FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1983271010> ?p ?o ?g. }

• W1983271010 endingPage "3674" @default.
• W1983271010 startingPage "3665" @default.
• W1983271010 abstract "DNA polymerase β (pol β) and flap endonuclease 1 (FEN1) are key players in pol β-mediated long-patch base excision repair (LP-BER). It was proposed that this type of LP-BER is accomplished through FEN1 removal of a 2- to 11-nucleotide flap created by pol β strand displacement DNA synthesis. To understand how these enzymes might cooperate during LP-BER, we characterized purified human pol β DNA synthesis by utilizing various BER intermediates, including single-nucleotide-gapped DNA, nicked DNA, and nicked DNA with various lengths of flaps all with a 5′-terminal tetrahydrofuran (THF) residue. We observed that nicked DNA and nicked-THF flap DNA were poor substrates for pol β-mediated DNA synthesis; yet, DNA synthesis was strongly stimulated by purified human FEN1. FEN1 did not improve pol β substrate binding. FEN1 cleavage activity was required for the stimulation, suggesting that FEN1 removed a barrier to pol β DNA synthesis. In addition, FEN1 cleavage on both nicked and nicked-THF flap DNA resulted in a one-nucleotide gapped DNA molecule that was an ideal substrate for pol β. This study demonstrates that pol β cooperates with FEN1 to remove DNA damage via a “Hit and Run” mechanism, involving alternating short gap production by FEN1 and gap filling by pol β, rather than through coordinated formation and removal of a strand-displaced flap. DNA polymerase β (pol β) and flap endonuclease 1 (FEN1) are key players in pol β-mediated long-patch base excision repair (LP-BER). It was proposed that this type of LP-BER is accomplished through FEN1 removal of a 2- to 11-nucleotide flap created by pol β strand displacement DNA synthesis. To understand how these enzymes might cooperate during LP-BER, we characterized purified human pol β DNA synthesis by utilizing various BER intermediates, including single-nucleotide-gapped DNA, nicked DNA, and nicked DNA with various lengths of flaps all with a 5′-terminal tetrahydrofuran (THF) residue. We observed that nicked DNA and nicked-THF flap DNA were poor substrates for pol β-mediated DNA synthesis; yet, DNA synthesis was strongly stimulated by purified human FEN1. FEN1 did not improve pol β substrate binding. FEN1 cleavage activity was required for the stimulation, suggesting that FEN1 removed a barrier to pol β DNA synthesis. In addition, FEN1 cleavage on both nicked and nicked-THF flap DNA resulted in a one-nucleotide gapped DNA molecule that was an ideal substrate for pol β. This study demonstrates that pol β cooperates with FEN1 to remove DNA damage via a “Hit and Run” mechanism, involving alternating short gap production by FEN1 and gap filling by pol β, rather than through coordinated formation and removal of a strand-displaced flap. The mammalian genome suffers from endogenous and exogenous insults that modify DNA. These modifications can be a small single-base lesion, bulky DNA adduct, base dimer, or other type of alteration. Among them, the single-base lesion is the most common form of DNA damage observed in mammalian cells, because it arises from both exogenous DNA-damaging agents (1Lawley P.D. Prog. Nucleic Acids Res. Mol. Biol. 1966; 5: 89-131Crossref PubMed Scopus (280) Google Scholar) as well as from endogenous biological processes resulting in base alkylation (2Lutz W.K. Mutat. Res. 1990; 238: 287-295Crossref PubMed Scopus (125) Google Scholar, 3Lindahl T. Nature. 1993; 362: 709-715Crossref PubMed Scopus (4378) Google Scholar) and oxidation (4Ames B.N. Free Radic. Res. Commun. 1989; 7: 121-128Crossref PubMed Scopus (626) Google Scholar, 5Ames B.N. Gold L.S. Mutat. Res. 1991; 250: 3-16Crossref PubMed Scopus (686) Google Scholar). Additionally, endogenous cytosine deamination and base loss resulting from hydrolysis of the glycosidic bond are important sources of DNA damage (6Lindahl T. Karlstrom O. Biochemistry. 1973; 12: 5151-5154Crossref PubMed Scopus (168) Google Scholar, 7Lindahl T. Proc. Natl. Acad. Sci. U. S. A. 1974; 71: 3649-3653Crossref PubMed Scopus (473) Google Scholar, 8Lindahl T. Ljungquist S. Basic Life Sci. 1975; 5A: 31-38PubMed Google Scholar, 9Lindahl T. Prog. Nucleic Acids Res. Mol. Biol. 1979; 22: 135-192Crossref PubMed Scopus (436) Google Scholar, 10Greer S. Zamenhof S. J. Mol. Biol. 1962; 4: 123-141Crossref PubMed Scopus (102) Google Scholar). It has been estimated that a single-base lesion caused by hydrolytic depurination alone occurs at a frequency of 2 × 103-104 per human cell per day (3Lindahl T. Nature. 1993; 362: 709-715Crossref PubMed Scopus (4378) Google Scholar). Thus, DNA base modifications account for a large proportion of the total cellular DNA damage. To preserve genomic stability, mammalian cells have evolved a robust defense mechanism to repair these damaged bases. The repair of small single-base lesions is accomplished through base excision repair (BER) 1The abbreviations used are: BER, base excision repair; APE, AP endonuclease; dRP, deoxyribose phosphate; pol, polymerase; SN-BER, single-nucleotide base excision repair; LP-BER, long patch base excision repair; FEN1, flap endonuclease 1; PCNA, proliferating cell nuclear antigen; PARP-1, poly(ADP-ribose) polymerase-1; THF, tetrahydrofuran; nt, nucleotide(s); XRCC1, x-ray cross-complementing protein 1; TEMED, N,N,N′,N′-tetramethylethylenediamine. (11Lindahl T. Wood R.D. Science. 1999; 286: 1897-1905Crossref PubMed Scopus (1279) Google Scholar). BER is often initiated by a DNA glycosylase that cleaves the N-glycosydic bond of a damaged base, leaving an apurinic/apyrimidinic site, also referred to as an abasic site or AP site (3Lindahl T. Nature. 1993; 362: 709-715Crossref PubMed Scopus (4378) Google Scholar, 12Lindahl T. Annu. Rev. Biochem. 1982; 51: 61-87Crossref PubMed Scopus (696) Google Scholar). Subsequently, AP endonuclease (APE) cleaves the sugar-phosphate backbone at the 5′-side of the AP site resulting in 3′-hydroxyl and 5′-deoxyribose phosphate (dRP) groups at the margins of a one-nucleotide gap in DNA (13Doetsch P.W. Cunningham R.P. Mutat. Res. 1990; 236: 173-201Crossref PubMed Scopus (328) Google Scholar, 14Mosbaugh D.W. Bennett S.E. Prog. Nucleic Acids Res. Mol. Biol. 1994; 48: 315-370Crossref PubMed Scopus (98) Google Scholar). DNA polymerase β (pol β) inserts a nucleotide into the gap leaving nicked DNA with a 5′-dRP flap (15Srivastava D.K. Vande Berg B.J. Prasad R. Molina J.T. Beard W.A. Tomkinson A.E. Wilson S.H. J. Biol. Chem. 1998; 273: 21203-21209Abstract Full Text Full Text PDF PubMed Scopus (352) Google Scholar). At this point, the repair will be directed into different sub-pathways depending, at least in part, on whether or not the sugar residue in the flap (i.e. 5′-dRP) has been further modified (i.e. oxidized or reduced). With the unmodified dRP group, pol β removes the 5′-dRP group through its associated lyase activity (16Matsumoto Y. Kim K. Science. 1995; 269: 699-702Crossref PubMed Scopus (650) Google Scholar), resulting in nicked DNA that will be sealed by DNA ligase. This sub-pathway is designated as short-patch or single-nucleotide base excision repair (SN-BER). However, if the sugar group is oxidized or reduced and not removed by the pol β dRP lyase activity (16Matsumoto Y. Kim K. Science. 1995; 269: 699-702Crossref PubMed Scopus (650) Google Scholar, 17Dianov G. Price A. Lindahl T. Mol. Cell. Biol. 1992; 12: 1605-1612Crossref PubMed Scopus (265) Google Scholar, 18Matsumoto Y. Kim K. Bogenhagen D.F. Mol. Cell. Biol. 1994; 14: 6187-6197Crossref PubMed Scopus (262) Google Scholar), DNA ligase cannot seal the nick (15Srivastava D.K. Vande Berg B.J. Prasad R. Molina J.T. Beard W.A. Tomkinson A.E. Wilson S.H. J. Biol. Chem. 1998; 273: 21203-21209Abstract Full Text Full Text PDF PubMed Scopus (352) Google Scholar) and repair occurs through an alternate long patch base excision repair (LP-BER) sub-pathway, involving removal and replacement of several nucleotides (19Klungland A. Lindahl T. EMBO J. 1997; 16: 3341-3348Crossref PubMed Scopus (666) Google Scholar, 20Fortini P. Pascucci B. Parlanti E. Sobol R.W. Wilson S.H. Dogliotti E. Biochemistry. 1998; 37: 3575-3580Crossref PubMed Scopus (200) Google Scholar, 21Dianov G.L. Prasad R. Wilson S.H. Bohr V.A. J. Biol. Chem. 1999; 274: 13741-13743Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar, 22Dogliotti E. Fortini P. Pascucci B. Parlanti E. Prog. Nucleic Acids Res. Mol. Biol. 2001; 68: 4-25Google Scholar). It has been proposed that, in LP-BER, pol β performs strand displacement synthesis generating a flap that is then removed by another enzyme (19Klungland A. Lindahl T. EMBO J. 1997; 16: 3341-3348Crossref PubMed Scopus (666) Google Scholar, 22Dogliotti E. Fortini P. Pascucci B. Parlanti E. Prog. Nucleic Acids Res. Mol. Biol. 2001; 68: 4-25Google Scholar). Thus, pol β is considered a key player in both SN-BER and LP-BER (17Dianov G. Price A. Lindahl T. Mol. Cell. Biol. 1992; 12: 1605-1612Crossref PubMed Scopus (265) Google Scholar, 23Sobol R.W. Horton J.K. Kuhn R. Gu H. Singhal R.K. Prasad R. Rajewsky K. Wilson S.H. Nature. 1996; 379: 183-186Crossref PubMed Scopus (790) Google Scholar, 24Nealon K. Nicholl I.D. Kenny M.K. Nucleic Acids Res. 1996; 24: 3763-3770Crossref PubMed Scopus (59) Google Scholar, 25Horton J.K. Prasad R. Hou E. Wilson S.H. J. Biol. Chem. 2000; 275: 2211-2218Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). The LP-BER sub-pathway mechanism requires an additional enzyme to effectively remove the modified 5′-dRP-containing flap. This enzyme, flap endonuclease 1 (FEN1), has been characterized as a multifunctional endo/exonuclease that specifically recognizes and removes a DNA flap (26Harrington J.J. Lieber M.R. Genes Dev. 1994; 8: 1344-1355Crossref PubMed Scopus (256) Google Scholar, 27Murante R.S. Huang L. Turchi J.J. Bambara R.A. J. Biol. Chem. 1994; 269: 1191-1196Abstract Full Text PDF PubMed Google Scholar). FEN1 was initially identified as an essential enzyme involved in Okazaki fragment processing (28Bambara R.A. Murante R.S. Henricksen L.A. J. Biol. Chem. 1997; 272: 4647-4650Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar). Later, FEN1 was implicated in maintaining genomic stability (29Murray J.M. Tavassoli M. al-Harithy R. Sheldrick K.S. Lehmann A.R. Carr A.M. Watts F.Z. Mol. Cell. Biol. 1994; 14: 4878-4888Crossref PubMed Scopus (145) Google Scholar, 30Reagan M.S. Pittenger C. Siede W. Friedberg E.C. J. Bacteriol. 1995; 177: 364-371Crossref PubMed Google Scholar, 31Vallen E.A. Cross F.R. Mol. Cell. Biol. 1995; 15: 4291-4302Crossref PubMed Scopus (95) Google Scholar, 32Liu Y. Kao H-I. Bambara R.A. Annu. Rev. Biochem. 2004; 73: 589-615Crossref PubMed Scopus (306) Google Scholar). Both in vivo and in vitro studies have demonstrated that FEN1 plays a critical role in LP-BER by cleaving a DNA flap structure with damaged DNA (19Klungland A. Lindahl T. EMBO J. 1997; 16: 3341-3348Crossref PubMed Scopus (666) Google Scholar, 30Reagan M.S. Pittenger C. Siede W. Friedberg E.C. J. Bacteriol. 1995; 177: 364-371Crossref PubMed Google Scholar, 33Qiu J. Li X. Frank G. Shen B. J. Biol. Chem. 2001; 276: 4901-4908Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 34Shibata Y. Nakamura T. J. Biol. Chem. 2002; 277: 746-754Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 35DeMott M.S. Shen B. Park M.S. Bambara R.A. Zigman S. J. Biol. Chem. 1996; 271: 30068-30076Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 36Prasad R. Lavrik O.I. Kim S.J. Kedar P. Yang X.P. Vande Berg B.J. Wilson S.H. J. Biol. Chem. 2001; 276: 32411-32414Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). LP-BER may also involve replicative DNA polymerases pol δ and pol ϵ (20Fortini P. Pascucci B. Parlanti E. Sobol R.W. Wilson S.H. Dogliotti E. Biochemistry. 1998; 37: 3575-3580Crossref PubMed Scopus (200) Google Scholar, 37Memisoglu A. Samson L. Mutat. Res. 2000; 451: 39-51Crossref PubMed Scopus (239) Google Scholar, 38Sattler U. Frit P. Salles B. Calsou P. EMBO Rep. 2003; 4: 363-367Crossref PubMed Scopus (57) Google Scholar) as well as accessory proteins such as proliferating cell nuclear antigen (PCNA) (18Matsumoto Y. Kim K. Bogenhagen D.F. Mol. Cell. Biol. 1994; 14: 6187-6197Crossref PubMed Scopus (262) Google Scholar, 20Fortini P. Pascucci B. Parlanti E. Sobol R.W. Wilson S.H. Dogliotti E. Biochemistry. 1998; 37: 3575-3580Crossref PubMed Scopus (200) Google Scholar, 39Biade S. Sobol R.W. Wilson S.H. Matsumoto Y. J. Biol. Chem. 1998; 273: 898-902Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar) and poly(ADP-ribose) polymerase-1 (PARP-1) (36Prasad R. Lavrik O.I. Kim S.J. Kedar P. Yang X.P. Vande Berg B.J. Wilson S.H. J. Biol. Chem. 2001; 276: 32411-32414Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar, 40Dantzer F. de La Menissier-De Rubia G. Murcia J. Hostomsky Z. de Murcia G. Schreiber V. Biochemistry. 2000; 39: 7559-7569Crossref PubMed Scopus (410) Google Scholar). APE may also participate in LP-BER, because it can physically interact with pol β (41Bennett R.A. Wilson D.M. II I Wong D. Demple B. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7166-7169Crossref PubMed Scopus (327) Google Scholar, 42Wong D. Demple B. J. Biol. Chem. 2004; 279: 25268-25275Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar) and stimulate FEN1 endonuclease activity (43Dianova I. Bohr V.A. Dianov G.L. Biochemistry. 2001; 40: 12639-12644Crossref PubMed Scopus (136) Google Scholar, 44Ranalli T.A. Tom S. Bambara R.A. J. Biol. Chem. 2002; 277: 41715-41724Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). In addition, a BER protein complex that contains uracil-DNA-glycosylase, APE, pol β, DNA ligase I, PARP-1, and FEN1 has been identified through both affinity column chromatography and photoaffinity labeling (45Prasad R. Singhal R.K. Srivastava D.K. Molina J.T. Tomkinson A.E. Wilson S.H. J. Biol. Chem. 1996; 271: 16000-16007Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar, 46Lavrik O.I. Prasad R. Sobol R.W. Horton J.K. Ackerman E.J. Wilson S.H. J. Biol. Chem. 2001; 276: 25541-25548Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 47Cistulli C. Lavrik O.I. Prasad R. Hou E. Wilson S.H. DNA Repair (Amst.). 2004; 3: 581-591Crossref PubMed Scopus (79) Google Scholar), suggesting an interaction and cooperation among these proteins in LP-BER. Thus, it is expected that protein-protein interactions and cooperation could be important features of LP-BER. Depending on the involvement of PCNA, LP-BER has been further classified into a PCNA-dependent sub-pathway, where pol δ/ϵ is involved, and a PCNA-independent sub-pathway, where pol β is the only DNA polymerase that mediates LP-BER DNA synthesis (21Dianov G.L. Prasad R. Wilson S.H. Bohr V.A. J. Biol. Chem. 1999; 274: 13741-13743Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar, 22Dogliotti E. Fortini P. Pascucci B. Parlanti E. Prog. Nucleic Acids Res. Mol. Biol. 2001; 68: 4-25Google Scholar, 32Liu Y. Kao H-I. Bambara R.A. Annu. Rev. Biochem. 2004; 73: 589-615Crossref PubMed Scopus (306) Google Scholar, 48Prasad R. Dianov G.L. Bohr V.A. Wilson S.H. J. Biol. Chem. 2000; 275: 4460-4466Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). However, a recent study demonstrated that PCNA can also physically interact with pol β (49Kedar P.S. Kim S. Robertson A. Hou E. Prasad R. Horton J.K. Wilson S.H. J. Biol. Chem. 2002; 34: 31115-31123Abstract Full Text Full Text PDF Scopus (114) Google Scholar), raising the possibility that PCNA may have a role even in pol β-dependent LP-BER. Most studies are consistent with the idea that pol β contributes a majority of the DNA synthesis during LP-BER and that FEN1 is required for processing (i.e. cleavage) the DNA flap intermediate (19Klungland A. Lindahl T. EMBO J. 1997; 16: 3341-3348Crossref PubMed Scopus (666) Google Scholar, 32Liu Y. Kao H-I. Bambara R.A. Annu. Rev. Biochem. 2004; 73: 589-615Crossref PubMed Scopus (306) Google Scholar, 35DeMott M.S. Shen B. Park M.S. Bambara R.A. Zigman S. J. Biol. Chem. 1996; 271: 30068-30076Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 50Kim K. Biade S. Matsumoto Y. J. Biol. Chem. 1998; 273: 8842-8848Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar). Thus, pol β and FEN1 coordination may be an essential element of LP-BER. The substrate specificities of pol β and FEN1 could allow these enzymes to perform reactions in a sequential order during LP-BER. In one scenario, pol β has been proposed to independently displace the downstream DNA strand and create a flap for FEN1 cleavage (19Klungland A. Lindahl T. EMBO J. 1997; 16: 3341-3348Crossref PubMed Scopus (666) Google Scholar, 21Dianov G.L. Prasad R. Wilson S.H. Bohr V.A. J. Biol. Chem. 1999; 274: 13741-13743Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). A recent study found that FEN1 stimulated pol β-mediated DNA synthesis on a LP-BER substrate, and conversely, pol β stimulated FEN1 cleavage on a LP-BER flap substrate (48Prasad R. Dianov G.L. Bohr V.A. Wilson S.H. J. Biol. Chem. 2000; 275: 4460-4466Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). Interestingly, PARP-1 also stimulated pol β LP-BER DNA synthesis, but this stimulation required the presence of FEN1 (36Prasad R. Lavrik O.I. Kim S.J. Kedar P. Yang X.P. Vande Berg B.J. Wilson S.H. J. Biol. Chem. 2001; 276: 32411-32414Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar), suggesting that the stimulation of pol β activity by PARP-1 was somehow mediated through FEN1. Overall, these results indicate that pol β and FEN1 interact functionally. However, the mechanism by which these two enzymes collaborate to achieve efficient LP-BER is not known. Mechanistically, FEN1 could stimulate the substrate binding step and/or catalysis of pol β. Alternatively, FEN1 may remove intermediates that pose a block to pol β-mediated LP-BER DNA synthesis. Thus, in this study, we dissected the functional coordination between pol β and FEN1 on LP-BER substrates in vitro. We initially characterized pol β DNA synthesis on various LP-BER intermediates and found them to be poor substrates for pol β DNA synthesis. Accordingly these LP-BER intermediates would represent barriers to accomplish BER. pol β relied on FEN1 cleavage to remove the barriers and proceed with LP-BER DNA synthesis. A “Hit and Run” mechanism is proposed to describe how these enzymes coordinate their enzymatic activities to accomplish LP-BER. Specifically, alternating pol β gap filling and FEN1 gap generation results in an efficient “gap translation.” Materials—Oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA). Radionucleotides [γ-32P]ATP (7000 mCi/mmol) (MP Biomedicals, Irvine, CA) and [α-32P]ddATP (3000 mCi/mmol) and MicroSpin G-25 columns were purchased from Amersham Biosciences (GE Healthcare, Piscataway, NJ). Deoxynucleoside triphosphates were from Roche Diagnostics Corp. Optikinase and terminal deoxynucleotidyl transferase were from USB Corp. (Cleveland, OH). All other reagents were from Sigma-Aldrich. Protein Expression and Purification—Human pol β and FEN1 were expressed and purified as described previously (48Prasad R. Dianov G.L. Bohr V.A. Wilson S.H. J. Biol. Chem. 2000; 275: 4460-4466Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). The enzyme concentrations were determined from absorbance at 280 nm (51von Gill S.C. Hippel P.H. Anal. Biochem. 1989; 182: 319-326Crossref PubMed Scopus (5073) Google Scholar). The extinction coefficients used for pol β and FEN1 as calculated by Prot-Param were 21,170 m-1 cm-1 and 21,980 m-1 cm-1, respectively. Oligonucleotide Substrates—Oligonucleotides were designed to generate DNA substrates, including a single-nucleotide gap, a single-nucleotide gap with a 5′-tetrahydrofuran (THF) on the downstream oligonucleotide, a nicked DNA, and various lengths of downstream single-stranded flaps each with a 5′-THF residue in the context of nicked DNA. These substrates mimic various proposed SN- and LP-BER intermediates. The oligonucleotide sequences are given in Table I. Each substrate was constructed by annealing an upstream primer (U) and a down-stream oligonucleotide (D) to a 31-mer template (T). pol β DNA synthesis was measured by following extension of a 5′-labeled upstream primer. The upstream primer was 5′-radiolabeled with [γ-32P]ATP and Optikinase. The unincorporated [γ-32P]ATP was removed with a G-25 spin column. The substrates utilized for FEN1 cleavage and gel mobility shift assays were radiolabeled at either the 5′- or 3′-end of the downstream oligonucleotides with [γ-32P]ATP and Optikinase or with [α-32P]ddATP and terminal deoxynucleotidyl transferase. These radio-labeled oligonucleotides were then purified using 12 or 15% polyacrylamide, 7 m urea denaturing gel electrophoresis. A radiolabeled oligonucleotide (U or D) and a corresponding U or D oligonucleotide were annealed to a template at a molar ratio of 1.5:1.5:1, respectively, to generate gapped and nicked DNA or nicked DNA substrates with various length flaps (Table I).Table IOligonucleotide sequencesOligonucleotideLengthSequenceaUnannealed residues are in boldface, and “F” denotes THFntDownstream (D)bThe subscripts describe the annealed product. For example, Dgap is used to generate a one-nucleotide-gapped BER intermediate, whereas Dgap-THF generates a one-nucleotide gap with a 5′-THF residue in the gap. The other THF flap oligonucleotides generate nicked DNA with a 5′-single-stranded overhang of the indicated size Dgap155′–GTGCGGATCCGGTGC–3′ Dgap-THF155′–FGTGCGGATCCGGTGC–3′ Dnick165′–CGTGCGGATCCGGTGC–3′ DTHF flap165′–FCGTGCGGATCCGGTGC–3′ DTHF-1nt flap175′–FTCGTGCGGATCCGGTGC–3′ DTHF-3nt flap195′–FTTTCGTGCGGATCCGGTGC–3′ DTHF-5nt flap215′–FTTTTTCGTGCGGATCCGGTGC–3′ DTHF-15nt flap315′–FTTTTTTTTTTTTTTTCGTGCGGATCCGGTGC–3′Template (T) T313′–GACGTCGACTACGCGGCACGCCTAGGCCACG–5′Upstream (U) U155′–CTGCAGCTGATGCGC–3′a Unannealed residues are in boldface, and “F” denotes THFb The subscripts describe the annealed product. For example, Dgap is used to generate a one-nucleotide-gapped BER intermediate, whereas Dgap-THF generates a one-nucleotide gap with a 5′-THF residue in the gap. The other THF flap oligonucleotides generate nicked DNA with a 5′-single-stranded overhang of the indicated size Open table in a new tab Gel Mobility Shift Assay—The gel mobility shift assay was performed in the binding buffer containing 50 mm Tris-HCl, pH 7.5, 50 mm KCl, 0.1 mg/ml bovine serum albumin, 0.1% Nonidet P-40, and 5% glycerol. pol β was incubated with nicked-THF flap DNA or nicked DNA substrate in the presence or absence of FEN1 at 37 °C for 8 min. An aliquot of each reaction mixture (8 μl) was loaded onto a 1% agarose-1% polyacrylamide gel. The gel was prepared in 0.25× Tris borate-EDTA buffer by combining equal volumes of 2% acrylamide and 0.6% bisacrylamide with melted 2% agarose gel in a total volume of 80 ml. Ammonia persulfate (200 μl of 10%) and 20 μl of TEMED were then added into the gel mixture, which was then poured into a horizontal gel electrophoresis apparatus. The enzyme·DNA complex and unbounded DNA were then separated by electrophoresis in 0.25× Tris borate-EDTA buffer at 100 V for 1 h in the cold room (∼4 °C). Radioactive signals were detected with a PhosphorImager (Amersham Bioscience-GE Health) and quantified with ImageQuant version 1.2 software. The concentration of enzyme·DNA complex was calculated from the equation, C = [E] × Ib/(Ib + Iub), where C is the concentration of enzyme·DNA complex, [E] is the concentration of enzyme, Ib is the intensity of DNA·protein complex, and Iub is the intensity of free DNA. Apparent Kd was obtained by fitting the data to a quadratic equation, [pol β·DNA] = 0.5 × (pol β + Kd + DNA) - {[0.25 × (pol β + Kd + DNA)2] - (pol β× DNA)}1/2, where [pol β·DNA] is the concentration of pol β·DNA complex, pol β is the concentration of pol β, Kd is the apparent dissociation constant, and DNA is the concentration of DNA. Enzymatic Assays—pol β DNA synthesis was determined by measuring nucleotide insertion into a DNA substrate. The 5′-end of the upstream primer of these substrates was radiolabeled with [γ-32P]ATP, as described above. In all cases, the 5′-end of the downstream oligonucleotide was phosphorylated. The reaction was performed in buffer containing 50 mm Tris-HCl, pH 7.5, 50 mm KCl, 0.2 mm EDTA, and 0.1 mg/ml bovine serum albumin. pol β, as indicated, was incubated with 50 nm DNA substrate in the presence of 5 mm MgCl2 and 5 μm dCTP. The reaction mixture was assembled on ice, transferred to 37 °C, and incubated for 10 min. The FEN1 cleavage assay was performed under the same conditions except that the downstream oligonucleotides of the substrates were radiolabeled at the 3′-end. The substrates were separated from the products by 15 or 18% polyacrylamide, 7 m urea denaturing gels, and products were detected by a PhosphorImager and quantified by ImageQuant as described above. Measurement of kobs of pol β and FEN1—The apparent rate (kobs) of pol β nucleotide insertion with nicked-THF flap DNA and nicked DNA substrates in the absence and presence of FEN1 was measured by incubating 1 nm of each enzyme with 200 nm DNA in the same buffer as the one for pol β activity assay. The reaction was initiated with 5 mm MgCl2 and incubated at 37 °C. Aliquots (10 μl) were removed from the reaction mixture at various time intervals (0.5–5 min). The apparent rate of FEN1 cleavage on nicked-THF flap and nicked DNA substrates in the absence and presence of pol β was also measured. The substrates for measuring FEN1 cleavage were radiolabeled at the 5′-end of their downstream oligonucleotides. The slopes of the linear time courses were used to calculate the respective turnover numbers where kobs = Vobs/[E]total. FEN1 Stimulates Initiation of LP-BER—Previous studies had shown that FEN1 stimulated LP-BER DNA synthesis activity of pol β (36Prasad R. Lavrik O.I. Kim S.J. Kedar P. Yang X.P. Vande Berg B.J. Wilson S.H. J. Biol. Chem. 2001; 276: 32411-32414Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar, 48Prasad R. Dianov G.L. Bohr V.A. Wilson S.H. J. Biol. Chem. 2000; 275: 4460-4466Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar), thereby facilitating LP-BER. To explore the mechanism of this effect, we initially examined pol β DNA synthesis on a nicked-THF flap DNA substrate in the presence of FEN1. This substrate mimics the initial LP-BER transient intermediate, because the single-nucleotide gap has already been filled and the lyase activity of pol β will not remove the 5′-THF residue (16Matsumoto Y. Kim K. Science. 1995; 269: 699-702Crossref PubMed Scopus (650) Google Scholar, 17Dianov G. Price A. Lindahl T. Mol. Cell. Biol. 1992; 12: 1605-1612Crossref PubMed Scopus (265) Google Scholar, 18Matsumoto Y. Kim K. Bogenhagen D.F. Mol. Cell. Biol. 1994; 14: 6187-6197Crossref PubMed Scopus (262) Google Scholar). DNA synthesis was measured over an 8-min time interval (Fig. 1). pol β was incubated with the substrate in the presence of 5 μm dNTPs with or without FEN1. In the absence of FEN1, only a small amount (∼5%) of the nicked-THF flap substrate (50 nm) was extended by one nucleotide (Fig. 1, A (lanes 1–8) and B). Addition of FEN1 enhanced the amount of pol β DNA synthetic products by ∼5-fold (Fig. 1, A (lanes 9–15) and B), and this was predominantly in the form of a single-nucleotide insertion synthesis. LP-BER DNA Synthesis of pol β Is Poor on Nicked DNA Substrates—To further understand the influence of FEN1 on pol β LP-BER DNA synthesis, we examined pol β nucleotide insertion on substrates that resemble various LP-BER intermediates. These included a nicked DNA, a nicked-THF flap, a nicked-THF-1nt flap, a nicked-THF-3nt flap, a nicked-THF-5nt flap, and a nicked-THF-15nt flap (Table I and Fig. 2). pol β-mediated DNA synthesis was lowest on the nicked DNA and nicked-THF flap DNA substrates, as compared with the other substrates (Fig. 2). DNA synthesis on longer nicked-THF flaps was lower than that with single-nucleotide gapped and 1nt-gap-THF DNA substrates that mimic SN-BER intermediates (Fig. 2). This was most obvious at lower enzyme concentrations (0.1 and 0.5 nm) where substrate depletion had little influence on the rate of product formation (Fig. 2, compare lanes 10 and 11 with 2 and 3, and lanes 14 and 15 with 6 and 7, respectively). Use of a higher concentration of pol β with the various lengths of nicked-THF flap substrates converted most of the labeled substrates into extended products indicating that all these substrates were fully annealed (Fig. 2, and data not shown). Gel mobility shift assays showed that the binding of pol β onto the nicked and various nicked-THF flap substrates was significantly decreased compared with gapped DNA (data not shown). This indicated that the nicked structures may not support pol β binding, thereby, compromising pol β nucleotide insertion. Thus, the LP-BER intermediates representing nicked DNA appear to form a barrier to pol β DNA synthesis. Overall, our results demonstrate that pol β DNA synthesis on nicked-THF flap and nicked DNA is poor; therefore, the development of a nicked flap intermediate during LP-BER would be a rate-limiting step of LP-BER DNA synthesis. FEN1 Cleavage Activity Is Critical for Stimulating pol β LP-BER DNA Synthesis—Because the nicked-THF flap and nicked DNA are poor substrates for pol β DNA synthesis, they will delay progression of LP-BER. FEN1 could alleviate this block by removing a nucleotide at the nicks, stimulating pol β DNA synthesis, or by stabilizing the interaction between pol β and these DNA substrates allowing an effective pol β-mediated strand displacement synthesis or, alternatively, by destabilizing (i.e. melting) the d" @default.
• W1983271010 created "2016-06-24" @default.
• W1983271010 creator A5004213173 @default.
• W1983271010 creator A5025801107 @default.
• W1983271010 creator A5045523035 @default.
• W1983271010 creator A5046214153 @default.
• W1983271010 creator A5062571628 @default.
• W1983271010 creator A5089715804 @default.
• W1983271010 date "2005-02-01" @default.
• W1983271010 modified "2023-10-12" @default.
• W1983271010 title "DNA Polymerase β and Flap Endonuclease 1 Enzymatic Specificities Sustain DNA Synthesis for Long Patch Base Excision Repair" @default.
• W1983271010 cites W1377731 @default.
• W1983271010 cites W1409078517 @default.
• W1983271010 cites W1506492200 @default.
• W1983271010 cites W1545021361 @default.
• W1983271010 cites W1554627281 @default.
• W1983271010 cites W1566131689 @default.
• W1983271010 cites W1605349427 @default.
• W1983271010 cites W1860417382 @default.
• W1983271010 cites W1967209251 @default.
• W1983271010 cites W1967634425 @default.
• W1983271010 cites W1971602039 @default.
• W1983271010 cites W1973194906 @default.
• W1983271010 cites W1974585689 @default.
• W1983271010 cites W1977721810 @default.
• W1983271010 cites W1978124987 @default.
• W1983271010 cites W1983863777 @default.
• W1983271010 cites W1995390673 @default.
• W1983271010 cites W2000605935 @default.
• W1983271010 cites W2003329456 @default.
• W1983271010 cites W2005448675 @default.
• W1983271010 cites W2005986251 @default.
• W1983271010 cites W2010055022 @default.
• W1983271010 cites W2016134181 @default.
• W1983271010 cites W2021241545 @default.
• W1983271010 cites W2022547913 @default.
• W1983271010 cites W2023476869 @default.
• W1983271010 cites W2028513756 @default.
• W1983271010 cites W2035932182 @default.
• W1983271010 cites W2036103078 @default.
• W1983271010 cites W2042699531 @default.
• W1983271010 cites W2044064237 @default.
• W1983271010 cites W2045074917 @default.
• W1983271010 cites W2045255868 @default.
• W1983271010 cites W2046175921 @default.
• W1983271010 cites W2056166567 @default.
• W1983271010 cites W2057747091 @default.
• W1983271010 cites W2063894827 @default.
• W1983271010 cites W2064477710 @default.
• W1983271010 cites W2064538331 @default.
• W1983271010 cites W2066253067 @default.
• W1983271010 cites W2069926362 @default.
• W1983271010 cites W2076684390 @default.
• W1983271010 cites W2078424943 @default.
• W1983271010 cites W2085312575 @default.
• W1983271010 cites W2087917559 @default.
• W1983271010 cites W2093369849 @default.
• W1983271010 cites W2099529834 @default.
• W1983271010 cites W2099530293 @default.
• W1983271010 cites W2100626549 @default.
• W1983271010 cites W2110487265 @default.
• W1983271010 cites W2115250657 @default.
• W1983271010 cites W2118764522 @default.
• W1983271010 cites W2134259738 @default.
• W1983271010 cites W2134831636 @default.
• W1983271010 cites W2138489088 @default.
• W1983271010 cites W2142485616 @default.
• W1983271010 cites W2145238731 @default.
• W1983271010 cites W2148493751 @default.
• W1983271010 cites W2151966082 @default.
• W1983271010 cites W2156751055 @default.
• W1983271010 cites W999705638 @default.
• W1983271010 doi "https://doi.org/10.1074/jbc.m412922200" @default.
• W1983271010 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15561706" @default.
• W1983271010 hasPublicationYear "2005" @default.
• W1983271010 type Work @default.
• W1983271010 sameAs 1983271010 @default.
• W1983271010 citedByCount "135" @default.
• W1983271010 countsByYear W19832710102012 @default.
• W1983271010 countsByYear W19832710102013 @default.
• W1983271010 countsByYear W19832710102014 @default.
• W1983271010 countsByYear W19832710102015 @default.
• W1983271010 countsByYear W19832710102016 @default.
• W1983271010 countsByYear W19832710102017 @default.
• W1983271010 countsByYear W19832710102018 @default.
• W1983271010 countsByYear W19832710102019 @default.
• W1983271010 countsByYear W19832710102020 @default.
• W1983271010 countsByYear W19832710102021 @default.
• W1983271010 countsByYear W19832710102022 @default.
• W1983271010 countsByYear W19832710102023 @default.
• W1983271010 crossrefType "journal-article" @default.
• W1983271010 hasAuthorship W1983271010A5004213173 @default.
• W1983271010 hasAuthorship W1983271010A5025801107 @default.
• W1983271010 hasAuthorship W1983271010A5045523035 @default.
• W1983271010 hasAuthorship W1983271010A5046214153 @default.
• W1983271010 hasAuthorship W1983271010A5062571628 @default.
• W1983271010 hasAuthorship W1983271010A5089715804 @default.
• W1983271010 hasBestOaLocation W19832710101 @default.

• next