FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1983441569> ?p ?o ?g. }

• W1983441569 endingPage "10386" @default.
• W1983441569 startingPage "10376" @default.
• W1983441569 abstract "Saccharomyces cerevisiae MPH1 was first identified as a gene encoding a 3′ to 5′ DNA helicase, which when deleted leads to a mutator phenotype. In this study, we isolated MPH1 as a multicopy suppressor of the dna2K1080E helicase-negative lethal mutant. Purified Mph1 stimulated the endonuclease activities of both Fen1 and Dna2, which act faithfully in the processing of Okazaki fragments. This stimulation required neither ATP hydrolysis nor the helicase activity of Mph1. Multicopy expression of MPH1 also suppressed the temperature-sensitive growth defects in cells expressing dna2Δ405N, which lacks the N-terminal 405 amino acids of Dna2. However, Mph1 did not stimulate the endonuclease activity of the Dna2Δ405N mutant protein. The stimulation of Fen1 by Mph1 was limited to flap-structured substrates; Mph1 hardly stimulated the 5′ to 3′ exonuclease activity of Fen1. Mph1 binds to flap-structured substrate more efficiently than to nicked duplex structures, suggesting that the stimulatory effect of Mph1 is exerted through its binding to DNA substrates. In addition, we found that Mph1 reversed the inhibitory effects of replication protein A on Fen1 activity. Our biochemical and genetic data indicate that the in vivo suppression of Dna2 defects observed with both dna2K1080E and dna2Δ405N mutants occur via stimulation of Fen1 activity. These findings suggest that Mph1 plays an important, although not essential, role in processing of Okazaki fragments by facilitating the formation of ligatable nicks. Saccharomyces cerevisiae MPH1 was first identified as a gene encoding a 3′ to 5′ DNA helicase, which when deleted leads to a mutator phenotype. In this study, we isolated MPH1 as a multicopy suppressor of the dna2K1080E helicase-negative lethal mutant. Purified Mph1 stimulated the endonuclease activities of both Fen1 and Dna2, which act faithfully in the processing of Okazaki fragments. This stimulation required neither ATP hydrolysis nor the helicase activity of Mph1. Multicopy expression of MPH1 also suppressed the temperature-sensitive growth defects in cells expressing dna2Δ405N, which lacks the N-terminal 405 amino acids of Dna2. However, Mph1 did not stimulate the endonuclease activity of the Dna2Δ405N mutant protein. The stimulation of Fen1 by Mph1 was limited to flap-structured substrates; Mph1 hardly stimulated the 5′ to 3′ exonuclease activity of Fen1. Mph1 binds to flap-structured substrate more efficiently than to nicked duplex structures, suggesting that the stimulatory effect of Mph1 is exerted through its binding to DNA substrates. In addition, we found that Mph1 reversed the inhibitory effects of replication protein A on Fen1 activity. Our biochemical and genetic data indicate that the in vivo suppression of Dna2 defects observed with both dna2K1080E and dna2Δ405N mutants occur via stimulation of Fen1 activity. These findings suggest that Mph1 plays an important, although not essential, role in processing of Okazaki fragments by facilitating the formation of ligatable nicks. Lagging strand DNA synthesis requires the orchestrated actions of many proteins and can be divided into several distinct enzymatic steps (1Bambara R.A. Murante R.S. Henricksen L.A. J. Biol. Chem... 1997; 272: 4647-4650Google Scholar, 2Hübscher U. Seo Y.S. Mol. Cells.. 2001; 12: 149-157Google Scholar, 3Kao H.I. Bambara R.A. Crit. Rev. Biochem. Mol. Biol... 2003; 38: 433-452Google Scholar-4Budd M.E. Tong A.H. Polaczek P. Peng X. Boone C. Campbell J.L. PLoS Genet... 2005; 1: 634-650Google Scholar). First, the polymerase (pol) 2The abbreviations used are: pol, polymerase; RPA, replication protein A; ssDNA, single-stranded DNA; dsDNA, double-stranded DNA; ATPγS, adenosine 5′-O-(thiotriphosphate); DTT, dithiothreitol; BSA, bovine serum albumin; nt, nucleotide(s); SD, synthetic-dropout medium. α-primase complex synthesizes RNA-DNA primers on the template DNA that are recognized by replication factor C. This complex loads proliferating cell nuclear antigen onto DNA, which acts as a processivity factor tethering pol δ to primer ends (5Conaway R.C. Lehman I.R. Proc. Natl. Acad. Sci. U. S. A... 1982; 79: 2523-2527Google Scholar, 6Shioda M. Nelson E.M. Bayne M.L. Benbow R.M. Proc. Natl. Acad. Sci. U. S. A... 1982; 79: 7209-7213Google Scholar-7Cai J. Uhlmann F. Gibbs E. Flores-Rozas H. Lee C.-G. Pillips B. Finkelstein J. Yao N. O'Donnell M. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A... 1996; 93: 12896-12901Google Scholar). This series of reactions leads to a polymerase switch in which the pol α-primase complex at primer ends is displaced and replaced by pol δ. Okazaki fragments are then elongated by pol δ until they encounter downstream Okazaki fragments (2Hübscher U. Seo Y.S. Mol. Cells.. 2001; 12: 149-157Google Scholar, 8Maga G. Frouin I. Spadari S. Hübscher U. J. Mol. Biol... 2000; 295: 191-801Google Scholar, 9Burgers P.M. Nucleic Acids Res... 1988; 16: 6297-6307Google Scholar-10Bauer G.A. Burgers P.M. Proc. Natl. Acad. Sci. U. S. A... 1988; 85: 7506-7510Google Scholar). Pol δ continues to synthesize DNA by displacing the 5′ termini of downstream Okazaki fragments, which generate 5′ RNA-DNA flap structures (11Burgers P.M. J. Biol. Chem... 2009; 284: 4041-4045Google Scholar). These flaps are then cleaved by structure-specific nucleases that lead to the generation of ligatable nicks, which are sealed by DNA ligase converting the noncontiguous lagging strands to a contiguous DNA chain (12Liu Y. Kao H.I. Bambara R.A. Annu. Rev. Biochem... 2004; 73: 589-615Google Scholar, 13Turchi J.J. Huang L. Murante R.S. Kim Y. Bambara R.A. Proc. Natl. Acad. Sci. U. S. A... 1994; 91: 9803-9807Google Scholar). A number of biochemical studies have shown that flap structures are removed by the concerted action of Dna2 endonuclease/helicase and Fen1 (flap endonuclease 1) (14Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature.. 2001; 412: 456-461Google Scholar, 15Ayyagari R. Gomes X.V. Gordenin D.A. Burgers P.M. J. Biol. Chem... 2003; 278: 1618-1625Google Scholar-16Kao H.I. Veeraraghaven J. Polaczek P. Campbell J.L. Bambara R.A. J. Biol. Chem... 2004; 279: 1501-1524Google Scholar). DNA2, first identified as a gene that complemented a yeast temperature-sensitive mutant defective in the elongation stage of DNA replication, was shown to encode a protein with structure-specific endonuclease and 5′ to 3′ helicase activities (17Kuo C.L. Huang C.H. Campbell J.L. Proc. Natl. Acad. Sci. U. S. A... 1983; 80: 6465-6469Google Scholar, 18Budd M.E. Campbell J.L. Proc. Natl. Acad. Sci. U. S. A... 1995; 92: 7642-7646Google Scholar, 19Budd M.E. Choe W.C. Campbell J.L. J. Biol. Chem... 1995; 270: 26766-26769Google Scholar, 20Bae S.H. Choe E. Lee K.H. Park K.S. Lee S.H. Seo Y.S. J. Biol. Chem... 1998; 273: 26880-26890Google Scholar-21Bae S.H. Kim D.W. Kim J. Kim J.H. Kim D.H. Kim H.D. Kang H.Y. Seo Y.S. J. Biol. Chem... 2002; 277: 26632-26641Google Scholar). RAD27, encoding yeast Fen1, is a gene showing strong mutator phenotype and genome instability when inactivated. Fen1 participates in a variety of DNA transactions, including Okazaki fragment processing, due to its endonuclease, gap endonuclease, and exonuclease activities (12Liu Y. Kao H.I. Bambara R.A. Annu. Rev. Biochem... 2004; 73: 589-615Google Scholar, 22Reagan M.S. Pittenger C. Siede W. Friedberg E.C. J. Bacteriol... 1995; 177: 364-371Google Scholar, 23Tishkoff D.Z. Filosi N. Gaida G.M. Kolodner R.D. Cell.. 1997; 88: 256-263Google Scholar, 24Johnson R.E. Kovvali G.K. Prakash L. Prakash S. Science.. 1995; 269: 238-240Google Scholar, 25Johnson R.E. Kovvali G.K. Prakash L. Prakash S. Curr. Genet... 1998; 34: 21-29Google Scholar, 26Harrington J.J. Lieber M.R. EMBO J... 1994; 13: 1235-1246Google Scholar, 27Murante R.S. Huang L. Turchi J.J. Bambara R.A. J. Biol. Chem... 1994; 269: 1191-1196Google Scholar-28Zheng L. Zhou M. Chai Q. Parrish J. Xue D. Patrick S.M. Turchi J.J. Yannone S.M. Shen B. EMBO. Rep... 2005; 6: 83-89Google Scholar). Fen1 can cleave flap structures efficiently to generate ligatable nicks, especially on short 5′ flap structures (<20 nt). However, Fen1 is not effective in cleaving replication protein A (RPA) bound or secondary structured flaps in vitro (14Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature.. 2001; 412: 456-461Google Scholar, 29Spiro C. Pelletier R. Rolfsmeier M.L. Dixon M.J. Lahue R.S. Gupta G. Park M.S. Chen X. Mariappan S.V. McMurray C.T. Mol. Cell... 1999; 4: 1079-1085Google Scholar). These findings suggest that in vivo Fen1 acts on flap DNA by first loading onto the 5′-ends of flap structures and then migrating to the junction of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), a process referred to as a tracking mechanism (30Liu Y. Zhang H. Veeraraghavan J. Bambara R.A. Freudenreich C.H. Mol. Cell. Biol... 2004; 24: 4049-4064Google Scholar). In contrast, Dna2 can remove secondary structured flaps through the combined action of its helicase/endonuclease activities; its helicase activity can unwind intramolecular base-paired hairpin-like flap structures, thus facilitating the cleavage of unwound ssDNA through its endonuclease activity. RPA can also assist in the removal of relatively long DNA flaps by Dna2 (14Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature.. 2001; 412: 456-461Google Scholar). RPA, which can bind to long flaps (>27 nt), inhibits the action of Fen1 in vitro while stimulating the Dna2-catalyzed cleavage of long flap by recruiting Dna2 (14Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature.. 2001; 412: 456-461Google Scholar). Thus, RPA is dynamically removed by Dna2 and then Fen1 cleaves the remaining flaps (15Ayyagari R. Gomes X.V. Gordenin D.A. Burgers P.M. J. Biol. Chem... 2003; 278: 1618-1625Google Scholar, 31Bae K.H. Kim H.S. Bae S.H. Kang H.Y. Brill S. Seo Y.S. Nucleic Acids Res... 2003; 31: 3006-3015Google Scholar). The Pif1 5′ to 3′ helicase activity is implicated in accelerating the growth of long flap structures by rapidly displacing downstream 5′ flap, thereby increasing the chances that RPA can bind before Fen1 acts (33Rossi M.L. Pike J.E. Wang W. Burgers P.M. Campbell J.L. Bambara R.A. J. Biol. Chem... 2008; 283: 27483-27493Google Scholar). These considerations indicate that Dna2 and Fen1 remove flap structures by their sequential action, and their activities are influenced by other proteins like RPA and Pif1. Saccharomyces cerevisiae MPH1 was first identified as a mutator phenotype 1 gene (34Entian K.D. Schuster T. Hegemann J.H. Becher D. Feldmann H. Güldener U. Götz R. Hansen M. Hollenberg C.P. Jansen G. Kramer W. Klein S. Kötter P. Kricke J. Launhardt H. Mannhaupt G. Maierl A. Meyer P. Mewes W. Munder T. Niedenthal R.K. Ramezani Rad M. Röhmer A. Römer A. Hinnen A. Mol. Gen. Genet... 1999; 262: 683-702Google Scholar), and the mph1Δ null mutant displayed increased mutation rates and sensitivity to a variety of DNA-damaging agents (35Scheller J. Schürer A. Rudolph C. Hettwer S. Kramer W. Genetics.. 2000; 11: 61-73Google Scholar). Based on genetic studies, it is thought that MPH1 functions in an error-free DNA damage bypass pathway that requires homologous recombination genes (36Schürer K.A. Rudonph C. Ulrich H.D. Kramer W. Genetics.. 2004; 166: 1673-1686Google Scholar). It was also shown that Mph1 has DNA-dependent ATPase activity and translocates on ssDNA in the 3′ to 5′ direction (37Prakash R. Krejci L. Van Komen S. Anke Schürer K. Kramer W. Sung P. J. Biol. Chem... 2005; 280: 7854-7860Google Scholar). Recently, it was reported that overexpression of Mph1 increased gross chromosomal rearrangements by partially inhibiting homologous recombination through its interaction with RPA (38Banerjee S. Smith S. Oum J.H. Liaw H.J. Hwang J.Y. Sikdar N. Motegi A. Lee S.E. Myung K. J. Cell Biol... 2008; 181: 1083-1093Google Scholar). These data suggest that Mph1 is important in maintaining the integrity of DNA. In addition to the proteins described above, the processing of Okazaki fragment is affected by other proteins that stimulate the endonucleases that cleave flap structures. Mgs1, which has DNA-dependent ATPase and DNA-annealing activities, markedly stimulates the endonuclease activity of Fen1 on flap DNA substrates in an ATP-dependent manner (39Kim J.H. Kang Y.H. Kang H.J. Kim D.H. Ryu G.H. Kang M.J. Seo Y.S. Nucleic Acids Res... 2005; 33: 6137-6150Google Scholar). Bloom and Werner helicases interact directly with hFen1 and stimulate its endonuclease activity (40Sharma S. Sommers J.A. Wu L. Bohr V.A. Hickson I.D. Brosh Jr. R.M. J. Biol. Chem... 2004; 279: 9844-9856Google Scholar, 41Brosh R.M. Jr., von Kobbe C. Sommers J.A. Karmakar P. Opresko P.L. Piotorowski J. Dianova I. Dianov G.L. Bohr V.A. EMBO J... 2001; 20: 5791-5801Google Scholar). The detection of auxiliary proteins that stimulate the activities of Dna2 or Fen1 is likely to reveal important redundant pathways involved in the processing of Okazaki fragments. Moreover, their discovery may reveal novel pathways used to maintain genome integrity, since DNA replication is closely linked to genome stability. In order to identify novel factors that influence Okazaki fragment processing, we have carried out multicopy suppressor screens with dna2 helicase-negative mutant strains. We introduced multicopy plasmids containing randomly inserted genomic DNA fragments into the dna2K1080E mutant yeast strain and analyzed the inserts that suppressed the lethal phenotype of this mutant. This screen resulted in the identification of MPH1 as a multicopy suppressor. To understand the biochemical mechanism of their suppression and its role in Okazaki fragment processing, we purified the Mph1 protein and investigated its interactions with Fen1 and Dna2 both in vivo and in vitro. We found that Mph1 enhanced the endonuclease activities of Fen1 and Dna2 in vitro, and this stimulation did not require ATPase/helicase activities of Mph1. Our results indicate that Mph1 participates in Okazaki fragment processing by increasing the rate of cleavage of flap substrate, thereby facilitating the production of ligatable nicks. Enzymes and Nucleotides—The restriction endonucleases, polynucleotide kinase, and T4 DNA ligase were purchased from Enzynomics (Daejeon, Korea). The oligonucleotides used in this study were commercially synthesized from Genotech (Daejeon, Korea). ATP was obtained from Sigma. ATPγS was from Roche Applied Science. [γ-32P]ATP (3,000 Ci/mmol) was purchased from Izotop (Budapest, Hungary). Yeast Dna2 and Fen1 were purified as described (14Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature.. 2001; 412: 456-461Google Scholar, 42Bae S.H. Kim J.A. Choe E. Lee K.H. Kang H.Y. Kim H.D. Kim J.H. Bae K.H. Cho Y. Park C. Seo Y.S. Nucleic Acids Res... 2001; 29: 3069-3079Google Scholar). Preparation of Helicase and Nuclease Substrates—All substrates were prepared as described previously (14Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature.. 2001; 412: 456-461Google Scholar), and the sequences of oligonucleotides used are listed in Table 1. Briefly, one of the two oligonucleotides in a partial duplex DNA substrate was 5′-labeled with [γ-32P]ATP and polynucleotide kinase according to the manufacturer's protocol and then annealed to the other oligonucleotide. For a flap or a nicked duplex substrate, a downstream oligonucleotide was labeled as described above and then annealed with the template and upstream oligonucleotides at a molar ratio of 1:3:5. All annealed substrates were purified by polyacrylamide gel electrophoresis.Table 1Oligonucleotide sequences used in this study Number Sequence (5′-3′) 1 GGGCTCACGTGGTCGACGCTGGAGGTGATCACCAGATGATTGCTAGGCATGCTTTCCGCAAGAGAACGGGCGTCTGCGTACCCGTGCAG (89 nt)aThe numbers in parentheses indicate the length of each oligonucleotide. 2 CAGCGTCGACCACGTGAGCCC (21 nt) 3 CTGCACGGGTACGCAGACGCC (21 nt) 4 CGAACAATTCAGCGGCTTTAACCGGACGCTCGACGCCATTAATAATGTTTTC (52 nt) 5 GAAAACATTATTAATGGCGTCGAGCTAGGCACAAGGCGAACTGCTAACGG (50 nt) 6 CCGTTAGCAGTTCGCCTTGTGCCTA (25 nt) 7 CCGTTAGCAGTTCGCCTTGTGCCTAG (26 nt) 8bUnderlined sequences form hairpin structures. GCGCATGTGCGTTCCATTTAGTTCAAGCCGCAGCGGCTTGAACCGGACGCTCGACGCCATTAATAATGTTTTC (73 nt) 9 GCTCGACGCCATTAATAATGTTTTC (25 nt)a The numbers in parentheses indicate the length of each oligonucleotide.b Underlined sequences form hairpin structures. Open table in a new tab Construction of Mph1 Expression Vectors—For overexpression of Mph1 in yeast, the ADH1 promoter was used. This was PCR-amplified from pRS323(ADH)-FLAG using two oligonucleotides (5′-TCC CCG CGG GAT ATC CTT TTG TTT CCG GG-3′ and 5′-GGC CGC GGC CGC GAG TTG ATT GTA TGC TTG GTA-3′), and the SacII-NotI fragment of the PCR product was cloned into pRS325 and pRS424 plasmids to prepare pRS325(ADH) and pRS424(ADH), respectively. The open reading frame of MPH1 was amplified from a plasmid containing MPH1 using two oligonucleotides (5′-GCG GCC GCA TGG CTA GTG CAG ATG ATT A-3′ and 5′-CTG CAG TCA AAA ATC AGA ATC TGA GC-3′). The NotI-PstI fragment of the PCR fragment was cloned into pRS325(ADH) to obtain pRS325(ADH)-MPH1. The NotI-PstI fragment from pRS325(ADH)-MPH1 was subcloned to pRS424(ADH) to make pRS424(ADH)-MPH1. To express hexahistidine and the FLAG-tagged Mph1, pRS424(ADH) was digested first with ClaI, and the resulting recessed ends were filled in with Klenow and then digested with KpnI. Similarly, pFastBac-Hta-FLAG-MPH1 (see below) was digested with RsrII, and the recessed end was filled in with Klenow, followed by digestion with KpnI. The fragment containing His6-FLAG-MPH1 was cloned into the digested pRS424(ADH)vector, resulting in pRS424(ADH)-HF-MPH1. For construction of a vector expressing the His6-FLAG-tagged protein in insect cells, two oligonucleotides containing the FLAG peptide sequence (5′-TCG ACT TGA CTA CAA GGA CGA TGA CGA TAA GAG C-3′ and 5′-GGC CGC TCT TAT CGT CAT CGT CCT TGT AGT CAA G-3′) were annealed, and the products were cloned into pFastBac-HTa vector, resulting in pFastBac-Hta-FLAG. pFastBac-Hta-FLAG-MPH1 was made by cloning the NotI-Kpn1 fragment of the PCR product amplified from pET28-MPH1 using 5′-GCG CGG CCG CAT GGC TAG TGC AGA TGA TTA C-3′ and 5′-GCG GTA CCT CAA AAA TCA GAA TCT GAG CC-3′. To make the mph1K113E mutant DNA, in vitro mutagenesis was carried out using the EZchange™ site-directed mutagenesis kit (Enzynomics) using the oligonucleotides (5′-GCC ATC CCA ACG GGT ATG GGT GAA ACG TTC ATT GCC AG-3′ and 5′-CTG GCA ATG AAC GTT TCA CCC ATA CCC GTT GGG ATG GC-3′), according to the manufacturer's protocol. Screening Multicopy Suppressors of dna2K1080E Mutant—A yeast genomic DNA library inserted into a pYEp13 multicopy plasmid (ATCC27323) was transformed into YJA1B (MATα ade2-101 ura3-52 lys2-801trp1-Δ63 his3-Δ200 leu2-Δ1 GAL+ dna2::HIS3 (pRS316-DNA2)) containing the pRS314-dna2K1080E plasmid. Transformants were grown in SD without histidine, leucine, and tryptophan for 24 h at 30 °C, followed by replica plating onto the same SD medium supplemented with 0.1% 5-fluoroorotic acid. The plates were incubated for an additional 3–4 days. The colonies grown were transferred to liquid medium, and total genomic DNA was prepared and used to transform Escherichia coli by electroporation, from which plasmids were isolated. To confirm multicopy suppression, recovered plasmids were retransformed into the YJA1B strain and examined for their ability to support growth of mutant cells. Double-checked plasmids were analyzed by sequencing to identify genomic DNA fragments inserted in the plasmid. One of the analyzed plasmids contained the MPH1 gene. To confirm that MPH1 is a multicopy suppressor, the open reading frame of MPH1 alone was cloned into a 2-μm origin-based pRS plasmid series and expressed under the ADH1 promoter in mutant cells. Drop Dilution Assay—Transformants were inoculated in appropriate medium (2 ml) and grown for 16–36 h. Each saturated culture was diluted with distilled water to a density of 1 × 107 cells/ml, and serially diluted samples (5–10 μl) were then spotted on appropriate medium and incubated for 3–5 days at the indicated temperatures. Where 5-fluoroorotic acid and control plate were used, inoculation was performed in the medium containing uracil to allow cells to spontaneously lose pRS316-Dna2 (containing the URA3 gene as a marker) during growth before spotting (35Scheller J. Schürer A. Rudolph C. Hettwer S. Kramer W. Genetics.. 2000; 11: 61-73Google Scholar, 39Kim J.H. Kang Y.H. Kang H.J. Kim D.H. Ryu G.H. Kang M.J. Seo Y.S. Nucleic Acids Res... 2005; 33: 6137-6150Google Scholar). Purification of Recombinant Mph1 Proteins—Baculoviruses expressing the N-terminally histidine-FLAG-tagged Mph1 protein (wild type or K113E mutant) were used to infect Sf9 insect cells (2 liters; 1 × 106 cells/ml) for 60 h at 27 °C in Sf-900 II serum-free medium (Invitrogen); cells were harvested by centrifugation, resuspended in 50 ml of lysis buffer (25 mm Hepes-NaOH, pH 7.6, 500 mm NaCl, 1 mm DTT, 1 mm EDTA, 10% glycerol, 0.1% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride, 0.1 mm benzamidine, 2 μg/ml leupeptin, 0.1 μg/ml anti-pain, and 1 μg/ml pepstatin A), and sonicated. Crude extracts were cleared by centrifugation at 18,000 rpm for 1 h using the Hanil A50S-8 rotor, and the supernatant was mixed with 0.5 ml of anti-FLAG M2-agarose beads (Sigma) pre-equilibrated with the lysis buffer for 2 h. The beads were collected and washed three times with 40 ml of buffer A (25 mm Hepes-NaOH, pH 7.6, 1 mm DTT, 1 mm EDTA, 10% glycerol, 0.01% Nonidet P-40) containing 800 mm NaCl and once with buffer A containing 300 mm NaCl. Bound proteins were eluted three times with 0.5 ml of buffer A containing 300 mm NaCl and 0.1 mg/ml 1× FLAG peptide (Sigma) with rocking at 4 °C for 30 min. The initial two eluates were combined and loaded onto a Heparin-Sepharose Fast Flow column (3 ml; GE Healthcare) by gravity, followed by elution with a 6-ml linear gradient of NaCl from 0.1 to 1 m in buffer A (flow rate, 0.1 ml/min). Mph1 was eluted in 550–750 mm NaCl. BSA was added to the active fractions (final concentration, 1 mg/ml) to stabilize the enzyme, which was then frozen at –80 °C. The protein concentrations of Mph1 fractions were quantified by SDS-PAGE analysis, followed by Coomassie Brilliant Blue staining, and the protein band intensity was determined using BSA as the standard (Bio-Rad). Nuclease Assay and Helicase Assay—Standard nuclease assays of Fen1 and Dna2 were performed in reaction mixtures (20 μl) containing 25 mm Tris-HCl, pH 7.8, 5 mm MgCl2, 2 mm DTT, 0.25 mg/ml BSA, and 15 fmol of DNA substrate. Unless stated otherwise, 50 mm NaCl was used for each reaction. Proteins were diluted in buffer (25 mm Hepes-NaOH, pH 7.6, 500 mm NaCl, 1 mm DTT, 0.25 mg/ml BSA, 0.01% Nonidet P-40, 10% glycerol) before their addition to reaction mixtures. The reactions were incubated at 30 °C for 15 min and halted with 6× stop solution (60 mm EDTA, pH 8.0, 40% (w/v) sucrose, 0.6% SDS, 0.25% xylene cyanol, 0.25% bromphenol blue). Reaction products were subjected to electrophoresis for 40 min at 150 V through 10% polyacrylamide gel in 1× TBE (89 mm Tris-base, 89 mm boric acid, and 2 mm EDTA); gels were dried on DEAE-cellulose paper and autoradiographed. The resolved DNA products were quantified using a PhosphorImager (Amersham Biosciences). Helicase assays were performed using the same conditions as described in the above nuclease assay but in the presence of 5 mm ATP. Gel Mobility Shift Assay—Reaction mixtures (20 μl) containing 25 mm Tris-HCl, pH 7.8, 50 mm NaCl, 2 mm DTT, 0.25 mg/ml BSA, 15 fmol of DNA substrate with or without 5 mm MgCl2 and with or without 5 mm ATP (or ATPγS) were incubated at 30 °C for 15 min, followed by the addition of glycerol and bromphenol blue to 10% (v/v) and 0.05% (w/v), respectively. Reaction products were subjected to electrophoresis through prerun 6% polyacrylamide gels for 1.5 h in 0.5× TBE at 4 °C (39Kim J.H. Kang Y.H. Kang H.J. Kim D.H. Ryu G.H. Kang M.J. Seo Y.S. Nucleic Acids Res... 2005; 33: 6137-6150Google Scholar). Gels were dried on DEAE-cellulose paper and then autoradiographed. Levels of nucleoprotein complexes formed were quantified using a PhosphorImager (Amersham Biosciences). Overexpression of MPH1 Suppresses the Lethal Phenotype of dna2K1080E—To identify novel factors involved in Okazaki fragment processing, extensive multicopy suppressor screens were carried out with several dna2 mutant strains. The mutant strains used were defective in the processing of DNA flap structures generated from 5′-end regions of Okazaki fragments in the pol δ-catalyzed displacement reaction. The rationale for this screen was that it might reveal additional proteins that participate in Okazaki fragment maturation by (i) replacing one of the defective activities of Dna2, (ii) stimulating the flap-cleaving enzymes, including Dna2 and Fen1, or (iii) repairing DNA structures resulting from defects in flap processing. Multicopy suppressor screens were performed with the helicase-negative dna2K1080E mutant in the hope of isolating a helicase gene that could substitute for the helicase function of Dna2. This effort resulted in the isolation of one clone that harbored a library plasmid containing the full-length open reading frame of the MPH1 gene. To confirm that MPH1 was responsible for suppression, the open reading frame of MPH1 was amplified from the library plasmid and positioned under the constitutive promoter of the gene encoding alcohol dehydrogenase 1 (ADH1) in the pRS325 multicopy vector (pRS325pADH-MPH1) and expressed in the dna2K1080E mutant strain. Overexpression of MPH1 driven by either the ADH1 promoter or its natural promoter suppressed the lethal phenotype of dna2K1080E (Fig. 1A). Since the Mph1 protein has intrinsic ATPase and 3′ to 5′ DNA helicase activities, we examined whether they were required for the observed suppression (37Prakash R. Krejci L. Van Komen S. Anke Schürer K. Kramer W. Sung P. J. Biol. Chem... 2005; 280: 7854-7860Google Scholar). For this purpose, we mutated lysine 113 to glutamic acid in the Walker A motif of MPH1 that is responsible for binding to the terminal phosphate of ATP (35Scheller J. Schürer A. Rudolph C. Hettwer S. Kramer W. Genetics.. 2000; 11: 61-73Google Scholar). Interestingly, overexpression of the mutated version of MPH1 also suppressed the lethality of dna2K1080E, as observed with the wild type MPH1. This result suggests that the helicase activity of Mph1 is dispensable for suppression of the dna2K1080E mutation. To gain more information about the mechanism by which MPH1 suppressed DNA2 mutated strain, we isolated the recombinant Mph1 protein. Its expression in E. coli resulted in mostly insoluble and severely degraded protein preparations. For this reason, recombinant baculoviruses were prepared that expressed Mph1 with N-terminally fused His6 and FLAG tags and were used to infect Sf9 cells. Extracts prepared from infected insect cells yielded soluble recombinant HF-Mph1 protein after two column purification steps (Fig. 1B), as described under Experimental Procedures. The recombinant Mph1 protein possessed helicase activity on partial double strand substrates with a 3′ single-stranded DNA but not with a 5′ single-stranded DNA (Fig. 1C), consistent with the previous report that Mph1 purified from yeast translocates in the 3′ to 5′ direction (37Prakash R. Krejci L. Van Komen S. Anke Schürer K. Kramer W. Sung P. J. Biol. Chem... 2005; 280: 7854-7860Google Scholar). Mph1 Stimulates the Endonuclease Activity of Fen1—RPA and Mgs1, both identified as multicopy suppressors of dna2 mutants, markedly stimulated the endonuclease activity of Dna2 and Fen1, respectively (14Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature.. 2001; 412: 456-461Google Scholar, 39Kim J.H. Kang Y.H. Kang H.J. Kim D.H. Ryu G.H. Kang M.J. Seo Y.S. Nucleic Acids Res... 2005; 33: 6137-6150Google Scholar). To investigate whether Mph1 utilized a similar mechanism, we examined the structure-specific nuclease activity of Fen1 in the absence (Fig. 2A, lanes 3–7) or presence (Fig. 2A, lanes 8–12) of Mph1 in a time course experiment (Fig. 2, A and B). Mph1 markedly enhanced the activity of Fen1 when a 27-nt 5′ flap substrate was used (Fig. 2A). The purified Mph1 protein alone was devoid of any nuclease activity (Fig. 2A, lane 2). Maximal stimulation (15.3-fold) was observed at the earliest time point examined (Fig. 2B). If Mph1 suppressed the lethality of dna2K1080E solely by stimulating the action of Fen1, we would expect that overexpression of FEN1 should suppress the dna2K1080E mutant. As predicted, multicopy expression of FEN1 suppressed the dna2K1080E mutant (Fig. 2C, second row). Since it is possible that the presence of affinity tags on proteins can abolish their enzymatic activities or other associated functions, we examined whether the N-terminally tagged Mph1 maintained its in vivo ability to suppress the dna2K1080E mutation. As shown in Fig. 2C (third and fourth rows), expression of both wild type and K113E mutant-tagged proteins still suppressed the growth defect of the dna2K1080E mutant. Since overexpression of FEN1 also rescued the temperature-sensitive growth defect of dna2Δ405N and dna2-1 in addition to dna2K1080E, the stimulation of Fen1 activity appears to be a general mechanism for the suppression of any defective dna2 (39Kim J.H. Kang Y.H. Kang H.J. Kim D.H. Ryu G.H. Kang M.J. Seo Y.S. Nucleic Acids Res... 2005; 33: 6137-6150Google Scholar, 43Budd M.E. Campbell J.L. Mol. Cell. Biol... 1997; 17: 2136-2142Google Scholar). These findings are consistent with the notion that the most critical function of Dna2 is dependent on its endonuclease activity. Mph1 Stimulates the Endonuclease Activity of Dna2—Since overexpression of the dna2K1080E mutant allele itself alone resulted in the growth of this mutant, 3C. H. Lee and Y. S. Seo, unpublished data. we examined the possibility that the stimulation of the endonuclease activity of Dna2K1080E protein (the only enzymatic activity of this Dna2 mutant" @default.
• W1983441569 created "2016-06-24" @default.
• W1983441569 creator A5004143966 @default.
• W1983441569 creator A5027717102 @default.
• W1983441569 creator A5030497198 @default.
• W1983441569 creator A5039796941 @default.
• W1983441569 creator A5060735133 @default.
• W1983441569 creator A5063345003 @default.
• W1983441569 creator A5079832305 @default.
• W1983441569 date "2009-04-01" @default.
• W1983441569 modified "2023-09-28" @default.
• W1983441569 title "The MPH1 Gene of Saccharomyces cerevisiae Functions in Okazaki Fragment Processing" @default.
• W1983441569 cites W1506492200 @default.
• W1983441569 cites W1566131689 @default.
• W1983441569 cites W1729887059 @default.
• W1983441569 cites W1922687004 @default.
• W1983441569 cites W1966219094 @default.
• W1983441569 cites W1966464105 @default.
• W1983441569 cites W1968643238 @default.
• W1983441569 cites W1969003098 @default.
• W1983441569 cites W1973535211 @default.
• W1983441569 cites W1981277651 @default.
• W1983441569 cites W1997002747 @default.
• W1983441569 cites W2003329456 @default.
• W1983441569 cites W2006538713 @default.
• W1983441569 cites W2010302368 @default.
• W1983441569 cites W2011681036 @default.
• W1983441569 cites W2013456924 @default.
• W1983441569 cites W2014223000 @default.
• W1983441569 cites W2015925955 @default.
• W1983441569 cites W2020977321 @default.
• W1983441569 cites W2023865120 @default.
• W1983441569 cites W2028767678 @default.
• W1983441569 cites W2053213954 @default.
• W1983441569 cites W2055652654 @default.
• W1983441569 cites W2061754995 @default.
• W1983441569 cites W2063847889 @default.
• W1983441569 cites W2063860903 @default.
• W1983441569 cites W2066253067 @default.
• W1983441569 cites W2076210586 @default.
• W1983441569 cites W2079497347 @default.
• W1983441569 cites W2089260242 @default.
• W1983441569 cites W2090110799 @default.
• W1983441569 cites W2094502358 @default.
• W1983441569 cites W2100626549 @default.
• W1983441569 cites W2101107398 @default.
• W1983441569 cites W2103552974 @default.
• W1983441569 cites W2107856790 @default.
• W1983441569 cites W2110161513 @default.
• W1983441569 cites W2110919730 @default.
• W1983441569 cites W2118064322 @default.
• W1983441569 cites W2135453449 @default.
• W1983441569 cites W2144835937 @default.
• W1983441569 cites W2154184046 @default.
• W1983441569 cites W2159127144 @default.
• W1983441569 cites W2160735284 @default.
• W1983441569 cites W2169553212 @default.
• W1983441569 cites W2171763930 @default.
• W1983441569 doi "https://doi.org/10.1074/jbc.m808894200" @default.
• W1983441569 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2667725" @default.
• W1983441569 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19181670" @default.
• W1983441569 hasPublicationYear "2009" @default.
• W1983441569 type Work @default.
• W1983441569 sameAs 1983441569 @default.
• W1983441569 citedByCount "27" @default.
• W1983441569 countsByYear W19834415692012 @default.
• W1983441569 countsByYear W19834415692014 @default.
• W1983441569 countsByYear W19834415692016 @default.
• W1983441569 countsByYear W19834415692017 @default.
• W1983441569 countsByYear W19834415692018 @default.
• W1983441569 countsByYear W19834415692019 @default.
• W1983441569 countsByYear W19834415692020 @default.
• W1983441569 crossrefType "journal-article" @default.
• W1983441569 hasAuthorship W1983441569A5004143966 @default.
• W1983441569 hasAuthorship W1983441569A5027717102 @default.
• W1983441569 hasAuthorship W1983441569A5030497198 @default.
• W1983441569 hasAuthorship W1983441569A5039796941 @default.
• W1983441569 hasAuthorship W1983441569A5060735133 @default.
• W1983441569 hasAuthorship W1983441569A5063345003 @default.
• W1983441569 hasAuthorship W1983441569A5079832305 @default.
• W1983441569 hasBestOaLocation W19834415691 @default.
• W1983441569 hasConcept C104317684 @default.
• W1983441569 hasConcept C11305352 @default.
• W1983441569 hasConcept C185592680 @default.
• W1983441569 hasConcept C199360897 @default.
• W1983441569 hasConcept C2776235265 @default.
• W1983441569 hasConcept C2777576037 @default.
• W1983441569 hasConcept C41008148 @default.
• W1983441569 hasConcept C54355233 @default.
• W1983441569 hasConcept C73573662 @default.
• W1983441569 hasConcept C86803240 @default.
• W1983441569 hasConcept C98086919 @default.
• W1983441569 hasConceptScore W1983441569C104317684 @default.
• W1983441569 hasConceptScore W1983441569C11305352 @default.
• W1983441569 hasConceptScore W1983441569C185592680 @default.
• W1983441569 hasConceptScore W1983441569C199360897 @default.
• W1983441569 hasConceptScore W1983441569C2776235265 @default.
• W1983441569 hasConceptScore W1983441569C2777576037 @default.

• next