FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1983392014> ?p ?o ?g. }

• W1983392014 endingPage "4276" @default.
• W1983392014 startingPage "4265" @default.
• W1983392014 abstract "Multisubunit RNA editing complexes catalyze uridylate insertion/deletion RNA editing directed by complementary guide RNAs (gRNAs). Editing in trypanosome mitochondria is transcript-specific and developmentally controlled, but the molecular mechanisms of substrate specificity remain unknown. Here we used a minimal A6 pre-mRNA/gRNA substrate to define functional determinants for full-round insertion and editing complex interactions at the editing site 2 (ES2). Editing begins with pre-mRNA cleavage within an internal loop flanked by upstream and downstream duplexes with gRNA. We found that substrate recognition around the internal loop is sequence-independent and that completely artificial duplexes spanning a single helical turn are functional. Furthermore, after our report of cross-linking interactions at the deletion ES1 (35.Sacharidou A. Cifuentes-Rojas C. Halbig K. Hernandez A. Dangott L.J. De Nova-Ocampo M. Cruz-Reyes J. RNA. 2006; 12: 1219-1228Crossref PubMed Scopus (12) Google Scholar), we show for the first time editing complex contacts at an insertion ES. Our studies using site-specific ribose 2′ substitutions defined 2′-hydroxyls within the (a) gRNA loop region and (b) flanking helixes that markedly stimulate both pre-mRNA cleavage and editing complex interactions at ES2. Modification of the downstream helix affected scissile bond specificity. Notably, a single 2′-hydroxyl at ES2 is essential for cleavage but dispensable for editing complex cross-linking. This study provides new insights on substrate recognition during full-round editing, including the relevance of secondary structure and the first functional association of specific (pre-mRNA and gRNA) riboses with both endonuclease cleavage and cross-linking activities of editing complexes at an ES. Importantly, most observed cross-linking interactions are both conserved and relatively stable at ES2 and ES1 in hybrid substrates. However, they were also detected as transient low-stability contacts in a non-edited transcript. Multisubunit RNA editing complexes catalyze uridylate insertion/deletion RNA editing directed by complementary guide RNAs (gRNAs). Editing in trypanosome mitochondria is transcript-specific and developmentally controlled, but the molecular mechanisms of substrate specificity remain unknown. Here we used a minimal A6 pre-mRNA/gRNA substrate to define functional determinants for full-round insertion and editing complex interactions at the editing site 2 (ES2). Editing begins with pre-mRNA cleavage within an internal loop flanked by upstream and downstream duplexes with gRNA. We found that substrate recognition around the internal loop is sequence-independent and that completely artificial duplexes spanning a single helical turn are functional. Furthermore, after our report of cross-linking interactions at the deletion ES1 (35.Sacharidou A. Cifuentes-Rojas C. Halbig K. Hernandez A. Dangott L.J. De Nova-Ocampo M. Cruz-Reyes J. RNA. 2006; 12: 1219-1228Crossref PubMed Scopus (12) Google Scholar), we show for the first time editing complex contacts at an insertion ES. Our studies using site-specific ribose 2′ substitutions defined 2′-hydroxyls within the (a) gRNA loop region and (b) flanking helixes that markedly stimulate both pre-mRNA cleavage and editing complex interactions at ES2. Modification of the downstream helix affected scissile bond specificity. Notably, a single 2′-hydroxyl at ES2 is essential for cleavage but dispensable for editing complex cross-linking. This study provides new insights on substrate recognition during full-round editing, including the relevance of secondary structure and the first functional association of specific (pre-mRNA and gRNA) riboses with both endonuclease cleavage and cross-linking activities of editing complexes at an ES. Importantly, most observed cross-linking interactions are both conserved and relatively stable at ES2 and ES1 in hybrid substrates. However, they were also detected as transient low-stability contacts in a non-edited transcript. The single-mitochondrion containing kinetoplastid protozoa, including species of Trypanosoma and Leishmania, use cycles of uridylate insertion or deletion at numerous editing sites (ESs) 4The abbreviations used are: ES, editing site; gRNA, guide RNA; nt, nucleotide(s); dsRNA, double-stranded RNA. within pre-mRNAs to generate mature mRNAs (for recent reviews, see Refs. 1.Stuart K.D. Schnaufer A. Ernst N.L. Panigrahi A.K. Trends Biochem. Sci. 2005; 30: 97-105Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar, 2.Simpson L. Aphasizhev R. Gao G. Kang X. RNA. 2004; 10: 159-170Crossref PubMed Scopus (115) Google Scholar, 3.Madison-Antenucci S. Grams J. Hajduk S.L. Cell. 2002; 108: 435-438Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). This post-transcriptional mRNA maturation is catalyzed by a multisubunit editing complex (4.Pollard V.W. Harris M.E. Hajduk S.L. EMBO J. 1992; 11: 4429-4438Crossref PubMed Scopus (131) Google Scholar, 5.Rusche L.N. Cruz-Reyes J. Piller K.J. Sollner-Webb B. EMBO J. 1997; 16: 4069-4081Crossref PubMed Scopus (143) Google Scholar, 6.Aphasizhev R. Aphasizheva I. Nelson R.E. Gao G. Simpson A.M. Kang X. Falick A.M. Sbicego S. Simpson L. EMBO J. 2003; 22: 913-924Crossref PubMed Scopus (120) Google Scholar, 7.Panigrahi A.K. Gygi S.P. Ernst N.L. Igo Jr., R.P. Palazzo S.S. Schnaufer A. Weston D.S. Carmean N. Salavati R. Aebersold R. Stuart K.D. Mol. Cell. Biol. 2001; 21: 380-389Crossref PubMed Scopus (112) Google Scholar, 8.Panigrahi A.K. Schnaufer A. Ernst N.L. Wang B. Carmean N. Salavati R. Stuart K. RNA. 2003; 9: 484-492Crossref PubMed Scopus (120) Google Scholar) with specificity for the ESs being directed by small transacting guide RNAs (gRNAs) that are partially complementary to pre-mRNA (9.Blum B. Bakalara N. Simpson L. Cell. 1990; 60: 189-198Abstract Full Text PDF PubMed Scopus (458) Google Scholar, 10.Kable M.L. Seiwert S.D. Heidmann S. Stuart K. Science. 1996; 273: 1189-1195Crossref PubMed Scopus (161) Google Scholar, 11.Leung S.S. Koslowsky D.J. Nucleic Acids Res. 1999; 27: 778-787Crossref PubMed Scopus (37) Google Scholar, 12.Koslowsky D.J. Reifur L. Yu L.E. Chen W. RNA Biol. 2004; 1: 28-34Crossref PubMed Scopus (22) Google Scholar). A significant body of information has been accumulated on the functional and structural composition of editing complexes, including the identity of the subunits catalyzing the three steps of each editing cycle; they are mRNA cleavage at deletion and insertion ESs (13.Trotter J.R. Ernst N.L. Carnes J. Panicucci B. Stuart K. Mol. Cell. 2005; 20: 403-412Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 14.Carnes J. Trotter J.R. Ernst N.L. Steinberg A. Stuart K. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 16614-16619Crossref PubMed Scopus (110) Google Scholar), U addition or U removal (15.Kang X. Rogers K. Gao G. Falick A.M. Zhou S. Simpson L. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1017-1022Crossref PubMed Scopus (53) Google Scholar, 16.Aphasizhev R. Sbicego S. Simpson L. RNA. 2003; 9: 265-276Crossref PubMed Scopus (93) Google Scholar, 17.Ernst N.L. Panicucci B. Igo Jr., R.P. Panigrahi A.K. Salavati R. Stuart K. Mol. Cell. 2003; 11: 1525-1536Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar), and RNA ligation at deletion and insertion ESs (18.Huang C.E. Cruz-Reyes J. Zhelonkina A.G. O’Hearn S. Wirtz E. Sollner-Webb B. EMBO J. 2001; 20: 4694-4703Crossref PubMed Scopus (70) Google Scholar, 19.Rusche L.N. Huang C.E. Piller K.J. Hemann M. Wirtz E. Sollner-Webb B. Mol. Cell. Biol. 2001; 21: 979-989Crossref PubMed Scopus (86) Google Scholar, 20.McManus M.T. Shimamura M. Grams J. Hajduk S.L. RNA. 2001; 7: 167-175Crossref PubMed Scopus (97) Google Scholar, 21.Schnaufer A. Panigrahi A.K. Panicucci B. Igo Jr., R.P. Wirtz E. Salavati R. Stuart K. Science. 2001; 291: 2159-2162Crossref PubMed Scopus (215) Google Scholar, 22.Cruz-Reyes J. Zhelonkina A.G. Huang C.E. Sollner-Webb B. Mol. Cell. Biol. 2002; 22: 4652-4660Crossref PubMed Scopus (63) Google Scholar, 23.Schnaufer A. Ernst N.L. Palazzo S.S. O’Rear J. Salavati R. Stuart K. Mol. Cell. 2003; 12: 307-319Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). The complexes are heterogeneous in protein composition but share most of the approximately 20 subunits identified (24.Panigrahi A.K. Ernst N.L. Domingo G.J. Fleck M. Salavati R. Stuart K.D. RNA. 2006; 12: 1038-1049Crossref PubMed Scopus (90) Google Scholar). Several factors are also known or proposed to play auxiliary roles in editing (8.Panigrahi A.K. Schnaufer A. Ernst N.L. Wang B. Carmean N. Salavati R. Stuart K. RNA. 2003; 9: 484-492Crossref PubMed Scopus (120) Google Scholar, 25.Muller U.F. Lambert L. Goringer H.U. EMBO J. 2001; 20: 1394-1404Crossref PubMed Scopus (78) Google Scholar, 26.Blom D. Burg J. Breek C.K. Speijer D. Muijsers A.O. Benne R. Nucleic Acids Res. 2001; 29: 2950-2962Crossref PubMed Scopus (47) Google Scholar, 27.Aphasizhev R. Aphasizheva I. Nelson R.E. Simpson L. RNA. 2003; 9: 62-76Crossref PubMed Scopus (93) Google Scholar, 28.Vondruskova E. van den Burg J. Zikova A. Ernst N.L. Stuart K. Benne R. Lukes J. J. Biol. Chem. 2005; 280: 2429-2438Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar, 29.Pelletier M. Read L.K. RNA. 2003; 9: 457-468Crossref PubMed Scopus (73) Google Scholar, 30.Missel A. Souza A.E. Norskau G. Goringer H.U. Mol. Cell. Biol. 1997; 17: 4895-4903Crossref PubMed Scopus (96) Google Scholar, 31.Madison-Antenucci S. Sabatini R.S. Pollard V.W. Hajduk S.L. EMBO J. 1998; 17: 6368-6376Crossref PubMed Scopus (73) Google Scholar, 32.Vanhamme L. Perez-Morga D. Marchal C. Speijer D. Lambert L. Geuskens M. Alexandre S. Ismaili N. Goringer U. Benne R. Pays E. J. Biol. Chem. 1998; 273: 21825-21833Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 33.Miller M.M. Halbig K. Cruz-Reyes J. Read L.K. RNA. 2006; 12: 1292-1303Crossref PubMed Scopus (30) Google Scholar), although they are dispensable in vitro (5.Rusche L.N. Cruz-Reyes J. Piller K.J. Sollner-Webb B. EMBO J. 1997; 16: 4069-4081Crossref PubMed Scopus (143) Google Scholar, 6.Aphasizhev R. Aphasizheva I. Nelson R.E. Gao G. Simpson A.M. Kang X. Falick A.M. Sbicego S. Simpson L. EMBO J. 2003; 22: 913-924Crossref PubMed Scopus (120) Google Scholar, 8.Panigrahi A.K. Schnaufer A. Ernst N.L. Wang B. Carmean N. Salavati R. Stuart K. RNA. 2003; 9: 484-492Crossref PubMed Scopus (120) Google Scholar, 34.Allen T.E. Heidmann S. Reed R. Myler P.J. Goringer H.U. Stuart K.D. Mol. Cell. Biol. 1998; 18: 6014-6022Crossref PubMed Scopus (53) Google Scholar). Much less is known about the mechanisms of substrate recognition including the protein subunits and substrate determinants that distinguish pre-edited (pre-) mRNAs from other transcripts and DNA in mitochondria. We recently reported the first observations of direct editing complex interactions with a functional site for full-round U deletion, showed preferential association with the editing substrate, and provided evidence for one of the interacting subunits corresponding to KREPA2 (Ref. 35.Sacharidou A. Cifuentes-Rojas C. Halbig K. Hernandez A. Dangott L.J. De Nova-Ocampo M. Cruz-Reyes J. RNA. 2006; 12: 1219-1228Crossref PubMed Scopus (12) Google Scholar). However, editing complex interactions at insertion sites have not been reported. Other recent reports showed that bacterially expressed recombinant versions of the subunits KREPA3 and KREPA4 bind RNA (36.Brecht M. Niemann M. Schluter E. Muller U.F. Stuart K. Goringer H.U. Mol. Cell. 2005; 17: 621-630Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 37.Salavati R. Ernst N.L. O’Rear J. Gilliam T. Tarun Jr., S. Stuart K. RNA. 2006; 12: 819-831Crossref PubMed Scopus (43) Google Scholar). The latter exhibited specificity for a gRNA 3′ oligo(U) tail. In pre-mRNA/gRNA substrates, unpaired pre-mRNA uridylates or unpaired gRNA purines are landmarks of deletion or insertion sites, respectively (9.Blum B. Bakalara N. Simpson L. Cell. 1990; 60: 189-198Abstract Full Text PDF PubMed Scopus (458) Google Scholar), and the number of such residues dictates the extent of U removal or addition (9.Blum B. Bakalara N. Simpson L. Cell. 1990; 60: 189-198Abstract Full Text PDF PubMed Scopus (458) Google Scholar, 10.Kable M.L. Seiwert S.D. Heidmann S. Stuart K. Science. 1996; 273: 1189-1195Crossref PubMed Scopus (161) Google Scholar, 38.Seiwert S.D. Stuart K. Science. 1994; 266: 114-117Crossref PubMed Scopus (128) Google Scholar). The two kinds of editing are likely to be differentially regulated as they involve separate activities and enzymes (13.Trotter J.R. Ernst N.L. Carnes J. Panicucci B. Stuart K. Mol. Cell. 2005; 20: 403-412Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 14.Carnes J. Trotter J.R. Ernst N.L. Steinberg A. Stuart K. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 16614-16619Crossref PubMed Scopus (110) Google Scholar, 18.Huang C.E. Cruz-Reyes J. Zhelonkina A.G. O’Hearn S. Wirtz E. Sollner-Webb B. EMBO J. 2001; 20: 4694-4703Crossref PubMed Scopus (70) Google Scholar, 22.Cruz-Reyes J. Zhelonkina A.G. Huang C.E. Sollner-Webb B. Mol. Cell. Biol. 2002; 22: 4652-4660Crossref PubMed Scopus (63) Google Scholar, 39.Cruz-Reyes J. Rusche L.N. Piller K.J. Sollner-Webb B. Mol. Cell. 1998; 1: 401-409Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 40.Cruz-Reyes J. Rusche L.N. Sollner-Webb B. Nucleic Acids Res. 1998; 26: 3634-3639Crossref PubMed Scopus (36) Google Scholar), and there is evidence for their physical separation in heterogeneous complexes and subcomplexes (23.Schnaufer A. Ernst N.L. Palazzo S.S. O’Rear J. Salavati R. Stuart K. Mol. Cell. 2003; 12: 307-319Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 24.Panigrahi A.K. Ernst N.L. Domingo G.J. Fleck M. Salavati R. Stuart K.D. RNA. 2006; 12: 1038-1049Crossref PubMed Scopus (90) Google Scholar). Interestingly, efficient deletion and insertion editing have distinct requirements for a proposed pre-mRNA/gRNA ligation bridge (42.Cruz-Reyes J. Zhelonkina A. Rusche L. Sollner-Webb B. Mol. Cell. Biol. 2001; 21: 884-892Crossref PubMed Scopus (62) Google Scholar, 43.Igo Jr., R.P. Lawson S.D. Stuart K. Mol. Cell. Biol. 2002; 22: 1567-1576Crossref PubMed Scopus (36) Google Scholar), and artificially interconverted sites use differing pre-mRNA lengths (41.Cifuentes-Rojas C. Halbig K. Sacharidou A. De Nova-Ocampo M. Cruz-Reyes J. Nucleic Acids Res. 2005; 33: 6610-6620Crossref PubMed Scopus (13) Google Scholar). The above observations suggest that the editing complex recognitions in and near an ES may also differ between the two editing types. Our interconversion of functional ESs from deletion to insertion and vice versa experimentally demonstrated that the basic determinants that commit editing complexes into full-cycle deletion or insertion reside within the internal loop containing the targeted ES (41.Cifuentes-Rojas C. Halbig K. Sacharidou A. De Nova-Ocampo M. Cruz-Reyes J. Nucleic Acids Res. 2005; 33: 6610-6620Crossref PubMed Scopus (13) Google Scholar). However, additional features proximal and/or distal to an ES may modulate the efficiency of editosome assembly and catalysis. For example, discrete sequence changes affecting the pairing potential of residues adjoining an ES can significantly impact the specificity and efficacy of full-round and partial (“pre-cleaved”) editing (43.Igo Jr., R.P. Lawson S.D. Stuart K. Mol. Cell. Biol. 2002; 22: 1567-1576Crossref PubMed Scopus (36) Google Scholar, 44.Lawson S.D. Igo Jr., R.P. Salavati R. Stuart K.D. RNA. 2001; 7: 1793-1802Crossref PubMed Scopus (14) Google Scholar). The current model of trypanosome RNA editing postulates that natural sites should be flanked by a proximal upstream duplex between a purine-rich pre-mRNA sequence and a gRNA 3′ poly-U tail (9.Blum B. Bakalara N. Simpson L. Cell. 1990; 60: 189-198Abstract Full Text PDF PubMed Scopus (458) Google Scholar, 10.Kable M.L. Seiwert S.D. Heidmann S. Stuart K. Science. 1996; 273: 1189-1195Crossref PubMed Scopus (161) Google Scholar, 11.Leung S.S. Koslowsky D.J. Nucleic Acids Res. 1999; 27: 778-787Crossref PubMed Scopus (37) Google Scholar, 12.Koslowsky D.J. Reifur L. Yu L.E. Chen W. RNA Biol. 2004; 1: 28-34Crossref PubMed Scopus (22) Google Scholar) and an adjacent pre-mRNA/gRNA downstream “anchor” duplex that directs cleavage (9.Blum B. Bakalara N. Simpson L. Cell. 1990; 60: 189-198Abstract Full Text PDF PubMed Scopus (458) Google Scholar, 10.Kable M.L. Seiwert S.D. Heidmann S. Stuart K. Science. 1996; 273: 1189-1195Crossref PubMed Scopus (161) Google Scholar, 45.Seiwert S.D. Heidmann S. Stuart K. Cell. 1996; 84: 831-841Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 46.Cruz-Reyes J. Sollner-Webb B. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8901-8906Crossref PubMed Scopus (95) Google Scholar). Mutational analysis of the gRNA 3′ region that stabilizes the upstream duplex can significantly enhance full-round editing in vitro (42.Cruz-Reyes J. Zhelonkina A. Rusche L. Sollner-Webb B. Mol. Cell. Biol. 2001; 21: 884-892Crossref PubMed Scopus (62) Google Scholar, 47.Igo Jr., R.P. Palazzo S.S. Burgess M.L. Panigrahi A.K. Stuart K. Mol. Cell. Biol. 2000; 20: 8447-8457Crossref PubMed Scopus (93) Google Scholar). In Leishmania tarentolae, an upstream duplex was used in model U-insertion substrates by one group (48.Kapushoc S.T. Simpson L. RNA. 1999; 5: 656-669Crossref PubMed Scopus (24) Google Scholar, 49.Kabb A.L. Oppegard L.M. McKenzie B.A. Connell G.J. Nucleic Acids Res. 2001; 29: 2575-2580Crossref PubMed Scopus (9) Google Scholar) but was not essential according to another (50.Pai R.D. Oppegard L.M. Connell G.J. RNA. 2003; 9: 469-483Crossref PubMed Scopus (11) Google Scholar). The latter group proposed that pre-mRNA purine sequences have a role in editing that is independent of base-pairing with gRNA (48.Kapushoc S.T. Simpson L. RNA. 1999; 5: 656-669Crossref PubMed Scopus (24) Google Scholar, 49.Kabb A.L. Oppegard L.M. McKenzie B.A. Connell G.J. Nucleic Acids Res. 2001; 29: 2575-2580Crossref PubMed Scopus (9) Google Scholar). In a CYb pre-mRNA substrate, a 34-nt A/U element appeared to modulate gRNA-directed and gRNA-independent insertion (51.Oppegard L.M. Kabb A.L. Connell G.J. J. Biol. Chem. 2000; 275: 33911-33919Abstract Full Text Full Text PDF PubMed Scopus (9) Google Scholar), and a discrete 5′ determinant near an editing site in a ND7 substrate was proposed (49.Kabb A.L. Oppegard L.M. McKenzie B.A. Connell G.J. Nucleic Acids Res. 2001; 29: 2575-2580Crossref PubMed Scopus (9) Google Scholar, 50.Pai R.D. Oppegard L.M. Connell G.J. RNA. 2003; 9: 469-483Crossref PubMed Scopus (11) Google Scholar). In Trypanosoma brucei, the three model systems that currently recreate a full-round editing in vitro, A6, CYb, and RPS12 (10.Kable M.L. Seiwert S.D. Heidmann S. Stuart K. Science. 1996; 273: 1189-1195Crossref PubMed Scopus (161) Google Scholar, 38.Seiwert S.D. Stuart K. Science. 1994; 266: 114-117Crossref PubMed Scopus (128) Google Scholar, 41.Cifuentes-Rojas C. Halbig K. Sacharidou A. De Nova-Ocampo M. Cruz-Reyes J. Nucleic Acids Res. 2005; 33: 6610-6620Crossref PubMed Scopus (13) Google Scholar, 43.Igo Jr., R.P. Lawson S.D. Stuart K. Mol. Cell. Biol. 2002; 22: 1567-1576Crossref PubMed Scopus (36) Google Scholar, 52.Igo Jr., R.P. Weston D.S. Ernst N.L. Panigrahi A.K. Salavati R. Stuart K. Eukaryot. Cell. 2002; 1: 112-118Crossref PubMed Scopus (65) Google Scholar), are based on natural purine-rich pre-mRNA fragments. We showed in A6 constructs that natural pre-mRNA extensions protruding from the upstream and downstream duplexes could be replaced by unnatural stretches without significant effects on editing. In one such construct, about half of a 5′ polypurine run proposed to stimulate editing in vitro (10.Kable M.L. Seiwert S.D. Heidmann S. Stuart K. Science. 1996; 273: 1189-1195Crossref PubMed Scopus (161) Google Scholar) was substituted by pyrimidines (41.Cifuentes-Rojas C. Halbig K. Sacharidou A. De Nova-Ocampo M. Cruz-Reyes J. Nucleic Acids Res. 2005; 33: 6610-6620Crossref PubMed Scopus (13) Google Scholar). However, whether or not a specific pre-mRNA (or gRNA) sequence or its natural base composition modulates editing remains unclear. Previous structural studies in solutions of different natural-like mRNA/gRNA pairs have proposed that a common secondary structure may be important for editing complex recognition (53.Yu L.E. Koslowsky D.J. RNA. 2006; 12: 1050-1060Crossref PubMed Scopus (14) Google Scholar), but this has not been tested in functional in vitro systems. Here we performed systematic sequence mutagenesis and ribose 2′-deoxynucleoside substitutions of a minimal A6 pre-mRNA/gRNA substrate to define functional determinants for both full-round U insertion and editing complex interactions at the targeted ES2. Our competition analyses of editing and RNA-protein interactions showed evidence of preferential association of editing complexes with the hybrid substrate. We observed that the requirement for the duplexes flanking the internal loop is sequence-independent, and artificial helices spanning a single turn support efficient editing. We also found that specific ribose 2′-hydroxyls in both strands of the downstream helix and, surprisingly, in the gRNA loop region strongly stimulate both pre-mRNA cleavage and editing complex interactions at the targeted insertion site. Moreover, 2′ deoxy substitution of the downstream helix affected scissile bond selectivity, whereas the tested modifications in either pre-mRNA or gRNA strand had relatively moderate effects. Notably, the 2′-hydroxyl moiety adjoining the scissile bond is an essential determinant of insertion, potentially involved in cleavage catalysis. The current studies of trypanosome full-round insertion editing provide significant insights on the relevance of the substrate secondary structure rather than its specific sequence and suggest that specific pre-mRNA and gRNA riboses significantly affect both pre-mRNA cleavage and editing complex interactions at the targeted bond. The starting substrate in these studies was the minimized ATPase 6 (A6) 45-nt pre-mRNA (41.Cifuentes-Rojas C. Halbig K. Sacharidou A. De Nova-Ocampo M. Cruz-Reyes J. Nucleic Acids Res. 2005; 33: 6610-6620Crossref PubMed Scopus (13) Google Scholar) paired with a variant of the enhanced gRNA gA6[14]USD-3A (47.Igo Jr., R.P. Palazzo S.S. Burgess M.L. Panigrahi A.K. Stuart K. Mol. Cell. Biol. 2000; 20: 8447-8457Crossref PubMed Scopus (93) Google Scholar). This substrate directs full-round insertion of 3Us at ES2 and uses pre-edited ES1 to increase the stability of the downstream duplex. RNAs were transcribed from a DNA template as described by Milligan et al. (54.Milligan J.F. Groebe D.R. Witherell G.W. Uhlenbeck O.C. Nucleic Acids Res. 1987; 15: 8783-8798Crossref PubMed Scopus (1891) Google Scholar), gel-purified, and quantified using an ND-1000 spectrophotometer (NanoDrop®). The DNA templates below are 3′-extended with the T7 promoter complementary strand TATAGTGAGTCGTATTA. The number of the RNA pair using the transcript product is in brackets (see Fig. 1; #, operational number). Pre-mRNAs−[2] CTTTCCCTTTCTTCTCTCCTCCCCCTCCTTTCCCTATAACTCCAAAATCAGTACATACGCATACATC, #309; [3] CTTTCCCTTTCTTCTCTCCTCCCCCTCCTTTCCCTATAACTCCAAAATCAGTACATACGCGCCC, #352; [4] CTTTCCCTTTCTTCTCTCCTCCCCCTCCTTTCCCTATAACTCCAAAATCAGTACATCGCGCCC, #356; [5] CTCCCCCTCCTTTCCCTATAACTCCAAAATCAGTACATCGCGCCC, #445; [6] CTATAACTCCAAAATCAGTACATCGCGCCCTTCCTCCTCCTTTCC, #447; [7] CTATAACTCCAAAATCAGTACATCGCGCCCTTAAAGAAAGAGCCC, #465; [8] CTTGACTCCAAAATCAGTACATCGCGCCCTTCCTCCTCCTTTCC, #463; [9] CTGACTCCAAAATCAGTACATCGCGCCCTTCCTCCTCCTTTCC, #464; [10] CCACACTCACATCAGTACATCGCGCCCTTCCTCCTCCTTTCCC, #556; [11] CCACATCACATCAGTACATCGCGCCCTTCCTCCTCCCTTTCCC, #561; [12] GGACATCACATCAGTACATCGCGCCCTTCCTCCTCCCTTTCCC, #563. gRNAs−[2] AATGTATGCGTATACTTCGTTTATCTCGGAGTTATAGTATATCC, #307; [3] GGGCGCGTATACTTCGTTTATCTCGGAGTTATAGTATATCC, #349; [4] GGGCGCGATACTTCGTTTATCTCGGAGTTATAGTATATCC, #350; [8] GGGCGCGATACTTCGTTTATCTCGGAGTCTAGTATATCC, #467; [9] GGGCGCGATACTTCGTTTATCTCGGAGTCAGTATATCC, #468; [10] GGGCGCGATACTTCGTTTATGTGAGTGTGGTATATCC, #557; [11] GGGCGCGATACTTCGTTTATGTGATGTGGTATATCC, #568; [12] GGGCGCGATACTTCGTTTATGTGATGTCC, #569. Deoxynucleoside-substituted transcripts were made by (IDT, Inc.), and 2′-F and 2′-OCH3 modified transcripts were by (Dharmacon, Boulder, Co). Ribonucleotides are denoted by the prefix “r”. Pre-mRNA Strand−[13] GGGGGAGGAGArGrArArGrArArArGrGrGrArArArGrUrArCrUrGrArUrUrUrUrGrGrArGrUrUrArUrArG, #403; [14] rGrGrGrGrGrArGrGrArGrAGAAGAAAGGGArArArGrUrArCrUrGrArUrUrUrUrGrGrArGrUrUrArUrArG, #404; [15] rGrGrGrGrGrArGrGrArGrArGrArArGrArArArGrGrGrArArArGrUrArCrUGrArUrUrUrUrGrGrArGrUrUrArUrArG, #405; [16] rGrGrGrGrGrArGrGrArGrArGrArArGrArArArGrGrGrArArArGrUrArCrUmGrArUrUrUrUrGrGrArGrUrUrArUrArG, #456; [17] rGrGrGrGrGrArGrGrArGrArGrArArGrArArArGrGrGrArArArGrUrArCrUfGrArUrUrUrUrGrGrArGrUrUrArUrArG, #519; [18] rGrGrGrGrGrArGrGrArGrArGrArArGrArArArGrGrGrArArArGrUrArCrUrGrArUrUrUrUGGAGTTATAGrA, #429; [19] rGrGrGrGrGrArGrGrArGrArGrArArGrArArArGrGrGrArArArGrUrArCrUrGrATTTTGGAGTTATAGrA, #441; [20] rGrGrGrGrGrArGrGrArGrArGrArArGrArArArGrGrGrArArArGrUrArCrUrGATTTTGGAGTTATAGrA, #451; [21] GrGrGrGrGrArGrGrArGrArGrArArGrArArArGrGrGrArArArGrUrArCrUrGArUrUrUrUrGrGrArGrUrUrArUrArG, #430; [26] rGrGrGrGrGrArGrGrArGrArGrArArGrArArArGrGrGrArArArGrUACTrGrArUrUrUrUrGrGrArGrUrUrArUrArG, #565. gRNA Strand−[22, 23] rGrGrArUrArUrArCrUrArUrArArCrUrCrCrGrArGrArUrArArArCrGrArArGrUrUrUTCCCTTTCTTrU, #485; [24, 25] rGrGrArUrArUrACTATAACTCCrGrArGrArUrArArArCrGrArArGrUrUrUrUrCrCrCrUrUrUrCrUrUrU, #487; [26, 28] rGrGrArUrArUrArCrUrArUrArArCrUrCrCrGrArGrArUAAACGAArGrUrUrUrUrCrCrCrUrUrUrCrUrUrU, #486. Photoreactive Substrates−Each pre-mRNA was obtained by ligation of two pieces (55.Moore M.J. Sharp P.A. Science. 1992; 256: 992-997Crossref PubMed Scopus (406) Google Scholar). All thiolated RNA pairs numbers are indicated by a colon. Acceptor pieces: [15′]rGrGrGrGrGrArGrGrArGrArGrArArGrArArArGrrGrArArArGrUrArCrUG, #424; [23′]5′rGrGrGrGrGrArGrGrArGrAGAAGAAAGGGArArArGrUrArCrUrG, #524′; [27′,28′] rGrGrGrGrGrArGrGrArGrArGrArArGrArArArGrGrGrArArArGrUACTrG, #560; the common donor piece (4-ThioU)rArUrUrUrUrGrGrArGrUrUrArUrArG, #401. For Pair-25′ the donor piece was (4-ThioU)rArUrUrUrUGGAGTTATAGArA, #567). The acceptor pieces were synthesized by IDT®, and the thiolated donors were synthesized by Dharmacon®. The donor pieces were radiolabeled to high specific activity with T4 polynucleotide kinase and [γ-32P]ATP (MPBiomedicals) using a 1:2 molar ratio of ends:ATP, gel-purified, and ligated to the acceptor piece as described (35.Sacharidou A. Cifuentes-Rojas C. Halbig K. Hernandez A. Dangott L.J. De Nova-Ocampo M. Cruz-Reyes J. RNA. 2006; 12: 1219-1228Crossref PubMed Scopus (12) Google Scholar) using as the bridge CTATAACTCCAAAATACAGTACTTTCCCTTTC, #553. The molar ratio of acceptor/donor/bridge was 2:1:1.5. Procyclic T. brucei strain TREU667 was grown in Cunningham media, and mitochondrial extracts were prepared as described (56.Harris M.E. Hajduk S.L. Cell. 1992; 68: 1091-1099Abstract Full Text PDF PubMed Scopus (61) Google Scholar). Editing complexes were enriched by Q-Sepharose ion exchange chromatography and further purified by DNA-cellulose affinity chromatography as reported (5.Rusche L.N. Cruz-Reyes J. Piller K.J. Sollner-Webb B. EMBO J. 1997; 16: 4069-4081Crossref PubMed Scopus (143) Google Scholar, 35.Sacharidou A. Cifuentes-Rojas C. Halbig K. Hernandez A. Dangott L.J. De Nova-Ocampo M. Cruz-Reyes J. RNA. 2006; 12: 1219-1228Crossref PubMed Scopus (12) Google Scholar). Additional enrichment can be achieved by using another step of Q-Sepharose; however, both editing and cross-linking activities were equivalent in the minimal substrate for full-round insertion (41.Cifuentes-Rojas C. Halbig K. Sacharidou A. De Nova-Ocampo M. Cruz-Reyes J. Nucleic Acids Res. 2005; 33: 6610-6620Crossref PubMed Scopus (13) Google Scholar) by complexes from the two-step and three-step purifications (see Fig. 7 and data not shown). Fractions with the peak of editing activity were used for all the experiments. Full-round U insertion was performed as described (39.Cruz-Reyes J. Rusche L.N. Piller K.J. Sollner-Webb B. Mol. Cell. 1998; 1: 401-409Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Briefly, a 2-μl mixture with pre-annealed 3′-end-labeled pre-mRNA (∼10 fmol) and gRNA (1.2 pmol) was completed to 20 μl with 10 mm MRB buffer (10 mm magnesium acetate, 10 mm KCl, 1 mm EDTA, pH 8, 25 mm Tris-HCl, pH 8, and 5% glycerol), 150 μm UTP, 3 μm ATP, and 2 μl of peak editing fraction. The reaction was incubated at 26 °C for 60 min, deproteinized, and resolved in 9% acrylamide, 7 m urea gels. Editing complexes were pretreated with 10 mm PPi to score total cleavage in absence of RNA ligase activity (22.Cruz-Reyes J. Zhelonkina A.G. Huang C.E. Sollner-Webb B. Mol. Cell. Biol. 2002; 22: 4652-4660Crossref PubMed Scopus (63) Google Scholar). Neither ATP nor UTP were added to this assay, and the cleavage products were resolved in 15% PAGE with 7 m urea. Ribonuclease T1 and hydroxyl ladders were used to confirm the cleavage at ES2 (not shown). All pre-mRNAs for editing were 3′-end-radiolabeled with [32P]cytidine 3′,5′-diphosphate except for the 2′-F-modified transcript (Pair-17), which had to be made with a 3′-terminal deoxynucleoside (Dharmacon). Such a terminus prevents radiolabeling with T4 RNA ligase (57.Nandakumar J. Shuman S. Mol. Cell. 2004; 16: 211-221Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar), so this transcript was 5′-end-labeled with T4 polynucleotide kinase. Data were visualized by phosphorimaging and/or x-ray autoradiography, and quantitation was performed using a STORM PhosphorImager (ImageQuant 5.0, GE Healthcare). Each panel in the figures corresponds to one of two repli" @default.
• W1983392014 created "2016-06-24" @default.
• W1983392014 creator A5035080166 @default.
• W1983392014 creator A5038466467 @default.
• W1983392014 creator A5052701065 @default.
• W1983392014 creator A5055625883 @default.
• W1983392014 creator A5067936254 @default.
• W1983392014 creator A5073745132 @default.
• W1983392014 date "2007-02-01" @default.
• W1983392014 modified "2023-10-13" @default.
• W1983392014 title "Substrate Determinants for RNA Editing and Editing Complex Interactions at a Site for Full-round U Insertion" @default.
• W1983392014 cites W1974747849 @default.
• W1983392014 cites W1975647360 @default.
• W1983392014 cites W1977764715 @default.
• W1983392014 cites W1987671305 @default.
• W1983392014 cites W1988503886 @default.
• W1983392014 cites W1990269628 @default.
• W1983392014 cites W1990591051 @default.
• W1983392014 cites W1991631460 @default.
• W1983392014 cites W1993742413 @default.
• W1983392014 cites W2000750967 @default.
• W1983392014 cites W2001351981 @default.
• W1983392014 cites W2003024383 @default.
• W1983392014 cites W2006144062 @default.
• W1983392014 cites W2011615869 @default.
• W1983392014 cites W2018786123 @default.
• W1983392014 cites W2023667758 @default.
• W1983392014 cites W2029008737 @default.
• W1983392014 cites W2046703384 @default.
• W1983392014 cites W2051075703 @default.
• W1983392014 cites W2057145644 @default.
• W1983392014 cites W2072777207 @default.
• W1983392014 cites W2074570058 @default.
• W1983392014 cites W2080653091 @default.
• W1983392014 cites W2082188429 @default.
• W1983392014 cites W2085272777 @default.
• W1983392014 cites W2086004321 @default.
• W1983392014 cites W2104258472 @default.
• W1983392014 cites W2105344150 @default.
• W1983392014 cites W2106003406 @default.
• W1983392014 cites W2109930513 @default.
• W1983392014 cites W2111852544 @default.
• W1983392014 cites W2113336183 @default.
• W1983392014 cites W2114306163 @default.
• W1983392014 cites W2114344934 @default.
• W1983392014 cites W2115539119 @default.
• W1983392014 cites W2115727730 @default.
• W1983392014 cites W2116481264 @default.
• W1983392014 cites W2118586303 @default.
• W1983392014 cites W2124999767 @default.
• W1983392014 cites W2126057369 @default.
• W1983392014 cites W2127264766 @default.
• W1983392014 cites W2127311438 @default.
• W1983392014 cites W2128138104 @default.
• W1983392014 cites W2128880038 @default.
• W1983392014 cites W2129248772 @default.
• W1983392014 cites W2136645624 @default.
• W1983392014 cites W2137195660 @default.
• W1983392014 cites W2138077578 @default.
• W1983392014 cites W2141157874 @default.
• W1983392014 cites W2145081087 @default.
• W1983392014 cites W2145594096 @default.
• W1983392014 cites W2145707143 @default.
• W1983392014 cites W2145817805 @default.
• W1983392014 cites W2148814662 @default.
• W1983392014 cites W2149038592 @default.
• W1983392014 cites W2150265408 @default.
• W1983392014 cites W2156044707 @default.
• W1983392014 cites W2156753325 @default.
• W1983392014 cites W2164665193 @default.
• W1983392014 cites W2165555600 @default.
• W1983392014 cites W2168140297 @default.
• W1983392014 cites W2169231942 @default.
• W1983392014 cites W2171558140 @default.
• W1983392014 cites W2171895257 @default.
• W1983392014 cites W2183157368 @default.
• W1983392014 cites W2264429446 @default.
• W1983392014 cites W4232297913 @default.
• W1983392014 doi "https://doi.org/10.1074/jbc.m605554200" @default.
• W1983392014 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17158098" @default.
• W1983392014 hasPublicationYear "2007" @default.
• W1983392014 type Work @default.
• W1983392014 sameAs 1983392014 @default.
• W1983392014 citedByCount "7" @default.
• W1983392014 countsByYear W19833920142018 @default.
• W1983392014 crossrefType "journal-article" @default.
• W1983392014 hasAuthorship W1983392014A5035080166 @default.
• W1983392014 hasAuthorship W1983392014A5038466467 @default.
• W1983392014 hasAuthorship W1983392014A5052701065 @default.
• W1983392014 hasAuthorship W1983392014A5055625883 @default.
• W1983392014 hasAuthorship W1983392014A5067936254 @default.
• W1983392014 hasAuthorship W1983392014A5073745132 @default.
• W1983392014 hasBestOaLocation W19833920141 @default.
• W1983392014 hasConcept C104317684 @default.
• W1983392014 hasConcept C185592680 @default.
• W1983392014 hasConcept C18903297 @default.
• W1983392014 hasConcept C21786251 @default.
• W1983392014 hasConcept C2777289219 @default.

• next