FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1983491627> ?p ?o ?g. }

• W1983491627 endingPage "76" @default.
• W1983491627 startingPage "67" @default.
• W1983491627 abstract "Lower motor neuron diseases (LMNDs) include a large spectrum of clinically and genetically heterogeneous disorders. Studying a large inbred African family, we recently described a novel autosomal recessive LMND variant characterized by childhood onset, generalized muscle involvement, and severe outcome, and we mapped the disease gene to a 3.9-cM interval on chromosome 1p36. We identified a homozygous missense mutation (c.1940 T→C [p.647 Phe→Ser]) of the Pleckstrin homology domain–containing, family G member 5 gene, PLEKHG5. In transiently transfected HEK293 and MCF10A cell lines, we found that wild-type PLEKHG5 activated the nuclear factor κB (NFκB) signaling pathway and that both the stability and the intracellular location of mutant PLEKHG5 protein were altered, severely impairing the NFκB transduction pathway. Moreover, aggregates were observed in transiently transfected NSC34 murine motor neurons overexpressing the mutant PLEKHG5 protein. Both loss of PLEKHG5 function and aggregate formation may contribute to neurotoxicity in this novel form of LMND. Lower motor neuron diseases (LMNDs) include a large spectrum of clinically and genetically heterogeneous disorders. Studying a large inbred African family, we recently described a novel autosomal recessive LMND variant characterized by childhood onset, generalized muscle involvement, and severe outcome, and we mapped the disease gene to a 3.9-cM interval on chromosome 1p36. We identified a homozygous missense mutation (c.1940 T→C [p.647 Phe→Ser]) of the Pleckstrin homology domain–containing, family G member 5 gene, PLEKHG5. In transiently transfected HEK293 and MCF10A cell lines, we found that wild-type PLEKHG5 activated the nuclear factor κB (NFκB) signaling pathway and that both the stability and the intracellular location of mutant PLEKHG5 protein were altered, severely impairing the NFκB transduction pathway. Moreover, aggregates were observed in transiently transfected NSC34 murine motor neurons overexpressing the mutant PLEKHG5 protein. Both loss of PLEKHG5 function and aggregate formation may contribute to neurotoxicity in this novel form of LMND. Lower motor neuron diseases (LMNDs) are clinically characterized by progressive paralysis with amyotrophy and loss of deep tendon reflexes and fasciculations, because of motor neuron degeneration in the anterior horn of the spinal cord and the brainstem. Diagnosis is confirmed by electrophysiological or histological evidence of muscle denervation, with normal or subnormal motor nerve conduction velocities and normal sensory potentials. The classic form of autosomal recessive proximal spinal muscular atrophy (MIM 253300) is linked to the SMN1 gene,1Lefebvre S Bürglen L Reboullet S Clermont O Burlet P Viollet L Benichou B Cruaud C Millasseau P Zeviani M Identification and characterization of a spinal muscular atrophy-determining gene.Cell. 1995; 80: 155-165Abstract Full Text PDF PubMed Scopus (2740) Google Scholar but numerous LMND variants have been described, differing by localization of motor weakness, mode of inheritance, and age at onset.2Zerres K Rudnik-Schoneborn S 93rd ENMC international workshop: non-5q-spinal muscular atrophies (SMA)—clinical picture.Neuromuscul Disord. 2003; 13: 179-183Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar, 3Irobi J De Jonghe P Timmerman V Molecular genetics of distal hereditary motor neuropathies.Hum Mol Genet. 2004; 13: R195-R202Crossref PubMed Scopus (74) Google Scholar To date, six other causative genes were reported in pure LMNDs: five with autosomal dominant inheritance (HSPB8/HSP22 and HSPB1/HSP27 in distal hereditary motor neuronopathy type II [d-HMNII {MIM 158590 and 608634}], GARS and BSCL2 in d-HMNV [MIM 600794], and DCTN1 in d-HMNVII [MIM 607641]) and one with autosomal recessive inheritance (IGHMBP2 in d-HMNVI, also known as ”spinal muscular atrophy with respiratory distress” [SMARD {MIM 604320}]).4Grohmann K Schuelke M Diers A Hoffmann K Lucke B Adams C Bertini E Leonhardt-Horti H Muntoni F Ouvrier R et al.Mutations in the gene encoding immunoglobulin μ-binding protein 2 cause spinal muscular atrophy with respiratory distress type 1.Nat Genet. 2001; 29: 75-77Crossref PubMed Scopus (268) Google Scholar, 5Antonellis A Ellsworth RE Sambuughin N Puls I Abel A Lee-Lin SQ Jordanova A Kremensky I Christodoulou K Middleton LT et al.Glycyl tRNA synthetase mutations in Charcot-Marie-Tooth disease type 2D and distal spinal muscular atrophy type V.Am J Hum Genet. 2003; 72: 1293-1299Abstract Full Text Full Text PDF PubMed Scopus (417) Google Scholar, 6Puls I Jonnakuty C LaMonte B Holzbaur E Tokito M Mann E Floeter M Bidus K Drayna D Oh S et al.Mutant dynactin in lower motor neuron disease.Nat Genet. 2003; 33: 455-456Crossref PubMed Scopus (768) Google Scholar, 7Evgrafov OV Mersiyanova I Irobi J Van Den Bosch L Dierick I Leung CL Schagina O Verpoorten N Van Impe K Fedotov V et al.Mutant small heat-shock protein 27 causes axonal Charcot-Marie-Tooth disease and distal hereditary motor neuropathy.Nat Genet. 2004; 36: 602-606Crossref PubMed Scopus (475) Google Scholar, 8Irobi J Van Impe K Seeman P Jordanova A Dierick I Verpoorten N Michalik A De Vriendt E Jacobs A Van Gerwen V et al.Hot-spot residue in small heat-shock protein 22 causes distal motor neuropathy.Nat Genet. 2004; 36: 597-601Crossref PubMed Scopus (344) Google Scholar, 9Windpassinger C Auer-Grumbach M Irobi J Patel H Petek E Horl G Malli R Reed JA Dierick I Verpoorten N et al.Heterozygous missense mutations in BSCL2 are associated with distal hereditary motor neuropathy and Silver syndrome.Nat Genet. 2004; 36: 271-276Crossref PubMed Scopus (290) Google Scholar All encode proteins that are directly or indirectly involved in two important intracellular pathways: axonal transport and RNA processing.10James PA Talbot K The molecular genetics of non-ALS motor neuron diseases.Biochim Biophys Acta. 2006; 1762: 986-1000Crossref PubMed Scopus (37) Google Scholar, 11Van Den Bosch L Timmerman V Genetics of motor neuron disease.Curr Neurol Neurosci Rep. 2006; 6: 423-431Crossref PubMed Scopus (19) Google Scholar Elsewhere, we described a novel clinical variant of autosomal recessive LMND with childhood onset in a large inbred family originating from Mali.12Maystadt I Zarhrate M Leclair-Richard D Estournet B Barois A Renault F Routon M Durand M Lefebvre S Munnich A et al.A gene for autosomal recessive lower motor neuron disease with childhood onset maps to 1p36.Neurology. 2006; 67: 120-124Crossref PubMed Scopus (10) Google Scholar Affected individuals presented with generalized muscle weakness and atrophy with denervation and normal sensation. Bulbar symptoms and pyramidal signs were absent. In four of the five affected children, the outcome was severe, with loss of walking and the need for permanent respiratory assistance before adulthood. Genetic analyses with the use of a homozygosity mapping strategy assigned this LMND locus to a 3.9-cM (or 1.5-Mb) interval on chromosome 1p36, between loci D1S508 and D1S2633 (Zmax=3.79 at θ=0.00 at locus D1S253). Here, we report the identification of the Pleckstrin homology domain–containing, family G member 5 gene, PLEKHG5 (accession number NM_020631), located within the candidate region, which is mutated in this pedigree. Elsewhere, we reported the linkage data on the African family.12Maystadt I Zarhrate M Leclair-Richard D Estournet B Barois A Renault F Routon M Durand M Lefebvre S Munnich A et al.A gene for autosomal recessive lower motor neuron disease with childhood onset maps to 1p36.Neurology. 2006; 67: 120-124Crossref PubMed Scopus (10) Google Scholar Informed consent was obtained from all family members, and the study was approved by the ethics committee of the Catholic University of Louvain. We isolated genomic DNA (gDNA) from blood samples, using standard protocols. We performed genotyping for microsatellites as described elsewhere.12Maystadt I Zarhrate M Leclair-Richard D Estournet B Barois A Renault F Routon M Durand M Lefebvre S Munnich A et al.A gene for autosomal recessive lower motor neuron disease with childhood onset maps to 1p36.Neurology. 2006; 67: 120-124Crossref PubMed Scopus (10) Google Scholar We used the Primer3 program to design PCR primers that flanked all exons of candidate genes, on the basis of the chromosome 1 draft human sequence. Details on PLEKHG5 primers are given in table 1. We performed direct sequencing, using the dideoxy chain-termination method (ABI Big Dye 3.1) on a 3100 automated sequencer (ABI Prism [Applied Biosystems]) in accordance with standard procedures and the manufacturer’s recommendations. The mutation was verified bidirectionally on gDNA and cDNA. We extracted whole mRNA from fibroblast cell lines of patients (RNeasy [Qiagen]), and we obtained cDNA products by RT-PCR, using oligo(dT) and random hexamers (Transcriptor First Strand cDNA Synthesis Kit [Roche]).Table 1.PLEKHG5 Primers Used for gDNA and cDNA Sequencing Analyses, Plasmid Constructions, and Real-Time RT-PCRPrimer Sequence (5′→3′)Analysis and Exon (GenBank Accession Number)ForwardReversegDNA: Exon 1 (NM_198681)TCTGTGGTGTTGCTTTCCTGGCCTGCAAGTGGCTCTTAAA Exon 1 (NM_020631)TCAGAGTTCCCTTGCAGCTTGGGACCAGTCACTTCCAGAG Exon 1 (NM_001042663)TGGAAACTGACCTCGGAGACCCCGGAGGAGGTTAGGAG Exon 1 (NM_001042664)GCGCGGCTACCGTAATTCTTCTGTCCATCGGTTTAGGG Exon 1 (NM_001042665)GCTCCACAGTCTCCAAGGTGGGACTCCACACCCCTACCTC Exon 2 (NM_198681)TGAAGGGAGGACTGAGGAGATCTGTGGATAGCTGGTGCTG Exon 3 (NM_198681)ATCCAGCAGAGGGGAAACTTTCCTTATGACGCCCTAGCAC Exon 4 (NM_198681)TAACAGGCTGTGGTCCCTCTTCTGCCCATCAGCCTTACTT Exon 5 (NM_198681)AGACCAGGTACCGTTCGATGGATCTCCCAGACCTCTGCAC Exon 6 (NM_198681)AATGAGGGCGGTGAGGAGTGGCTCCTGCATACATGATT Exon 7 (NM_198681)CCGCCTGGTTCTAACACACAGCATCCAGCAGAGACACCT Exon 8 (NM_198681)CCTCCTCCACCAGACCAGCCATTTTCCAGAAGGGACAA Exon 9 (NM_198681)AGAGATGCAGAGACCCTCCTCCCAGCTGCTCCATCTTGTCT Exon 10 (NM_198681)CAGTGGCAGCACCAACACTGGTAACAGTGGCCTCTTTGG Exon 11 (NM_198681)TTGCATGCAGGTTGCTTATCGCAGCCCTTGTCTGACTTTC Exon 12 (NM_198681)TTCTTATCCGTGGCTGCTGTCCCTCCTTCCTGGTACCTCA Exon 13 (NM_198681)GGGTGAGGTACCAGGAAGGATCGTAATTCCTCACCCTTGG Exon 14 (NM_198681)GCCCAAGTGCAGTAAGGAAGGTCCAGGGTCCCGTCCTC Exon 15 (NM_198681)GAGGACGGGACCCTGGACAGCTTCAGGTCCAGGGTCAT Exon 16 (NM_198681)AAGTCGGTGCTGAGGAAGACGCCAGAGACTGACTCCCATC Exon 17 (NM_198681)TGCCTAGCTGAGATGGGAGTGGGACTGCAGAGCTGAGAAC Exon 18 (NM_198681)GTTCATGGTGGGAGGAGTGTGGGTACATGGGACAGAATGG Exon 19 (NM_198681)GTTCATGGTGGGAGGAGTGTGGGTACATGGGACAGAATGG Exon 20 (NM_198681)GCTGGGTGGACACCATTTACCAGCTACCACGAATGGATCA Exon 21.1 (NM_198681)CAGGAGGGCAGAGGGTATAATAATACCTGGGGCTGGAACA Exon 21.2 (NM_198681)CCCCACCTGCTCAAGTCTAAGATGCTCCCAGGCATGAGT Exon 22 (NM_198681)GAAGAGAGGGTGACCAGAGCGCAAAGGACTCTTCCCAGTGcDNA: Exons 1–3 (NM_198681)TCTGTGGTGTTGCTTTCCTGATAATGCATGGTGCTGTGGA Exons 2–7 (NM_198681)CCGCTGAAAAGAAGGGACTCTGTAGGCCTCGAAGGTGAG Exons 6–9 (NM_198681)GTCCCAGCCATGAAGAAGAACAGTGTTGGTGCTGCCACT Exons 8–11 (NM_198681)CTCCAAGTCCCTGAGTTTGCACCCGCAGTTTCCTGATGTA Exons 10–15 (NM_198681)CTGGGAGGAGGAGTACGATGGTCTTCCTCAGCACCGACTT Exons 14–18 (NM_198681)CGCTCTTCAAGCCCTACATCCAACAGCAGATCCGTGAAGA Exons 17–21 (NM_198681)TCTGCACCTGGACTTGACAGaPrimers used for plasmids constructions.CCAGGCTCTACCACAACCATaPrimers used for plasmids constructions. Exons 20–21 (NM_198681)AGCAGGAGGAGGAAGAGGAGTAATACCTGGGGCTGGAACA Exons 21–22 (NM_198681)CCCCACCTGCTCAAGTCTAACTCCTCCACTCCATCCAGTC Exon 22 (NM_198681)TGCTTCAGCTACTGCCTCCTGGGAACTGGGCAGATTCAGRT-PCR: Exons 18–20 (NM_198681)GCTACGGGACCCTGGGTCTTGCAGCTGGTTCTGGGCAa Primers used for plasmids constructions. Open table in a new tab PLEKHG5 full-ORF expression clones, containing the complete coding cDNA for isoforms BC042606 or BC015231, were sequence verified (Deutsches Ressourcenzentrum für Genomforschung [RZPD]). To introduce the c.1940 T→C amino acid substitution in the PLEKHG5 plasmids, we amplified cDNA of the patients with primers framing the mutation (table 1). We then restricted the mutated cDNA amplification product and the full-ORF expression clones with two single-cut endonucleases, BstEII and PflMI (New England Biolabs). After ligation, we screened for the presence of the mutated insert, and we verified the absence of additional mutation by sequencing analysis. pCMVlacZ plasmid was constructed by insertion of the Escherichia coli lacZ coding region into the multiple cloning site of pCMX-PL1.13Matis C Chomez P Picard J Rezsohazy R Differential and opposed transcriptional effects of protein fusions containing the VP16 activation domain.FEBS Lett. 2001; 499: 92-96Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar HEK293 cells (human embryonic kidney 293 cells) and MCF10A cells (human mammary epithelial cells) were maintained at 37°C in a humidified 5% CO2 atmosphere, in Dulbecco's modified Eagle medium (DMEM) F12 (Invitrogen) supplemented with 5% (for MCF10A) or 10% (for HEK293) horse serum (Cambrex), 100 IU/ml penicillin, and 100 μg/ml streptomycin (Sigma). Also added to the medium for MCF10A cells was 0.1 μg/ml cholera toxin (Calbiochem), 10 μg/ml insulin (Invitrogen), 0.5 μg/ml hydrocortisone (Sigma), and 20 ng/ml human epidermal growth factor (Invitrogen). Before transfection, exponentially proliferating cells were trypsinized, and 1.6×105 MCF10A cells or 2.6×105 HEK293 cells were plated in each well of a 6-well plate. Twenty-four hours after plating, cells were transfected using 3 μl of Fugene 6 (Roche) in accordance with the manufacturer’s instructions. For luciferase-reporter gene assays and real-time RT-PCR analyses, 0.5 μg of the expression vectors was transfected together with 1 μg of the reporter plasmid (nuclear factor κB [NFκB] cis-reporting system [Stratagene]) and with 20 ng of constitutive reporter plasmid (pCMVlacZ) for luciferase activity normalization. Expression vectors were replaced by 50 ng of pFC-MEKK (Stratagene) and 0.5 μg of carrier DNA (pCat), to provide a positive control for NFκB activation. For western-blot analyses and immunofluorescence studies, cells were transfected with 1.5 μg of expression vector DNA. NSC34 cells (a mouse embryonic spinal cord–neuroblastoma cell line with a motor neuron phenotype, kindly provided by Dr. Neil Cashman, University of Toronto14Cashman NR Durham HD Blusztajn JK Oda K Tabira T Shaw IT Dahrouge S Antel JP Neuroblastoma × spinal cord (NSC) hybrid cell lines resemble developing motor neurons.Dev Dyn. 1992; 194: 209-221Crossref PubMed Scopus (524) Google Scholar) were cultured at 37°C under 5% CO2 and 95% air in DMEM supplemented with 10% fetal calf serum. NSC34 cells in a 24-well plate were transfected with either the wild-type or the mutant PLEKHG5 plasmids with use of Lipofectamine (Invitrogen). The transfection efficacy was controlled using cotransfection with a green fluorescent protein (GFP)–expressing plasmid. Cells were harvested 48 h after transfection. Lysis and enzymatic activity dosages were performed with the β-Gal Reporter Gene Assay (chemiluminescent) kit (Roche) and the Luciferase Reporter Gene assay (high-sensitivity) kit (Roche). Total RNA was isolated 48 h after transfection and was purified using the Trizol procedure (Invitrogen) in accordance with the manufacturer’s instructions. cDNA was transcribed from 3 μg of total RNA by use of random hexamers and M-MLV Reverse Transcriptase (Invitrogen), in the presence of RNase inhibitor (Promega). Quantitative real-time RT-PCR amplification was performed on cDNA by use of the qPCR Master Mix Plus for SYBR Green I (Eurogentec) in the presence of PLEKHG5-specific primers (Eurogentec) (table 1). The measurement of the β2 microglobulin gene provided an amplification control that allowed PLEKHG5 expression to be normalized. Each reaction was performed in triplicate, by use of an MX3000P Real-Time PCR System (Stratagene). Polyclonal antibodies to PLEKHG5 were obtained by immunization of two rabbits with two synthesized specific peptides (NH2-CYLRVKAPAKPGDEG-CONH2 and NH2-CKVDIYLDQSNTPLSL-CONH2) and were purified on a sepharose column (Covalab). High reactivity of immunopurified antibodies was confirmed by ELISA. Proteins were harvested 48 h after transfection. Cells were washed three times with ice-cold PBS and then were lysed in 0.32 M sucrose or in lysis buffer (10 mM Hepes [pH 7.8], 10 mM KCl, 2 mM MgCl2, 0.1 mM EDTA, and 1 mM dithiothreitol) and 10% Nonidet P40 (Sigma), with the addition of the Protease Inhibitors cocktail (Roche). Cell extracts were boiled for 5 min in Laemmli buffer and were submitted to a 7.5% SDS-PAGE. Proteins were electroblotted onto nitrocellulose membranes. After electroblotting, membranes were treated with 5% dry milk in TBS buffer (50 mM Tris [pH 8.1] and 150 mM NaCl) containing 0.05% Tween-20, for 1 h at room temperature, and then were hybridized overnight at 4°C with anti-PLEKHG5 antibodies (1:1,000) diluted in blocking solution. The antigen-antibody complexes were revealed by secondary incubation with horseradish peroxidase–coupled goat anti-rabbit immunoglobulin G antibodies (1:10,000 [Sigma]). Immunoreactive proteins were visualized using enhanced chemiluminescence reagents (Perkin Elmer). Hybridization with β-actin antibody (1:1,000 [Sigma]) was performed as a control. Transfected HEK293 and MCF10A cells were fixed in 4% formaldehyde 48 h after transfection. We permeabilized cells with 1% Triton X-100 in PBS for 15 min and blocked aspecific fixation sites in 5% nonfat milk for 2 h at room temperature. Cells were incubated with anti-PLEKHG5 polyclonal antibodies (1:100) for 1 h and then with fluorescein isothiocyanate–conjugated goat anti-rabbit antibody (1:1,000 [Sigma]) for an additional 1 h. Cells were examined using a Zeiss Axioplan 2 imaging microscope equipped with ISIS 3 software (MetaSystem). Transfected NSC34 murine cells were treated for PLEKGH5 immunofluorescence with the polyclonal anti-PLEKGH5 antibody (1:100) coupled with diamidino-4′,6-phenylindole-2 dichlorhydrate staining of the nuclei. Cells were incubated with the primary anti-PLEKHG5 antibody (1:100) overnight, followed by a rhodamine (A-594)–conjugated anti-rabbit secondary antibody (1:800 [Invitrogen]) for an additional 1 h. PLEKGH5- and GFP-coexpressing cells were observed using confocal analysis (Leica). P values were calculated by Welch’s t test, by use of R software (version 2.3.0.). We sequenced the 25 candidate and predicted genes located in the 3.9-cM mapped interval on chromosome 1p36 (NPHP4, KCNAB2, CHD5, RPL22, RNF207, C1orf188, ICMT, C1orf211, HES3, GPR153, ACOT7, HES2, ESPN, TNFRSF25, PLEKHG5, NOL9, TAS1R1, HKR3, KLHL21, PHF13, THAP3, DNAJC11, CAMTA1, AK098599, and AK128074), as well as two additional candidate genes known to cause Charcot-Marie-Tooth disease (CMT) and located very close to this chromosomal region (MFN2 and KIF1Bβ) (fig. 1a). In the five affected members of the Malian family, we found a homozygous mutation (c.1940 T→C) resulting in an amino acid substitution (p.647 Phe→Ser) in the pleckstrin homology (PH) domain of the PLEKHG5 protein (fig. 1c). The mutation was not detected in 300 healthy controls (600 chromosomes), of whom 250 originated from Mali (500 chromosomes). The mutant phenylalanine is highly conserved across species and is a canonical amino acid residue of the PH consensus sequence (fig. 1d and 1e). We then screened PLEKHG5 in a sample of four unlinked families and 16 isolated patients with a close phenotype, but we identified no additional mutations. PLEKHG5 spans 53,917 bp on human chromosome 1 and codes for a member of the Dbl protein family that shares a PH domain and a guanine nucleotide exchange factor for Rho protein (RhoGEF) domain.16Whitehead IP Campbell S Rossman KL Der CJ Dbl family proteins.Biochem Biophys Acta. 1997; 1332: F1-F23PubMed Google Scholar Interestingly, it has been suggested elsewhere that the PLEKHG5 protein has an NFκB-activating function.17Matsuda A Suzuki Y Honda G Muramatsu S Matsuzaki O Nagano Y Doi T Shimotohno K Harada T Nishida E et al.Large-scale identification and characterization of human genes that activate NF-κB and MAPK signaling pathways.Oncogene. 2003; 22: 3307-3318Crossref PubMed Scopus (323) Google Scholar Five mRNA isoforms annotated by National Center for Biotechnology Information (NCBI) genome browser and two Mammalian Gene Collection Full ORF mRNAs have been reported to code for proteins that mainly differ by their N-terminal end (accession numbers NM_020631, NM_198681, NM_001042663, NM_001042664, NM_001042665, BC042606, and BC015231) (fig. 1b). According to microarray databases (UniGene, Expression Profile Viewer), PLEKHG5 is ubiquitously expressed, but predominantly in the peripheral nervous system and brain. Using western blotting and immunofluorescence, we failed to detect endogenous PLEKHG5 protein in various human cells (fibroblastic cell lines, lymphoblastoid cell lines, cultured amniocytes, and cultured primary hepatocytes) (data not shown). However, using real-time quantitative RT-PCR, we confirmed the ubiquitous expression of PLEKHG5 in the human nervous system, with a predominance in peripheral nerve and spinal cord (fig. 2). To further investigate the impact of the c.1940 T→C mutation, two isoforms of PLEKHG5 (BC042606 and BC015231) (fig. 1b) were transfected in HEK293 and MCF10A cell lines. The wild-type PLEKHG5 protein was not visualized by western blotting or immunofluorescence before transfection. By contrast, after transfection of expression vectors encoding wild-type BC015231 and BC042606 isoforms, we detected protein fragments of 130 and 150 kDa in cell lysates, using polyclonal rabbit anti-PLEKHG5 antibodies (fig. 3a). In addition, immunofluorescence analysis revealed that wild-type PLEKHG5 proteins were diffusely localized in cytoplasm (fig. 3b). On the contrary, in cells transfected with the corresponding c.1940 T→C mutant constructs, mutant PLEKHG5 proteins were consistently undetectable by western blotting, suggesting an instability of the mutant variants (fig. 3a). By immunofluorescence, mutant PLEKHG5 proteins were not detected with a classic exposure time (0.04 s). However, a light, diffuse cytoplasmic signal could be detected after a longer exposure time (0.34 s) (fig. 3b). The two isoforms of PLEKHG5 were then tested for their ability to activate the NFκB pathway. HEK293 and MCF10A cell lines were transfected with a luciferase-reporter gene responsive to NFκB, together with expression vectors encoding either wild-type or c.1940 T→C mutated PLEKHG5 cDNAs. Although the PLEKHG5 transcript was barely detected in untransfected control cells by use of real-time quantitative RT-PCR, its abundance increased up to 1,000-fold after transfection in cells transfected with either wild-type or mutant PLEKHG5 variants (fig. 4). Consistently, the luciferase activity was more than sixfold higher in the wild-type PLEKHG5–transfected cells than in the control cells. By contrast, induction of the luciferase activity was markedly reduced in cells transfected with the mutant isoforms (fig. 5a), therefore demonstrating that the amino acid substitution severely impaired PLEKHG5 ability to activate the NFκB pathway. This loss of activity clearly reflects, at least in part, the instability of the mutant protein.Figure 5.Comparison between wild-type (WT) and mutated PLEKHG5 activity on the NFκB signaling pathway. a, Reporter construct consisting of the luciferase gene placed under control of a promoter containing the consensus NFκB binding sites (Stratagene), transfected in HEK293 or MCF10A cells alone (Control), in combination with expression vectors for wild-type and mutated PLEKHG5 proteins (BC015231 and BC042606), or in combination with expression vector for a positive control of NFκB activation (pFC-MEKK). Values are expressed as fold activation over transfection of the reporter plasmid alone. Bars indicate the SD of five independent experiments. The differences between wild-type and mutated PLEKHG5 are statistically significant according to Welch’s t test. b, Schematic representation of the plasmid constructions (see the “Subjects and Methods” section). Untransf. = untransfected. PCMV = CMV promoter; TATA = TATA box.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Finally, we transiently transfected murine motor neuronal NSC34 cells with the two wild-type BC015231 and BC042606 isoforms and the corresponding mutant constructs. Western-blotting experiments confirmed the instability of the mutant PLEKHG5 proteins, which accumulated to much lower level than that of the wild-type proteins (fig. 3c). Detection of the mutant PLEKHG5 proteins by immunofluorescence revealed formation of aggregates in the motor neuron somas close to the nucleus in the majority (60%–70%) of the transfected cells (fig. 3d). This was observed neither in NSC34 cells transfected with the wild-type counterparts nor in nontransfected cells. In conclusion, transfection experiments using PLEKHG5 variants in distinct cellular models supported instability and loss of NFκB-activating function of the mutant PLEKHG5 proteins and revealed their involvement in aggregate formation in transfected murine motor neuron cells. The mechanism by which the mutation in the PH domain of PLEKHG5 leads to an autosomal recessive, generalized LMND is unclear. PH domains are protein modules of ∼100 aa, found in a wide range of eukaryotic proteins, many of which are involved in cell signaling and cytoskeletal regulation. They play a membrane-anchoring function because of their ability to bind to phosphoinositides.18Harlan JE Hajduk PJ Yoon HS Fesik SW Pleckstrin homology domains bind to phosphatidylinositol-4,5-bisphosphate.Nature. 1994; 371: 168-170Crossref PubMed Scopus (659) Google Scholar In Dbl-family proteins, including PLEKHG5, PH domains also independently contribute to the allosteric regulation of the RhoGEF domain. This latter domain activates GTPases by stimulating the exchange of GDP to GTP, thereby initiating various signaling mechanisms that regulate neuronal shape and plasticity, dendrite growth, synapse formation, and neuronal survival.19van Leeuwen FN Kain HET van der Kammen RA Michiels F Kranenburg OW Collard JG The guanine nucleotide exchange factor Tiam1 affects neuronal morphology: opposing roles for the small GTPases Rac and Rho.J Cell Biol. 1997; 139: 797-907Crossref PubMed Scopus (313) Google Scholar, 20Estrach S Schmidt S Diriong S Penna A Blangy A Fort P Debant A The human Rho-GEF trio and its target GTPase RhoG are involved in the NGF pathway, leading to neurite outgrowth.Curr Biol. 2002; 12: 307-312Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 21May V Schiller MR Eipper BA Mains RE Kalirin Dbl-homology guanine nucleotide exchange factor 1 domain initiates new axon outgrowths via RhoG-mediated mechanisms.J Neurosci. 2002; 22: 6980-6990Crossref PubMed Google Scholar, 22Nahm M Lee M Baek SH Yoon JH Kim HH Lee ZH Lee S Drosophila RhoGEF4 encodes a novel RhoA-specific guanine exchange factor that is highly expressed in the embryonic central nervous system.Gene. 2006; 384: 139-144Crossref PubMed Scopus (6) Google Scholar Recent experiments show that mutations in the PH domain, impairing phosphoinositide binding, do not systematically affect protein subcellular localization. However, in all cases, these mutations significantly reduce the guanine nucleotide exchange activity of the Dbl proteins.23Baumeister MA Rossman KL Sondek J Lemmon MA The Dbs PH domain contributes independently to membrane targeting and regulation of guanine nucleotide-exchange activity.Biochem J. 2006; 400: 563-572Crossref PubMed Scopus (37) Google Scholar Two proteins sharing a PH domain or a PH/RhoGEF domain have already been shown to account for human neurodegenerative diseases: Dynamin 2 (encoded by DNM2) and alsin (encoded by ALS2). Mutations of the PH domain of Dynamin 2 have been reported in CMT, dominant intermediate B (DI-CMTB [MIM 606482]), whereas mutations outside the PH domain are responsible for a dominant myopathic phenotype (centronuclear myopathy [MIM 160150]), suggesting that the PH domain could be specifically involved in motor neuron maintenance.24Bitoun M Maugenre S Jeannet PY Lacene E Ferrer X Laforet P Martin JJ Laporte J Lochmuller H Beggs AH et al.Mutations in dynamin 2 cause dominant centronuclear myopathy.Nat Genet. 2005; 37: 1207-1209Crossref PubMed Scopus (308) Google Scholar, 25Züchner S Noureddine M Kennerson M Verhoeven K Claeys K De Jonghe P Merory J Oliveira SA Speer MC Stenger JE et al.Mutations in the pleckstrin homology domain of dynamin 2 cause dominant intermediate Charcot-Marie-Tooth disease.Nat Genet. 2005; 37: 289-294Crossref PubMed Scopus (272) Google Scholar Mutations in ALS2 have been described in three overlapping autosomal recessive diseases: juvenile amyotrophic lateral sclerosis (ALS2 [MIM 205100]), infantile-onset ascending spastic paraplegia (IAHSP [MIM 607225]), and juvenile primary lateral sclerosis (PLS [MIM 606353]).26Hadano S Hand CK Osuga H Yanagisawa Y Otomo A Devon RS Miyamoto N Showguchi-Miyata J Okada Y Singaraja R et al.A gene encoding a putative GTPase regulator is mutated in familial amyotrophic lateral sclerosis 2.Nat Genet. 2001; 29: 166-173Crossref PubMed Scopus (557) Google Scholar, 27Yang Y Hentati A Deng HX Dabbagh O Sasaki T Hirano M Hung WY Ouahchi K Yan J Azim AC et al.The gene encoding alsin, a protein with three guanine-nucleotide exchange factor domains, is mutated in a form of recessive amyotrophic lateral sclerosis.Nat Genet. 2001; 29: 160-165Crossref PubMed Scopus (633) Google Scholar, 28Eymard-Pierre E Lesca G Dollet S Santorelli FM di Capua M Bertini E Boespflug-Tanguy O Infantile-onset ascending hereditary spastic paralysis is associated with mutations in the alsin gene.Am J Hum" @default.
• W1983491627 created "2016-06-24" @default.
• W1983491627 creator A5008344044 @default.
• W1983491627 creator A5011167266 @default.
• W1983491627 creator A5012584706 @default.
• W1983491627 creator A5013955855 @default.
• W1983491627 creator A5016308029 @default.
• W1983491627 creator A5025144780 @default.
• W1983491627 creator A5029002217 @default.
• W1983491627 creator A5030820510 @default.
• W1983491627 creator A5038401549 @default.
• W1983491627 creator A5045613818 @default.
• W1983491627 creator A5055645621 @default.
• W1983491627 creator A5084264544 @default.
• W1983491627 date "2007-07-01" @default.
• W1983491627 modified "2023-10-10" @default.
• W1983491627 title "The Nuclear Factor κB–Activator Gene PLEKHG5 Is Mutated in a Form of Autosomal Recessive Lower Motor Neuron Disease with Childhood Onset" @default.
• W1983491627 cites W1536408199 @default.
• W1983491627 cites W1537390295 @default.
• W1983491627 cites W1586118899 @default.
• W1983491627 cites W1790229678 @default.
• W1983491627 cites W1925995047 @default.
• W1983491627 cites W1966260633 @default.
• W1983491627 cites W1972380090 @default.
• W1983491627 cites W1979535750 @default.
• W1983491627 cites W1980477780 @default.
• W1983491627 cites W1984979116 @default.
• W1983491627 cites W1986972844 @default.
• W1983491627 cites W1994953412 @default.
• W1983491627 cites W1995229221 @default.
• W1983491627 cites W2002559713 @default.
• W1983491627 cites W2007669066 @default.
• W1983491627 cites W2010233410 @default.
• W1983491627 cites W2011815143 @default.
• W1983491627 cites W2014070531 @default.
• W1983491627 cites W2016009049 @default.
• W1983491627 cites W2019313913 @default.
• W1983491627 cites W2019854747 @default.
• W1983491627 cites W2024153744 @default.
• W1983491627 cites W2027608016 @default.
• W1983491627 cites W2031248158 @default.
• W1983491627 cites W2040724884 @default.
• W1983491627 cites W2045780729 @default.
• W1983491627 cites W2046439284 @default.
• W1983491627 cites W2064253775 @default.
• W1983491627 cites W2067510196 @default.
• W1983491627 cites W2074549723 @default.
• W1983491627 cites W2080590768 @default.
• W1983491627 cites W2088882706 @default.
• W1983491627 cites W2098189071 @default.
• W1983491627 cites W2099731590 @default.
• W1983491627 cites W2101564286 @default.
• W1983491627 cites W2104483408 @default.
• W1983491627 cites W2107768418 @default.
• W1983491627 cites W2113221012 @default.
• W1983491627 cites W2123120172 @default.
• W1983491627 cites W2123779560 @default.
• W1983491627 cites W2123939448 @default.
• W1983491627 cites W2127835108 @default.
• W1983491627 cites W2130741221 @default.
• W1983491627 cites W2132840216 @default.
• W1983491627 cites W2133970156 @default.
• W1983491627 cites W2138759930 @default.
• W1983491627 cites W2140886941 @default.
• W1983491627 cites W2146003518 @default.
• W1983491627 cites W2149646530 @default.
• W1983491627 cites W2149761960 @default.
• W1983491627 cites W2150150063 @default.
• W1983491627 cites W2156310219 @default.
• W1983491627 cites W2160529952 @default.
• W1983491627 cites W2164348385 @default.
• W1983491627 cites W2166731929 @default.
• W1983491627 cites W2167113152 @default.
• W1983491627 cites W2168091755 @default.
• W1983491627 cites W2172055712 @default.
• W1983491627 cites W40684838 @default.
• W1983491627 cites W45764662 @default.
• W1983491627 doi "https://doi.org/10.1086/518900" @default.
• W1983491627 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1950913" @default.
• W1983491627 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17564964" @default.
• W1983491627 hasPublicationYear "2007" @default.
• W1983491627 type Work @default.
• W1983491627 sameAs 1983491627 @default.
• W1983491627 citedByCount "77" @default.
• W1983491627 countsByYear W19834916272012 @default.
• W1983491627 countsByYear W19834916272013 @default.
• W1983491627 countsByYear W19834916272014 @default.
• W1983491627 countsByYear W19834916272015 @default.
• W1983491627 countsByYear W19834916272016 @default.
• W1983491627 countsByYear W19834916272017 @default.
• W1983491627 countsByYear W19834916272018 @default.
• W1983491627 countsByYear W19834916272019 @default.
• W1983491627 countsByYear W19834916272020 @default.
• W1983491627 countsByYear W19834916272021 @default.
• W1983491627 countsByYear W19834916272022 @default.
• W1983491627 countsByYear W19834916272023 @default.
• W1983491627 crossrefType "journal-article" @default.
• W1983491627 hasAuthorship W1983491627A5008344044 @default.

• next