FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1983379891> ?p ?o ?g. }

• W1983379891 endingPage "403" @default.
• W1983379891 startingPage "395" @default.
• W1983379891 abstract "The molecular genetic analysis of the development of vertebrate and invertebrate model organisms has identified many developmental control genes which are highly conserved during evolution. An important role in the control of developmental decisions is executed by transcription factors, proteins which regulate the transcription of target genes, either as activators or repressors. In-vitro analyses have revealed that the protein product of the mouse Brachyury (T) gene, which is required in the differentiation of the notochord and the formation of posterior mesoderm, encodes a transcription factor with a novel DNA binding domain, the T domain. This unusually large DNA binding domain recognizes specifically the palindromic target sequence TTTCACACCTAGGTGTGAAA which was identified in an in-vitro binding site selection procedure. Upon binding to the palindromic target sequence, T protein activates transcription of a reporter gene. The DNA binding domain in the N-terminal half of the protein is physically separated from the domains in the C-terminal half which confer transcriptional modulation function. The T protein is the prototypical member of a growing class of molecules which share this conserved T domain." @default.
• W1983379891 created "2016-06-24" @default.
• W1983379891 creator A5075279504 @default.
• W1983379891 date "1995-12-01" @default.
• W1983379891 modified "2023-10-18" @default.
• W1983379891 title "The Brachyury protein: A T-domain transcription factor" @default.
• W1983379891 cites W103593936 @default.
• W1983379891 cites W115790361 @default.
• W1983379891 cites W1535621738 @default.
• W1983379891 cites W1815472980 @default.
• W1983379891 cites W1837658913 @default.
• W1983379891 cites W1963624673 @default.
• W1983379891 cites W1964795153 @default.
• W1983379891 cites W1975515226 @default.
• W1983379891 cites W1978944793 @default.
• W1983379891 cites W1985126857 @default.
• W1983379891 cites W1990938412 @default.
• W1983379891 cites W1998023087 @default.
• W1983379891 cites W1998576407 @default.
• W1983379891 cites W2002321922 @default.
• W1983379891 cites W2007675669 @default.
• W1983379891 cites W2013446898 @default.
• W1983379891 cites W2018793740 @default.
• W1983379891 cites W2022903413 @default.
• W1983379891 cites W2025853097 @default.
• W1983379891 cites W2032622148 @default.
• W1983379891 cites W2044918998 @default.
• W1983379891 cites W2045622916 @default.
• W1983379891 cites W2049648330 @default.
• W1983379891 cites W2049811286 @default.
• W1983379891 cites W2053702504 @default.
• W1983379891 cites W2053796273 @default.
• W1983379891 cites W2065788477 @default.
• W1983379891 cites W2071726755 @default.
• W1983379891 cites W2082843052 @default.
• W1983379891 cites W2084771679 @default.
• W1983379891 cites W2086725260 @default.
• W1983379891 cites W2090421407 @default.
• W1983379891 cites W2104065792 @default.
• W1983379891 cites W2111479560 @default.
• W1983379891 cites W2121460110 @default.
• W1983379891 cites W2122468638 @default.
• W1983379891 cites W2123942179 @default.
• W1983379891 cites W2125035801 @default.
• W1983379891 cites W2125068279 @default.
• W1983379891 cites W2128940002 @default.
• W1983379891 cites W2130646768 @default.
• W1983379891 cites W2132781864 @default.
• W1983379891 cites W2146966581 @default.
• W1983379891 cites W2148269439 @default.
• W1983379891 cites W2151181386 @default.
• W1983379891 cites W2166870017 @default.
• W1983379891 cites W2171181428 @default.
• W1983379891 cites W2345927070 @default.
• W1983379891 cites W2414647879 @default.
• W1983379891 cites W4248951783 @default.
• W1983379891 cites W75030932 @default.
• W1983379891 doi "https://doi.org/10.1016/s1044-5781(06)80003-4" @default.
• W1983379891 hasPublicationYear "1995" @default.
• W1983379891 type Work @default.
• W1983379891 sameAs 1983379891 @default.
• W1983379891 citedByCount "23" @default.
• W1983379891 countsByYear W19833798912012 @default.
• W1983379891 countsByYear W19833798912014 @default.
• W1983379891 countsByYear W19833798912015 @default.
• W1983379891 crossrefType "journal-article" @default.
• W1983379891 hasAuthorship W1983379891A5075279504 @default.
• W1983379891 hasConcept C101762097 @default.
• W1983379891 hasConcept C104317684 @default.
• W1983379891 hasConcept C111936080 @default.
• W1983379891 hasConcept C122465829 @default.
• W1983379891 hasConcept C145103041 @default.
• W1983379891 hasConcept C150194340 @default.
• W1983379891 hasConcept C158448853 @default.
• W1983379891 hasConcept C2780915607 @default.
• W1983379891 hasConcept C33987129 @default.
• W1983379891 hasConcept C46122727 @default.
• W1983379891 hasConcept C54355233 @default.
• W1983379891 hasConcept C68473852 @default.
• W1983379891 hasConcept C86339819 @default.
• W1983379891 hasConcept C86803240 @default.
• W1983379891 hasConcept C93501484 @default.
• W1983379891 hasConcept C95444343 @default.
• W1983379891 hasConceptScore W1983379891C101762097 @default.
• W1983379891 hasConceptScore W1983379891C104317684 @default.
• W1983379891 hasConceptScore W1983379891C111936080 @default.
• W1983379891 hasConceptScore W1983379891C122465829 @default.
• W1983379891 hasConceptScore W1983379891C145103041 @default.
• W1983379891 hasConceptScore W1983379891C150194340 @default.
• W1983379891 hasConceptScore W1983379891C158448853 @default.
• W1983379891 hasConceptScore W1983379891C2780915607 @default.
• W1983379891 hasConceptScore W1983379891C33987129 @default.
• W1983379891 hasConceptScore W1983379891C46122727 @default.
• W1983379891 hasConceptScore W1983379891C54355233 @default.
• W1983379891 hasConceptScore W1983379891C68473852 @default.
• W1983379891 hasConceptScore W1983379891C86339819 @default.
• W1983379891 hasConceptScore W1983379891C86803240 @default.
• W1983379891 hasConceptScore W1983379891C93501484 @default.

• next