FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1983104893> ?p ?o ?g. }

• W1983104893 endingPage "838" @default.
• W1983104893 startingPage "827" @default.
• W1983104893 abstract "Congenital cataracts (CCs), responsible for about one-third of blindness in infants, are a major cause of vision loss in children worldwide. Autosomal-recessive congenital cataracts (arCC) form a clinically diverse and genetically heterogeneous group of disorders of the crystalline lens. To identify the genetic cause of arCC in consanguineous Pakistani families, we performed genome-wide linkage analysis and fine mapping and identified linkage to 3p21-p22 with a summed LOD score of 33.42. Mutations in the gene encoding FYVE and coiled-coil domain containing 1 (FYCO1), a PI(3)P-binding protein family member that is associated with the exterior of autophagosomes and mediates microtubule plus-end-directed vesicle transport, were identified in 12 Pakistani families and one Arab Israeli family in which arCC had previously been mapped to the overlapping CATC2 region. Nine different mutations were identified, including c.3755 delC (p.Ala1252AspfsX71), c.3858_3862dupGGAAT (p.Leu1288TrpfsX37), c.1045 C>T (p.Gln349X), c.2206C>T (p.Gln736X), c.2761C>T (p.Arg921X), c.2830C>T (p.Arg944X), c.3150+1 G>T, c.4127T>C (p.Leu1376Pro), and c.1546C>T (p.Gln516X). Fyco1 is expressed in the mouse embryonic and adult lens and peaks at P12d. Expressed mutant proteins p.Leu1288TrpfsX37 and p.Gln736X are truncated on immunoblots. Wild-type and p.L1376P FYCO1, the only missense mutant identified, migrate at the expected molecular mass. Both wild-type and p. Leu1376Pro FYCO1 proteins expressed in human lens epithelial cells partially colocalize to microtubules and are found adjacent to Golgi, but they primarily colocalize to autophagosomes. Thus, FYCO1 is involved in lens development and transparency in humans, and mutations in this gene are one of the most common causes of arCC in the Pakistani population. Congenital cataracts (CCs), responsible for about one-third of blindness in infants, are a major cause of vision loss in children worldwide. Autosomal-recessive congenital cataracts (arCC) form a clinically diverse and genetically heterogeneous group of disorders of the crystalline lens. To identify the genetic cause of arCC in consanguineous Pakistani families, we performed genome-wide linkage analysis and fine mapping and identified linkage to 3p21-p22 with a summed LOD score of 33.42. Mutations in the gene encoding FYVE and coiled-coil domain containing 1 (FYCO1), a PI(3)P-binding protein family member that is associated with the exterior of autophagosomes and mediates microtubule plus-end-directed vesicle transport, were identified in 12 Pakistani families and one Arab Israeli family in which arCC had previously been mapped to the overlapping CATC2 region. Nine different mutations were identified, including c.3755 delC (p.Ala1252AspfsX71), c.3858_3862dupGGAAT (p.Leu1288TrpfsX37), c.1045 C>T (p.Gln349X), c.2206C>T (p.Gln736X), c.2761C>T (p.Arg921X), c.2830C>T (p.Arg944X), c.3150+1 G>T, c.4127T>C (p.Leu1376Pro), and c.1546C>T (p.Gln516X). Fyco1 is expressed in the mouse embryonic and adult lens and peaks at P12d. Expressed mutant proteins p.Leu1288TrpfsX37 and p.Gln736X are truncated on immunoblots. Wild-type and p.L1376P FYCO1, the only missense mutant identified, migrate at the expected molecular mass. Both wild-type and p. Leu1376Pro FYCO1 proteins expressed in human lens epithelial cells partially colocalize to microtubules and are found adjacent to Golgi, but they primarily colocalize to autophagosomes. Thus, FYCO1 is involved in lens development and transparency in humans, and mutations in this gene are one of the most common causes of arCC in the Pakistani population. A significant cause of vision loss worldwide, congenital cataracts (CC) cause approximately one-third of the cases of blindness in infants.1Robinson G.C. Jan J.E. Kinnis C. Congenital ocular blindness in children, 1945 to 1984.Am. J. Dis. Child. 1987; 141: 1321-1324PubMed Google Scholar They can occur in an isolated fashion or as one component of a syndrome affecting multiple tissues, although the distinction might be somewhat arbitrary in some cases. In approximately 70% of CC cases, the lens alone is involved.2Hejtmancik J.F. Congenital cataracts and their molecular genetics.Semin. Cell Dev. Biol. 2008; 19: 134-149Crossref PubMed Scopus (275) Google Scholar Nonsyndromic CCs have an estimated frequency of 1–6 per 10,000 live births,3Lambert S.R. Drack A.V. Infantile cataracts.Surv. Ophthalmol. 1996; 40: 427-458Abstract Full Text PDF PubMed Scopus (287) Google Scholar and approximately one-third of CC cases are familial.4Foster A. Cataract—A global perspective: output, outcome and outlay.Eye (Lond.). 1999; 13: 449-453Crossref PubMed Scopus (75) Google Scholar Congenital cataracts are very heterogeneous, both clinically and genetically, and approximately 8.3%–25% of nonsyndromic CCs are inherited as an autosomal-recessive (ar), autosomal-dominant (ad), or X-linked trait.5François J. Genetics of cataract.Ophthalmologica. 1982; 184: 61-71Crossref PubMed Scopus (65) Google Scholar, 6Haargaard B. Wohlfahrt J. Fledelius H.C. Rosenberg T. Melbye M. A nationwide Danish study of 1027 cases of congenital/infantile cataracts: etiological and clinical classifications.Ophthalmology. 2004; 111: 2292-2298Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar, 7Merin S. Inherited Cataracts.in: Merin S. Inherited Eye Diseases. Marcel Dekker,Inc., New York1991: 86-120Google Scholar To date, more than 40 loci for human CCs have been identified, and more than 26 of them have been associated with causative mutations in specific genes.8Shiels A. Bennett T.M. Hejtmancik J.F. Cat-Map: Putting cataract on the map.Mol. Vis. 2010; 16: 2007-2015PubMed Google Scholar To date, 14 genetic loci have been implicated in nonsyndromic autosomal-recessive CC (arCC), and most of these account for a few percentage points of CC cases each. Among these loci, mutations in nine genes, eph-receptor type-A2 (EPHA2, MIM 613020), connexin50 (GJA8, MIM 600897), glucosaminyl (N-acetyl) transferase 2 (GCNT2, MIM 600429), heat-shock transcription factor 4 (HSF4, MIM 602438), lens intrinsic membrane protein (LIM2, MIM, 154045), beaded filament structural protein 1 (BFSP1, MIM 603307), αA-crystallin (CRYAA, MIM 123580), βB1-crystallin (CRYBB1, MIM 600929), and βB3-crystallin (CRYBB3, MIM 123630), have been found.9Cohen D. Bar-Yosef U. Levy J. Gradstein L. Belfair N. Ofir R. Joshua S. Lifshitz T. Carmi R. Birk O.S. Homozygous CRYBB1 deletion mutation underlies autosomal recessive congenital cataract.Invest. Ophthalmol. Vis. Sci. 2007; 48: 2208-2213Crossref PubMed Scopus (61) Google Scholar, 10Kaul H. Riazuddin S.A. Shahid M. Kousar S. Butt N.H. Zafar A.U. Khan S.N. Husnain T. Akram J. Hejtmancik J.F. Riazuddin S. Autosomal recessive congenital cataract linked to EPHA2 in a consanguineous Pakistani family.Mol. Vis. 2010; 16: 511-517PubMed Google Scholar, 11Ponnam S.P. Ramesha K. Tejwani S. Ramamurthy B. Kannabiran C. Mutation of the gap junction protein alpha 8 (GJA8) gene causes autosomal recessive cataract.J. Med. Genet. 2007; 44: e85Crossref PubMed Scopus (54) Google Scholar, 12Ponnam S.P. Ramesha K. Tejwani S. Matalia J. Kannabiran C. A missense mutation in LIM2 causes autosomal recessive congenital cataract.Mol. Vis. 2008; 14: 1204-1208PubMed Google Scholar, 13Pras E. Frydman M. Levy-Nissenbaum E. Bakhan T. Raz J. Assia E.I. Goldman B. Pras E. A nonsense mutation (W9X) in CRYAA causes autosomal recessive cataract in an inbred Jewish Persian family.Invest. Ophthalmol. Vis. Sci. 2000; 41: 3511-3515PubMed Google Scholar, 14Pras E. Levy-Nissenbaum E. Bakhan T. Lahat H. Assia E. Geffen-Carmi N. Frydman M. Goldman B. Pras E. A missense mutation in the LIM2 gene is associated with autosomal recessive presenile cataract in an inbred Iraqi Jewish family.Am. J. Hum. Genet. 2002; 70: 1363-1367Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 15Pras E. Raz J. Yahalom V. Frydman M. Garzozi H.J. Pras E. Hejtmancik J.F. A nonsense mutation in the glucosaminyl (N-acetyl) transferase 2 gene (GCNT2): Association with autosomal recessive congenital cataracts.Invest. Ophthalmol. Vis. Sci. 2004; 45: 1940-1945Crossref PubMed Scopus (68) Google Scholar, 16Ramachandran R.D. Perumalsamy V. Hejtmancik J.F. Autosomal recessive juvenile onset cataract associated with mutation in BFSP1.Hum. Genet. 2007; 121: 475-482Crossref PubMed Scopus (84) Google Scholar, 17Riazuddin S.A. Yasmeen A. Yao W. Sergeev Y.V. Zhang Q. Zulfiqar F. Riaz A. Riazuddin S. Hejtmancik J.F. Mutations in betaB3-crystallin associated with autosomal recessive cataract in two Pakistani families.Invest. Ophthalmol. Vis. Sci. 2005; 46: 2100-2106Crossref PubMed Scopus (93) Google Scholar, 18Smaoui N. Beltaief O. BenHamed S. M'Rad R. Maazoul F. Ouertani A. Chaabouni H. Hejtmancik J.F. A homozygous splice mutation in the HSF4 gene is associated with an autosomal recessive congenital cataract.Invest. Ophthalmol. Vis. Sci. 2004; 45: 2716-2721Crossref PubMed Scopus (91) Google Scholar In six of the 14 reported arCC loci, the mutated gene is as yet unknown. The CATC2 (Cataract, Autosomal Recessive Congenital 2, MIM 610019) locus was first mapped to chromosome 3 in three inbred Arab families in 2001, but the disease-associated variants previously had not been identified.19Pras E. Pras E. Bakhan T. Levy-Nissenbaum E. Lahat H. Assia E.I. Garzozi H.J. Kastner D.L. Goldman B. Frydman M. A gene causing autosomal recessive cataract maps to the short arm of chromosome 3.Isr. Med. Assoc. J. 2001; 3: 559-562PubMed Google Scholar As part of an ongoing collaboration between the National Eye Institute (NEI, Bethesda, MD, USA), the National Centre of Excellence in Molecular Biology (NCEMB, Lahore, Pakistan), and Allama Iqbal Medical College (Lahore, Pakistan), a locus for arCC in twelve Pakistani families has been mapped to chromosomal region 3p21-p22, overlapping the CATC2 locus.19Pras E. Pras E. Bakhan T. Levy-Nissenbaum E. Lahat H. Assia E.I. Garzozi H.J. Kastner D.L. Goldman B. Frydman M. A gene causing autosomal recessive cataract maps to the short arm of chromosome 3.Isr. Med. Assoc. J. 2001; 3: 559-562PubMed Google Scholar Subsequently, homozygous missense, splice site, nonsense, and frameshift mutations have been identified in a positional candidate gene, FYCO1 (FYVE and coiled-coil domain containing 1 [MIM 607182]). In addition, a nonsense mutation was found in an Arab Israeli family in which the CATC2 locus had been mapped. In total, 9 FYCO1 mutations were identified in 13 arCC families, including 44 affected individuals, in which arCC segregates with the mutant FYCO1 allele, underlining the importance of FYCO1 in both lens biology and the pathogenesis of arCC. In this study, genome-wide linkage scans and fine mapping were performed in eight unrelated consanguineous arCC families of Pakistani origin, and 63 additional unlinked consanguineous families of Pakistani origin were additionally screened for mutations in FYCO1. Families described in this study include 060003 (also referred to as PKCC003), 060012 (PKCC012), 060014 (PKCC014), 060031 (PKCC031), 060041 (PKCC041), 060044 (PKCC044), 060054 (PKCC054), 060058 (PKCC058), 060064 (PKCC064), 060069 (PKCC069), 060091 (PKCC091), and 060094 (PKCC094). This study was approved by Institutional Review Board (IRB) of the National Centre of Excellence in Molecular Biology and the CNS IRB at the National Institutes of Health. Participating subjects gave informed consent consistent with the tenets of the Declaration of Helsinki. Ophthalmological examinations were performed at the Layton Rahmatullah Benevolent Trust Hospital, Lahore, Pakistan. A detailed medical history was obtained by interviewing family members. Medical records of clinical exams conducted with slit lamp biomicroscopy reported the types of cataract in affected individuals of the twelve families. We also recruited 150 unrelated, ethnically matched individuals, who provided control DNA samples. Blood samples were obtained from study participants and DNA was extracted using standard inorganic methods as previously described.20Grimberg J. Nawoschik S. Belluscio L. McKee R. Turck A. Eisenberg A. A simple and efficient non-organic procedure for the isolation of genomic DNA from blood.Nucleic Acids Res. 1989; 17: 8390Crossref PubMed Scopus (434) Google Scholar All affected individuals available for examination from twelve consanguineous Pakistani arCC families (060003, 060012, 060014, 060031, 060041, 060044, 060054, 060058, 060064, 060069, 060091, and 060094) displayed bilateral nuclear cataracts that either were present at birth or developed in infancy (Figure 1). Some affected individuals had undergone cataract surgery in the early years of life, and hence no pictures of their lenses were available. Autosomal recessive inheritance of the cataracts was seen in all families (Figure 2A ). No other ocular or systemic abnormalities were present in these families.Figure 2Pedigrees and Linkage Intervals for arCC FamiliesShow full caption(A) Twelve arCC pedigrees collected from Pakistan. Filled symbols denote affected individuals. Eight pedigrees (060003, 060012, 060041, 060058, 060064, 060069, 060091, and 060094) were used for genome-wide linkage scans and fine mapping of arCC intervals and candidate-gene mutation screenings. Four pedigrees (060014, 060031, 060044, and 060054) were used for fine mapping of arCC intervals and candidate-gene mutation screenings. Individuals who were genotyped are marked with an asterisk.(B) Refined arCC interval on the basis of haplotype analysis of patients with recombination events. Markers with the homozygous genotype are boxed so that the region without recombination is defined. Alleles for markers D3S3685 and D3S1289 in patients with recombination events are in bold so that the telomeric and centromeric breakpoints, respectively, are shown. The disease interval was placed between markers D3S3685 and D3S1289.View Large Image Figure ViewerDownload Hi-res image Download (PPT) (A) Twelve arCC pedigrees collected from Pakistan. Filled symbols denote affected individuals. Eight pedigrees (060003, 060012, 060041, 060058, 060064, 060069, 060091, and 060094) were used for genome-wide linkage scans and fine mapping of arCC intervals and candidate-gene mutation screenings. Four pedigrees (060014, 060031, 060044, and 060054) were used for fine mapping of arCC intervals and candidate-gene mutation screenings. Individuals who were genotyped are marked with an asterisk. (B) Refined arCC interval on the basis of haplotype analysis of patients with recombination events. Markers with the homozygous genotype are boxed so that the region without recombination is defined. Alleles for markers D3S3685 and D3S1289 in patients with recombination events are in bold so that the telomeric and centromeric breakpoints, respectively, are shown. The disease interval was placed between markers D3S3685 and D3S1289. Genome-wide linkage analysis was completed with 382 highly polymorphic microsatellite markers from the ABI PRISM Linkage Mapping Set MD-10 (Figure S2, available online; average spacing 10 cM; Applied Biosystems, Foster City, CA). PCR products were separated on an ABI 3130 DNA Analyzer, and alleles were assigned with GeneMapper Software version 4.0 (Applied Biosystems). Two-point linkage analyses were performed with the FASTLINK version of MLINK from the LINKAGE Program Package.21Cottingham Jr., R.W. Idury R.M. Schäffer A.A. Faster sequential genetic linkage computations.Am. J. Hum. Genet. 1993; 53: 252-263PubMed Google Scholar, 22Lathrop G.M. Lalouel J.M. Easy calculations of lod scores and genetic risks on small computers.Am. J. Hum. Genet. 1984; 36: 460-465PubMed Google Scholar Maximum LOD scores were calculated with ILINK. Autosomal-recessive cataracts were analyzed as a fully penetrant trait with a disease allele frequency of 0.001, and equal allele frequencies were arbitrarily used for all markers in the genome-wide scan. Marker allele frequencies were calculated from 100 Pakistani control individuals for fine mapping (Table S3). The marker order and distances between the markers were obtained from the Marshfield database and the NCBI chromosome 3 sequence maps (see Table S1). Eight of these families (060003, 060012, 060041, 060058, 060064, 060069, 060091, and 060094) independently showed significant or suggestive linkage to chromosomal region 3p21-p22; LOD scores were 3.85, 2.52, 4.09, 2.36, 3.89, 5.62, 4.88, and 3.82, respectively. Sequencing of candidate genes (see below) identified FYCO1 mutations in affected members of these eight families and subsequently in four additional arCC families (see below). Two-point linkage analysis in the 12 families with FYCO1 mutations confirms linkage to a 7.4 cM (15.6 Mb) region flanked by D3S3521 and D3S1289 (Table 1). The linked region includes markers D3S3582 (Zmax = 33.4 at θ = 0), D3S3561 (Zmax = 22.4 at θ = 0), D3S3685 (Zmax = 33.5 at θ = 0.01), and D3S2407 (Zmax = 24 at θ = 0.03). Significant LOD scores were also seen with other markers in the region, including D3S3512 (Zmax = 16.75 at θ = 0.08), D3S3521 (Zmax = 18.15 at θ = 0.05), D3S1289 (Zmax = 25.86 at θ = 0.02), D3S3616 (Zmax = 20.14 at θ = 0.05), D3S1300 (Zmax = 14.29 at θ = 0.09), and D3S3698 (Zmax = 2.14 at θ = 0.2), although these markers show obligate recombination events. Haplotype analysis confirmed and narrowed the critical interval (Figure 2B and Figure S1). Key recombination events were detected between markers D3S3582 and the adjacent telomeric marker D3S3685 in affected individuals 22, 26, 28, and 30 of family 060091 (Figure 2B and Figure S1), so that D3S3685 defines the telomeric boundary for the 3.5 cM (12 Mb) disease interval. Similarly, recombination events were detected between marker D3S3561 and its adjacent centromeric marker D3S1289 in individual 14 of family 060041, individuals 3, 7, and 8 of family 060064, and individual 26 of 060094 (Figure 2B and Figure S1), so that D3S1289 is the centromeric flanking marker. Thus, arCC in each of these 12 families cosegregates with a chromosome 3 region that includes FYCO1.Table 1Two-Point LOD Scores of Markers on Chromosomal Region 3p21 in a Total of 12 arCC FamiliesMarkercMMb00.010.050.10.20.30.4ZmaxθmaxD3S351261.5234.59- ∞12.2916.2816.6413.859.424.5616.750.08D3S352163.1238.87- ∞15.6918.1517.2113.18.23.518.150.05D3S240767.9441.3916.9423.5823.6321.7216.5510.744.9824.020.03D3S368567.9442.4732.733.531.428.0920.8713.326.0733.50.01D3S358269.1945.3933.4232.7730.1426.7419.6312.365.5433.420D3S356170.6152.3422.3721.8819.917.412.357.433.0922.370D3S1289∗71.4154.48- ∞25.6225.0522.5616.459.933.9925.860.02D3S361676.4857.34- ∞17.1120.1419.2814.799.153.9420.140.05D3S1300∗80.3260.51- ∞7.0113.4614.2511. 87.753.5414.290.09D3S369884.9263.12- ∞−17.66−4.57−0.212.141.930.992.140.2An asterisk indicates that an STR marker was included in the genome-wide scan. Open table in a new tab An asterisk indicates that an STR marker was included in the genome-wide scan. The linked region on chromosome 3 contains 287 genes or potential genes, according to the UCSC database. Candidate genes were prioritized on the basis of their expression in the lens and possible function in lens biology and transparency, as indicated in the NCBI and GeneCard databases. Although no candidate genes were absolutely excluded, pseudogenes, genes of unknown function and without known domain structures, and genes not expressed in the lens were given the lowest priorities. Primer pairs for individual exons in the critical interval were designed with the online primer3 program. The sequences and amplification conditions for FYCO1 primers are available in Table S2. The PCR primers for each exon were used for bidirectional sequencing with Big Dye Terminator Ready reaction mix according to instructions of the manufacturer (Applied Biosystems, Foster City, CA). Sequencing was performed on an ABI PRISM 3130 automated sequencer (Applied Biosystems, Foster City, CA). Sequence traces were analyzed with Mutation Surveyor (Soft Genetics Inc., State College PA) and the Seqman program of DNASTAR Software (DNASTAR Inc, Madison, WI, USA). After family 060064 was screened for 35 genes in the linked region (all of these genes were found to lack pathogenic mutations), the FYVE and coiled-coil domain containing 1 (FYCO1) gene was sequenced, and mutations were identified in this family and subsequently in the remaining seven linked families (NM_024513.2, Table 2 and Figure 3). Mutations were confirmed in all available affected family members. In family 060064, the affected individuals carry a homozygous C>T transition (1045 C>T) in exon 8, which results in a premature termination of translation (p.Gln349X). Three families (060003, 060012, and 060069) share a homozygous C>T transition (2206 C>T) in exon 8, and this transition results in a putative premature termination of translation or nonsense-mediated decay (p.Gln736X). These families share a common haplotype of 14 consecutive SNP markers across FYCO1, suggesting that they derive the mutant allele from a common ancestor (Table 3). In family 060041, a homozygous single base change in exon 8 converts an arginine residue to a premature stop codon (c.2830C>T; p.Arg944X). In family 060091, a homozygous single base-pair deletion in exon 13 causes a frameshift (c.3755 delC, p.Ala1252AspfsX71) resulting in a putative stop codon 71 amino acids downstream. In family 060094, affected individuals carry a homozygous 5 bp exon 14 duplication causing a frameshift (c.3858_3862dupGGAAT, p.Leu1288TrpfsX37) and putative stop codon 37 amino acids downstream. In family 060058, affected individuals carry a homozygous single base change converting a leucine to a proline residue in exon 16 (c.4127T>C; p.Leu1376Pro).Table 2FYCO1 Mutations in 13 arCC FamiliesFamilyAllele SharingMaximum LOD ScoreExonNucleotide ChangePredicted Amino Acid Change060064no3.898c.1045 C>Tp.Gln349X060003yes3.858c.2206C>Tp.Gln736X060012yes2.528c.2206C>Tp.Gln736X060069yes5.628c.2206C>Tp.Gln736X060054no2.618c.2761C>TaThese C>T changes occurred in a CpG dinucleotide.p.Arg921X060041no4.098c.2830C>TaThese C>T changes occurred in a CpG dinucleotide.p.Arg944X060044no2.539c.3150+1 G>Tinactivation of splice donor site060091no4.8813c.3755 delCp.Ala1252AspfsX71060094yes3.8214c.3858_3862dupGGAATp.Leu1288TrpfsX37060014yes2.7314c.3858_3862dupGGAATp.Leu1288TrpfsX37060058yes2.3616c.4127T>Cp.Leu1376Pro060031yes2.2816c.4127T>Cp.Leu1376ProFamily 119Pras E. Pras E. Bakhan T. Levy-Nissenbaum E. Lahat H. Assia E.I. Garzozi H.J. Kastner D.L. Goldman B. Frydman M. A gene causing autosomal recessive cataract maps to the short arm of chromosome 3.Isr. Med. Assoc. J. 2001; 3: 559-562PubMed Google Scholarnon/a8c.1546C>Tp.Gln516XNucleotide and amino acid designations are based on Refseq NM_024513.2.a These C>T changes occurred in a CpG dinucleotide. Open table in a new tab Table 3Intragenic FYCO1 Haplotypes of Families Sharing Common Mutationsp.Gln736Xp.Leu1288TrpfsX37p.Leu1376ProPCR AmpliconPositionSNP IDAllele (Frequency)Family 060003Family 060012Family 060069Family 060094Family 060014Family 060031Family 060058445961218rs4682801C(.07)/A(.93)AAAAAAA545956851rs751552T(.71)/A(.29)TTTAATT645954545rs41289622A(.61)/C(.39)CCCAAAA8A45950077rs4683158G(.07)/A(.93)AAAAAAA8A45950007rs13071283A(.61)/G(.39)GGGAAAA8B45949864rs3733100G(.56)/C(.44)CCCCCGG8C45949487rs33910087C(.67)/T(.33)TTTCCCC8E45948790rs3796375C((.73)/T(.27)CCCTTCC8G45948087rs13079869C(.7)/T(.3)TTTCCCC8H45947825rs71622515AAC(.61)/GAA(.39)GAAGAAGAAAACAACAACAAC8H45947702rs1994490A(.39)/G(.61)GGGGGAA1245940870rs13069079C(.61)/T(.39)TTTCCCC1445936761rs1463680C(.18)/T(.82)TTTTTTT1545917899rs1873002A(.16)/G(.84)GGGGGGGFiaFi: Frequency of the haplotype calculated on an assumption of independent inheritance of all SNP alleles estimated from 48 unrelated Pakistani controls..00019.00019.00019.000813.000813.00162.00162FHCHMbFHCHM: Frequency of the haplotype calculated from 48 unrelated Pakistani controls via the CHM algorithm as implemented in the Golden Helix SVS package.0.0190.0190.0190.0260.0260.0370.037The PCR amplicon, as well as the SNP, its position in the Ref_Assembly Build 37.1, SNP ID, and allelic variants are shown. Haplotypes were constructed on the basis of 14 consecutive intragenic single nucleotide polymorphisms (SNPs) within FYCO1.a Fi: Frequency of the haplotype calculated on an assumption of independent inheritance of all SNP alleles estimated from 48 unrelated Pakistani controls.b FHCHM: Frequency of the haplotype calculated from 48 unrelated Pakistani controls via the CHM algorithm as implemented in the Golden Helix SVS package. Open table in a new tab Nucleotide and amino acid designations are based on Refseq NM_024513.2. The PCR amplicon, as well as the SNP, its position in the Ref_Assembly Build 37.1, SNP ID, and allelic variants are shown. Haplotypes were constructed on the basis of 14 consecutive intragenic single nucleotide polymorphisms (SNPs) within FYCO1. Linkage analysis in some of the 125 arCC families ascertained had mapped loci to regions other than 3p21-p22. Sequencing FYCO1 in an affected individual from each of the 63 families in whom linkage analysis had not yielded a maximal LOD score of 3 identified mutations in four additional families (Table 2 and Figure 3). In family 060054, a homozygous single base change in exon 8 converts an arginine residue to a premature stop codon (c.2761C>T; p.Arg921X). In family 060044, we identified a homozygous single base change, a G-to-T transversion located in the conserved intron 9 donor splice site (c. 3150+1 G>T), suggesting that it might affect splicing. This is supported by the calculated splice-site scores of 7.6 for the normal splice site and −3.2 for the variant site, predicting that the c. 3150+1 G>T change leads to elimination of the intron 9 donor site. As in family 060094, exon 14 of affected individuals in family 060014 contains a homozygous 5 bp duplication causing a frameshift. The families share a common 14 intragenic FYCO1 SNP haplotype, suggesting that the mutant allele originates from a common ancestor (Table 3). As in family 060058, exon 16 of affected individuals in family 060031 contains a homozygous single base change that converts a leucine residue to a proline residue (c.4127T>C; p.Leu1376Pro). Once more, these two families share a common 14 SNP intragenic FYCO1 haplotype, suggesting that the disease allele originates from a common ancestor (Table 3). Each of the identified mutations segregates with arCC in the families, and none is present in the NCBI or Ensemble SNP databases. In addition, none of these eight mutations was detected in 300 unrelated, ethnically matched control chromosomes or in HapMap samples of any ethnicity. In addition, FYCO1 was sequenced in family 1 from Pras et al.,19Pras E. Pras E. Bakhan T. Levy-Nissenbaum E. Lahat H. Assia E.I. Garzozi H.J. Kastner D.L. Goldman B. Frydman M. A gene causing autosomal recessive cataract maps to the short arm of chromosome 3.Isr. Med. Assoc. J. 2001; 3: 559-562PubMed Google Scholar and the finding of a homozygous c.1546C>T sequence change (p.Gln516X) indicates that the FYCO1 mutation causes the autosomal-recessive congenital cataracts in this consanguineous Arabic family (Figure 3) and thus is the gene mutated in CATC2. FYCO1 on chromosome 3 contains 18 exons comprising 79 Kb and encoding 1478 amino acids.23Kiss H. Darai E. Kiss C. Kost-Alimova M. Klein G. Dumanski J.P. Imreh S. Comparative human/murine sequence analysis of the common eliminated region 1 from human 3p21.3.Mamm. Genome. 2002; 13: 646-655Crossref PubMed Scopus (16) Google Scholar, 24Kiss H. Yang Y. Kiss C. Andersson K. Klein G. Imreh S. Dumanski J.P. The transcriptional map of the common eliminated region 1 (C3CER1) in 3p21.3.Eur. J. Hum. Genet. 2002; 10: 52-61Crossref PubMed Scopus (32) Google Scholar The full-length FYCO1 mRNA (NM_024513.2) encodes a 167 kDa protein. FYCO1 has been highly conserved throughout evolution (protein sequence identity between humans and dogs after alignment via the CLUSTALW algorithm is 81%; that between humans and cows is 81%, that between humans and mice is 78%, that between humans and platypuses is 66%, and that between humans and zebrafish is 37%). Analyses using the Conserved Domain Database25Marchler-Bauer A. Anderson J.B. Chitsaz F. Derbyshire M.K. DeWeese-Scott C. Fong J.H. Geer L.Y. Geer R.C. Gonzales N.R. Gwadz M. et al.CDD: specific functional annotation with the Conserved Domain Database.Nucleic Acids Res. 2009; 37: D205-D210Crossref PubMed Scopus (890) Google Scholar and the COILS web server26Lupas A. Van D.M. Stock J. Predicting coiled coils from protein sequences.Science. 1991; 252: 1162-1164Crossref PubMed Scopus (3377) Google Scholar predict that FYCO1 is a long coiled-coil protein similar to members of two families of Rab effector proteins: RUN and FYVE domain-containing proteins (RUFY1–4) and early endosome antigen 1 (EEA1).27Rose A. Schraegle S.J. Stahlberg E.A. Meier I. Coiled-coil protein composition of 22 proteomes—Differences and common themes in subcellular infrastructure and traffic control.BMC Evol. Biol. 2005; 5: 66Crossref PubMed Scopus (85) Google Scholar FYCO1 contains a long central coiled-coil region flanked at the N terminus by an α-helical RUN domain or a zinc finger domain and at the C terminus by a FYVE domain (Figure 4A ). Unique to FYCO1 is the presence of a C-terminal extension in the form of a GOLD (Golgi dynamics) domain and an unstructured loop region connecting the FYVE and GOLD domains (Figure 4A). Most of the identified" @default.
• W1983104893 created "2016-06-24" @default.
• W1983104893 creator A5009921382 @default.
• W1983104893 creator A5014192128 @default.
• W1983104893 creator A5016753379 @default.
• W1983104893 creator A5054918012 @default.
• W1983104893 creator A5055306825 @default.
• W1983104893 creator A5056061328 @default.
• W1983104893 creator A5056512930 @default.
• W1983104893 creator A5057326412 @default.
• W1983104893 creator A5059151872 @default.
• W1983104893 creator A5084615582 @default.
• W1983104893 creator A5090663463 @default.
• W1983104893 date "2011-06-01" @default.
• W1983104893 modified "2023-09-25" @default.
• W1983104893 title "Mutations in FYCO1 Cause Autosomal-Recessive Congenital Cataracts" @default.
• W1983104893 cites W1964959216 @default.
• W1983104893 cites W1970302878 @default.
• W1983104893 cites W1977114591 @default.
• W1983104893 cites W1986439565 @default.
• W1983104893 cites W1994823455 @default.
• W1983104893 cites W1996777571 @default.
• W1983104893 cites W2013898010 @default.
• W1983104893 cites W2022103403 @default.
• W1983104893 cites W2023680182 @default.
• W1983104893 cites W2024645073 @default.
• W1983104893 cites W2026098936 @default.
• W1983104893 cites W2032151794 @default.
• W1983104893 cites W2035333716 @default.
• W1983104893 cites W2038156255 @default.
• W1983104893 cites W2045373134 @default.
• W1983104893 cites W2049709065 @default.
• W1983104893 cites W2067847530 @default.
• W1983104893 cites W2094367636 @default.
• W1983104893 cites W2109034822 @default.
• W1983104893 cites W2112523199 @default.
• W1983104893 cites W2124644922 @default.
• W1983104893 cites W2127134771 @default.
• W1983104893 cites W2142044474 @default.
• W1983104893 cites W2152911717 @default.
• W1983104893 cites W2165218453 @default.
• W1983104893 cites W2168212241 @default.
• W1983104893 cites W2169598826 @default.
• W1983104893 cites W4211111623 @default.
• W1983104893 doi "https://doi.org/10.1016/j.ajhg.2011.05.008" @default.
• W1983104893 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3113247" @default.
• W1983104893 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21636066" @default.
• W1983104893 hasPublicationYear "2011" @default.
• W1983104893 type Work @default.
• W1983104893 sameAs 1983104893 @default.
• W1983104893 citedByCount "128" @default.
• W1983104893 countsByYear W19831048932012 @default.
• W1983104893 countsByYear W19831048932013 @default.
• W1983104893 countsByYear W19831048932014 @default.
• W1983104893 countsByYear W19831048932015 @default.
• W1983104893 countsByYear W19831048932016 @default.
• W1983104893 countsByYear W19831048932017 @default.
• W1983104893 countsByYear W19831048932018 @default.
• W1983104893 countsByYear W19831048932019 @default.
• W1983104893 countsByYear W19831048932020 @default.
• W1983104893 countsByYear W19831048932021 @default.
• W1983104893 countsByYear W19831048932022 @default.
• W1983104893 countsByYear W19831048932023 @default.
• W1983104893 crossrefType "journal-article" @default.
• W1983104893 hasAuthorship W1983104893A5009921382 @default.
• W1983104893 hasAuthorship W1983104893A5014192128 @default.
• W1983104893 hasAuthorship W1983104893A5016753379 @default.
• W1983104893 hasAuthorship W1983104893A5054918012 @default.
• W1983104893 hasAuthorship W1983104893A5055306825 @default.
• W1983104893 hasAuthorship W1983104893A5056061328 @default.
• W1983104893 hasAuthorship W1983104893A5056512930 @default.
• W1983104893 hasAuthorship W1983104893A5057326412 @default.
• W1983104893 hasAuthorship W1983104893A5059151872 @default.
• W1983104893 hasAuthorship W1983104893A5084615582 @default.
• W1983104893 hasAuthorship W1983104893A5090663463 @default.
• W1983104893 hasBestOaLocation W19831048931 @default.
• W1983104893 hasConcept C104317684 @default.
• W1983104893 hasConcept C2780225610 @default.
• W1983104893 hasConcept C35158069 @default.
• W1983104893 hasConcept C501734568 @default.
• W1983104893 hasConcept C54355233 @default.
• W1983104893 hasConcept C62564794 @default.
• W1983104893 hasConcept C71924100 @default.
• W1983104893 hasConcept C86803240 @default.
• W1983104893 hasConceptScore W1983104893C104317684 @default.
• W1983104893 hasConceptScore W1983104893C2780225610 @default.
• W1983104893 hasConceptScore W1983104893C35158069 @default.
• W1983104893 hasConceptScore W1983104893C501734568 @default.
• W1983104893 hasConceptScore W1983104893C54355233 @default.
• W1983104893 hasConceptScore W1983104893C62564794 @default.
• W1983104893 hasConceptScore W1983104893C71924100 @default.
• W1983104893 hasConceptScore W1983104893C86803240 @default.
• W1983104893 hasIssue "6" @default.
• W1983104893 hasLocation W19831048931 @default.
• W1983104893 hasLocation W19831048932 @default.
• W1983104893 hasLocation W19831048933 @default.
• W1983104893 hasOpenAccess W1983104893 @default.
• W1983104893 hasPrimaryLocation W19831048931 @default.

• next