H. Yang R.S. Huang T.H. Liu S.H. Fu W.M. Mol. Pharmacol. 2004; 66: 440-449PubMed Google Scholar). Male Sprague-Dawley rats weighing 73–88 g were used. Implantation of a cannula (22-gauge) was done from the posterolateral side into the proximal tibial metaphysis in both limbs of rats anesthetized with trichloroacetaldehyde. The cannula had its outer end in the subcutaneous tissue. PGE2 or 17-phenyl trinor PGE2 (30 μm, 10 μl) was percutaneously injected into the proximal tibia through the cannula (once/day) for 7 consecutive days. The same volume of vehicle was injected into the contralateral side for comparison. On day 14, the rats were sacrificed, and the tibiae were also removed and cleaned of soft tissue. BMD and BMC of the tibia were measured with a dual-energy x-ray absorptiometer (DEXA, XR-26; Norland, Fort Atkinson, WI). The mode adapted to the measurements of small subjects was adopted. A coefficient of variation of 0.7% was calculated from daily measurements of BMD on a lumbar phantom for more than 1 year. The whole tibiae were scanned, and BMD and BMC were measured by absorptiometer. At the end of the program, the tibia was fixed, decalcified, and embedded in paraffin. Serial sections (5 μm) were cut longitudinally, and endogenous peroxidase activity was inactivated by treatment with 3% H2O2 in methanol for 20 min. The sections were then treated with normal goat serum to block nonspecific binding, followed by incubation with rabbit anti-rat Fn, α5β1 integrin, and type I collagen antibody (1:300) overnight at 4 °C. The sections were detected by avidin-biotin-peroxidase detection system and diaminobenzidine. For measurement of bone volume, the sections were stained with Mayer's hematoxylin and eosin solution. Images of the growth plate and proximal tibia were photographed by using an Olympus microscope IX70. Measurement of bone volume was performed on the secondary spongiosa, which is located 1.0–3.0 mm distal to epiphyseal growth plate and is characterized by a network of larger trabeculae. Bone volume was calculated using image analysis software (Image-Pro Plus 3.0) and expressed as percent of bone area. All measurements were done in a single-blind fashion. All protocols complied with institutional guidelines and were approved by Animal Care Committee of Medical College, National Taiwan University. Statistics—The values given are means ± S.E. The significance of difference between the experimental groups and controls was assessed by Student's t test. The difference is significant if the p value was <0.05. PGE2 Enhanced Fn Fibrillogenesis in Cultured Osteoblasts— The fibrillogenesis from the endogenously released Fn by the primary cultured rat osteoblasts was studied using immunocytochemistry. Day 3–5 osteoblasts were changed to serum-free medium and incubated with PGE2 (3 μm) for 24 h. Immunostaining of Fn was examined in 4% paraformaldehyde-fixed and nonpermeabilized cells. The mean immunofluorescence intensity underneath a cell group of 10–15 cells was measured using a confocal microscope. As shown in Fig. 1A, osteoblasts are able to form Fn network underneath the cell using endogenously released Fn. Fn fibril formation increased in response to the treatment of PGE2 for 24 h (Fig. 1B). The quantitative data showed a dose-dependent increase of fluorescence intensity (Fig. 1C). We also used ELISA to detect extracellular immobilized Fn. PGE2 also increased Fn expression in a concentration-dependent manner (Fig. 1D). Western blotting was used to examine the effect of PGE2 on the protein levels of Fn. Day 3–5 osteoblasts were changed to serum-free culture medium and treated with PGE2 for 24 h. The cultures were then washed with cold PBS, and protein samples were collected by the addition of lysis buffer without trypsin digestion. The result from Western blotting may contain both soluble cytosolic Fn and extracellular immobilized Fn. As shown in Fig. 1, E and F (PGE2 at 3 μm), PGE2 increased protein levels of Fn in a concentration- and time-dependent manner. Involvement of EP1 Receptors in PGE2-mediated Increase of Fn Formation—PGEs exert their effects through interaction with specific EP1–4 receptors (14Weinreb M. Machwate M. Shir N. Abramovitz M. Rodan G.A. Harada S. Bone. 2001; 28: 275-281Crossref PubMed Scopus (48) Google Scholar). To investigate the role of EP1–4 subtype receptors in PGE2-mediated increase of Fn formation, we assessed the distribution of these EP subtype receptors in rat primary osteoblasts by RT-PCR analysis. The mRNAs of EP1, EP2, EP3, and EP4 subtype receptors could be detected in primary rat osteoblasts (Fig. 2A). After PGE2 treatment for 6 h, the mRNA level of EP1 subtype receptor was evidently increased, whereas other subtype EP receptor mRNAs remained unchanged (Fig. 2A). We next examined which EP subtype receptors were involved in the PGE2-mediated increase of Fn formation, and specific inhibition of EP1 receptor expression was accomplished with AS-ODN. It was found that EP1 receptor-specific AS-ODN but not other EP receptor AS-ODN or MM-ODN significantly blocked the PGE2-mediated increase of Fn formation in primary rat osteoblasts (Fig. 2B). To determine the role of EP1 receptor-dependent signaling in the regulation of Fn expression in osteoblasts, the cells were treated with EP1–4-specific agonists, and then the expression level of Fn was examined. Of the agonists tested, only the EP1/EP3-selective receptor agonist, 17-phenyl trinor PGE2 (3 μm), significantly increased the protein level of Fn (Fig. 3A). In contrast, butaprost (EP2 agonist; 10 μm), sulprostone (EP3 agonist; 10 μm), and 11-deoxy-PGE1 (EP2/EP4-selective agonist; 10 μm) failed to up-regulate Fn expression. In addition, treatment of EP1 receptor antagonist SC19220 (10 μm) effectively antagonized the potentiating effect of PGE2 on Fn expression (Fig. 3A). It has been reported that sulprostone also acts on the rat EP1 receptor (26Boie Y. Stocco R. Sawyer N. Slipetz D.M. Ungrin M.D. Neuschafer-Rube F. Puschel G.P. Metters K.M. Abramovitz M. Eur. J. Pharmacol. 1997; 340: 227-241Crossref PubMed Scopus (267) Google Scholar). We then examined the concentration-dependent effect of sulprostone on the expression of Fn. Treatment of osteoblast with sulprostone did not increase the protein level of Fn unless at a higher concentration of 20 μm. Pretreatment of osteoblasts with EP1 AS-ODN but not EP3 AS-ODN antagonized the potentiating action of 20 μm sulprostone (Fig. 3B). The results shown above using pharmacological treatment or genetic inhibition clearly demonstrated a critical role for the EP1 receptor in the PGE2-mediated increase of Fn formation. It has been reported that activation of EP1 augments intracellular calcium mobilization, which is related to downstream signals (15Watabe A. Sugimoto Y. Honda A. Irie A. Namba T. Negishi M. Ito S. Narumiya S. Ichikawa A. J. Biol. Chem. 1993; 268: 20175-20178Abstract Full Text PDF PubMed Google Scholar). We then investigated the effect of chelating intracellular Ca2+ on the potentiating action of PGE2 on Fn expression. Pretreatment with BAPTA-AM (0.1–10 μm) for 30 min significantly abrogated PGE2-induced Fn formation (Fig. 3C). The quantitative data are shown in Fig. 3C, lower panels. Flow cytometry was used to investigate the effect of PGE2 on the change of intracellular Ca2+ concentration. As shown in Fig. 3D, incubation with PGE2 (3 μm), 17-phenyl trinor PGE2 (3 μm), and sulprostone (20 μm) enhanced the fluorescence intensity of fluo-3. However, sulprostone at 10 μm only slightly increased the intracellular Ca2+ concentration. ELISA detection also showed that pretreatment of osteoblasts with th" @default.
• W1982455287 created "2016-06-24" @default.
• W1982455287 creator A5001458811 @default.
• W1982455287 creator A5009738321 @default.
• W1982455287 creator A5024009281 @default.
• W1982455287 date "2005-06-01" @default.
• W1982455287 modified "2023-10-14" @default.
• W1982455287 title "Prostaglandin E2 Stimulates Fibronectin Expression through EP1 Receptor, Phospholipase C, Protein Kinase Cα, and c-Src Pathway in Primary Cultured Rat Osteoblasts" @default.
• W1982455287 cites W1523969239 @default.
• W1982455287 cites W1532214820 @default.
• W1982455287 cites W1558930301 @default.
• W1982455287 cites W1576671418 @default.
• W1982455287 cites W1591685989 @default.
• W1982455287 cites W1967385667 @default.
• W1982455287 cites W1967678975 @default.
• W1982455287 cites W1967922151 @default.
• W1982455287 cites W1976769209 @default.
• W1982455287 cites W1977455246 @default.
• W1982455287 cites W1999030637 @default.
• W1982455287 cites W2005792688 @default.
• W1982455287 cites W2007762330 @default.
• W1982455287 cites W2011497948 @default.
• W1982455287 cites W2012806471 @default.
• W1982455287 cites W2016024712 @default.
• W1982455287 cites W2024508053 @default.
• W1982455287 cites W2029231027 @default.
• W1982455287 cites W2051066183 @default.
• W1982455287 cites W2055023858 @default.
• W1982455287 cites W2056625902 @default.
• W1982455287 cites W2057918576 @default.
• W1982455287 cites W2078057379 @default.
• W1982455287 cites W2082795700 @default.
• W1982455287 cites W2087145616 @default.
• W1982455287 cites W2090589737 @default.
• W1982455287 cites W2092738120 @default.
• W1982455287 cites W2102285032 @default.
• W1982455287 cites W2106660324 @default.
• W1982455287 cites W2115293226 @default.
• W1982455287 cites W2122543608 @default.
• W1982455287 cites W2133193775 @default.
• W1982455287 cites W2143030475 @default.
• W1982455287 cites W2148281583 @default.
• W1982455287 cites W2151413316 @default.
• W1982455287 cites W2153244390 @default.
• W1982455287 cites W2160873496 @default.
• W1982455287 cites W2165253648 @default.
• W1982455287 cites W4248634331 @default.
• W1982455287 doi "https://doi.org/10.1074/jbc.m500130200" @default.
• W1982455287 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15833739" @default.
• W1982455287 hasPublicationYear "2005" @default.
• W1982455287 type Work @default.
• W1982455287 sameAs 1982455287 @default.
• W1982455287 citedByCount "94" @default.
• W1982455287 countsByYear W19824552872012 @default.
• W1982455287 countsByYear W19824552872013 @default.
• W1982455287 countsByYear W19824552872014 @default.
• W1982455287 countsByYear W19824552872015 @default.
• W1982455287 countsByYear W19824552872016 @default.
• W1982455287 countsByYear W19824552872017 @default.
• W1982455287 countsByYear W19824552872018 @default.
• W1982455287 countsByYear W19824552872019 @default.
• W1982455287 countsByYear W19824552872020 @default.
• W1982455287 countsByYear W19824552872021 @default.
• W1982455287 countsByYear W19824552872023 @default.
• W1982455287 crossrefType "journal-article" @default.
• W1982455287 hasAuthorship W1982455287A5001458811 @default.
• W1982455287 hasAuthorship W1982455287A5009738321 @default.
• W1982455287 hasAuthorship W1982455287A5024009281 @default.
• W1982455287 hasBestOaLocation W19824552871 @default.
• W1982455287 hasConcept C108636557 @default.
• W1982455287 hasConcept C12927208 @default.
• W1982455287 hasConcept C1491633281 @default.
• W1982455287 hasConcept C153911025 @default.
• W1982455287 hasConcept C170493617 @default.
• W1982455287 hasConcept C178592051 @default.
• W1982455287 hasConcept C181199279 @default.
• W1982455287 hasConcept C185592680 @default.
• W1982455287 hasConcept C2778938600 @default.
• W1982455287 hasConcept C55493867 @default.
• W1982455287 hasConcept C86492073 @default.
• W1982455287 hasConcept C86803240 @default.
• W1982455287 hasConcept C95444343 @default.
• W1982455287 hasConceptScore W1982455287C108636557 @default.
• W1982455287 hasConceptScore W1982455287C12927208 @default.
• W1982455287 hasConceptScore W1982455287C1491633281 @default.
• W1982455287 hasConceptScore W1982455287C153911025 @default.
• W1982455287 hasConceptScore W1982455287C170493617 @default.
• W1982455287 hasConceptScore W1982455287C178592051 @default.
• W1982455287 hasConceptScore W1982455287C181199279 @default.
• W1982455287 hasConceptScore W1982455287C185592680 @default.
• W1982455287 hasConceptScore W1982455287C2778938600 @default.
• W1982455287 hasConceptScore W1982455287C55493867 @default.
• W1982455287 hasConceptScore W1982455287C86492073 @default.
• W1982455287 hasConceptScore W1982455287C86803240 @default.
• W1982455287 hasConceptScore W1982455287C95444343 @default.
• W1982455287 hasIssue "24" @default.
• W1982455287 hasLocation W19824552871 @default.
• W1982455287 hasOpenAccess W1982455287 @default.

• next