FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1985384612> ?p ?o ?g. }

• W1985384612 endingPage "35192" @default.
• W1985384612 startingPage "35183" @default.
• W1985384612 abstract "Supressor of cytokine signaling (SOCS)-1 is selectively and rapidly induced by appropriate agonists and modulates cytokine responses by interfering with the Janus kinase/signal transducer and activator of transcription (Jak/STAT) pathway. On the basis of the observation that interleukin (IL)-4 up-regulates Socs-1 in the keratinocyte HaCaT cell line, we investigated which sequences of the 5′-Socs-1 gene are responsive to IL-4. We therefore have cloned the 5′-flanking region of this gene, and by promoter analysis we identified a functional IL-4-responsive element located at nucleotide (–684/–570) upstream from the transcription initiation site, whose presence and integrity are necessary to ensure IL-4 responsiveness. This element contains three STAT6 and one Ets consensus binding sequences of which specific mutations abolished IL-4 responsiveness either partially or totally. We also report that Ets-1 physically interacted with STAT6. Exogenous expression of Ets-1 in conjunction with STAT6 activation strongly inhibited expression of a Socs-1 promoter-luciferase reporter. Collectively, our data demonstrated the involvement of STAT6 and Ets, via a composite DNA element, in the IL-4 regulation of Socs-1 gene expression in keratinocytes. Supressor of cytokine signaling (SOCS)-1 is selectively and rapidly induced by appropriate agonists and modulates cytokine responses by interfering with the Janus kinase/signal transducer and activator of transcription (Jak/STAT) pathway. On the basis of the observation that interleukin (IL)-4 up-regulates Socs-1 in the keratinocyte HaCaT cell line, we investigated which sequences of the 5′-Socs-1 gene are responsive to IL-4. We therefore have cloned the 5′-flanking region of this gene, and by promoter analysis we identified a functional IL-4-responsive element located at nucleotide (–684/–570) upstream from the transcription initiation site, whose presence and integrity are necessary to ensure IL-4 responsiveness. This element contains three STAT6 and one Ets consensus binding sequences of which specific mutations abolished IL-4 responsiveness either partially or totally. We also report that Ets-1 physically interacted with STAT6. Exogenous expression of Ets-1 in conjunction with STAT6 activation strongly inhibited expression of a Socs-1 promoter-luciferase reporter. Collectively, our data demonstrated the involvement of STAT6 and Ets, via a composite DNA element, in the IL-4 regulation of Socs-1 gene expression in keratinocytes. Interleukin (IL) 1The abbreviations used are: IL, interleukin, EBS, Ets binding site; HA, hemagglutinin; IL-4RE, IL-4 responsive element; Jak, Janus kinase; RT-PCR, reverse transcription-PCR; SBE, STAT6-binding element; pSBE, proximal SBE; mSBE, median SBE; dSBE, distal SBE; SH2, Src homology; CBP, CREB-binding protein; SOCS, suppressor of cytokine signaling; STAT, signal transducer and activator of transcription; pol, polymerase; mut, mutated.1The abbreviations used are: IL, interleukin, EBS, Ets binding site; HA, hemagglutinin; IL-4RE, IL-4 responsive element; Jak, Janus kinase; RT-PCR, reverse transcription-PCR; SBE, STAT6-binding element; pSBE, proximal SBE; mSBE, median SBE; dSBE, distal SBE; SH2, Src homology; CBP, CREB-binding protein; SOCS, suppressor of cytokine signaling; STAT, signal transducer and activator of transcription; pol, polymerase; mut, mutated.-4 is a pleotropic cytokine, which displays a variety of biological responses by binding to high affinity receptor complexes. IL-4 receptors are expressed on a wide variety of cells of hematopoietic or non-hematopoietic origin. Among the latter, epidermal keratinocytes, which represent the major cell type of the skin, have been shown to be IL-4-responsive cells.Many studies have focused on the mechanisms by which IL-4 exerts its action. The Jak-STAT pathway has been shown to be activated by IL-4. Activation of JAK1 and JAK2 or 3, depending on the cell lines, is pivotal for the activation of downstream signaling events including the recruitment and rapid tyrosine phosphorylation of STAT6 (1Wery-Zennaro S. Letourneur M. David M. Bertoglio J. Pierre J. FEBS Lett. 1999; 464: 91-96Crossref PubMed Scopus (36) Google Scholar, 2Witthuhn B.A. Silvennoinen O. Miura O. Lai K.S. Cwik C. Liu E.T. Ihle J.N. Nature. 1994; 370: 153-157Crossref PubMed Scopus (533) Google Scholar, 3Kawamura M. McVicar D.W. Johnston J.A. Blake T.B. Chen Y.Q. Lal B.K. Lloyd A.R. Kelvin D.J. Staples J.E. Ortaldo J.R. O'Shea J.J. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6374-6378Crossref PubMed Scopus (238) Google Scholar, 4Musso T. Johnston J.A. Linnekin D. Varesio L. Rowe T.K. O'Shea J.J. McVicar D.W. J. Exp. Med. 1995; 181: 1425-1431Crossref PubMed Scopus (106) Google Scholar). STAT6 can dimerize and translocate into the nucleus where it regulates IL-4 target genes. STAT6-deficient mice underlined the importance of this factor in gene expression and Th cell differentiation, and indicated that most IL-4-mediated functions are lost in the absence of STAT6 (5Kaplan M.H. Schindler U. Smiley S.T. Grusby M.J. Immunity. 1996; 4: 313-319Abstract Full Text Full Text PDF PubMed Scopus (1323) Google Scholar, 6Shimoda K. van Deursen J. Sangster M.Y. Sarawar S.R. Carson R.T. Tripp R.A. Chu C. Quelle F.W. Nosaka T. Vignali D.A. Doherty P.C. Grosveld G. Paul W.E. Ihle J.N. Nature. 1996; 380: 630-633Crossref PubMed Scopus (1104) Google Scholar, 7Takeda K. Tanaka T. Shi W. Matsumoto M. Minami M. Kashiwamura S. Nakanishi K. Yoshida N. Kishimoto T. Akira S. Nature. 1996; 380: 627-630Crossref PubMed Scopus (1262) Google Scholar). In addition, the use of ectopic expression of STAT6 variants in cells have also emphasized its role in transcription regulation. The IL-4-induced expression of IL-13 Rα2 receptor chain and eotaxin-3 have been shown clearly to depend on STAT6 activation (8David M. Ford D. Bertoglio J. Maizel A.L. Pierre J. Oncogene. 2001; 20: 6660-6668Crossref PubMed Scopus (78) Google Scholar, 9David M.D. Bertoglio J. Pierre J. Oncogene. 2003; 22: 3386-3394Crossref PubMed Scopus (36) Google Scholar, 10Hoeck J. Woisetschlager M. J. Immunol. 2001; 166: 4507-4515Crossref PubMed Scopus (118) Google Scholar).Responsiveness to cytokines depends upon a balance of positive and negative regulators. Among these regulators SOCS (suppressor of cytokine signaling) proteins have been described as negatively regulating the JAK/STAT pathway. There are at least eight members of the SOCS family, each of which contains a central SH2 domain, an amino-terminal domain of variable length and divergent sequence, and a carboxyl-terminal 40-amino acid module that is known as the SOCS-box (11Hilton D.J. Richardson R.T. Alexander W.S. Viney E.M. Willson T.A. Sprigg N.S. Starr R. Nicholson S.E. Metcalf D. Nicola N.A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 114-119Crossref PubMed Scopus (609) Google Scholar, 12Alexander W.S. Nat. Rev. Immunol. 2002; 2: 410-416Crossref PubMed Scopus (526) Google Scholar). Generally, these proteins are not highly expressed in unstimulated tissues but are induced by stimulation. SOCS proteins regulate the magnitude and duration of responses triggered by various cytokines by inhibiting their signal transduction pathway in a classical negative feedback loop (13Alexander W.S. Starr R. Metcalf D. Nicholson S.E. Farley A. Elefanty A.G. Brysha M. Kile B.T. Richardson R. Baca M. Zhang J.G. Willson T.A. Viney E.M. Sprigg N.S. Rakar S. Corbin J. Mifsud S. DiRago L. Cary D. Nicola N.A. Hilton D.J. J. Leukocyte Biol. 1999; 66: 588-592Crossref PubMed Scopus (98) Google Scholar, 14Yasukawa H. Sasaki A. Yoshimura A. Annu. Rev. Immunol. 2000; 18: 143-164Crossref PubMed Scopus (509) Google Scholar, 15Chen X.P. Losman J.A. Rothman P. Immunity. 2000; 13: 287-290Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). At the molecular level, SOCS proteins have been shown to bind directly to cytokine receptors or to the catalytic domain of JAK kinases and therefore impede the recruitment and phosphorylation of STAT (16Gadina M. Hilton D. Johnston J.A. Morinobu A. Lighvani A. Zhou Y.J. Visconti R. O'Shea J.J. Curr. Opin. Immunol. 2001; 13: 363-373Crossref PubMed Scopus (168) Google Scholar).Among the SOCS protein family, SOCS-1 was independently identified in three laboratories (17Naka T. Narazaki M. Hirata M. Matsumoto T. Minamoto S. Aono A. Nishimoto N. Kajita T. Taga T. Yoshizaki K. Akira S. Kishimoto T. Nature. 1997; 387: 924-929Crossref PubMed Scopus (1128) Google Scholar, 18Endo T.A. Masuhara M. Yokouchi M. Suzuki R. Sakamoto H. Mitsui K. Matsumoto A. Tanimura S. Ohtsubo M. Misawa H. Miyazaki T. Leonor N. Taniguchi T. Fujita T. Kanakura Y. Komiya S. Yoshimura A. Nature. 1997; 387: 921-924Crossref PubMed Scopus (1221) Google Scholar, 19Starr R. Willson T.A. Viney E.M. Murray L.J. Rayner J.R. Jenkins B.J. Gonda T.J. Alexander W.S. Metcalf D. Nicola N.A. Hilton D.J. Nature. 1997; 387: 917-921Crossref PubMed Scopus (1793) Google Scholar). Although the role of SOCS-1 in modulating cytokine signaling has been extensively studied, less is known about the mechanisms that control Socs-1 gene expression. Numerous studies have implicated STAT protein family members in the positive regulation of Socs gene expression (20Auernhammer C.J. Bousquet C. Melmed S. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6964-6969Crossref PubMed Scopus (250) Google Scholar, 21Verdier F. Rabionet R. Gouilleux F. Beisenherz-Huss C. Varlet P. Muller O. Mayeux P. Lacombe C. Gisselbrecht S. Chretien S. Mol. Cell. Biol. 1998; 18: 5852-5860Crossref PubMed Scopus (130) Google Scholar). More recently, after erythropoietin stimulation a positive and negative regulation of Socs-1 and Socs-3 gene expression has been reported implicating STAT5 in erythropoietin-responsive cell lines (22Jegalian A.G. Wu H. J. Biol. Chem. 2002; 277: 2345-2352Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). Socs-1 expression is also controlled through translational repression (23Schluter G. Boinska D. Nieman-Seyde S.C. Biochem. Biophys. Res. Commun. 2000; 268: 255-261Crossref PubMed Scopus (40) Google Scholar, 24Gregorieff A. Pyronnet S. Sonenberg N. Veillette A. J. Biol. Chem. 2000; 275: 21596-21604Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). In addition, transcriptional silencing of Socs-1 gene by hypermethylation was frequently observed in certain cancer cells (25Yoshikawa H. Matsubara K. Qian G.S. Jackson P. Groopman J.D. Manning J.E. Harris C.C. Herman J.G. Nat. Genet. 2001; 28: 29-35Crossref PubMed Google Scholar, 26Galm O. Yoshikawa H. Esteller M. Osieka R. Herman J.G. Blood. 2003; 101: 2784-2788Crossref PubMed Scopus (266) Google Scholar).Socs-1 expression is up-regulated by numerous cytokines and growth factors, among which is IL-4 (17Naka T. Narazaki M. Hirata M. Matsumoto T. Minamoto S. Aono A. Nishimoto N. Kajita T. Taga T. Yoshizaki K. Akira S. Kishimoto T. Nature. 1997; 387: 924-929Crossref PubMed Scopus (1128) Google Scholar, 27Federici M. Giustizieri M.L. Scarponi C. Girolomoni G. Albanesi C. J. Immunol. 2002; 169: 434-442Crossref PubMed Scopus (109) Google Scholar), and is also able to inhibit IL-4 signal transduction (28Losman J.A. Chen X.P. Hilton D. Rothman P. J. Immunol. 1999; 162: 3770-3774PubMed Google Scholar). In this work, we report on the mechanism by which IL-4 regulates Socs-1 expression in human keratinocytes. The establishment of cell lines expressing either a gain-of-function or a transcriptional dominant negative form of STAT6 allowed us to investigate the role of STAT6 in the regulation of SOCS-1 mRNA expression. Moreover, we have cloned the 5′-flanking region of Socs gene and defined its promoter region which contains three STAT6-binding element (SBE). We then provide evidence that STAT6 binding to its distal SBE in the Socs-1 promoter was critical for IL-4-mediated Socs-1 expression. Furthermore, we report that the distal SBE is a composite element, which allows the binding of both STAT6 and Ets transcription factors. These two transcription factors are associated within the cells and transient transfection indicated a cooperation between these two unrelated transcription factors. Altogether these data argue for a novel transcription factor interaction mechanism that may account for SOCS-1 mRNA regulation of expression.EXPERIMENTAL PROCEDURESCell Culture—The human keratinocyte cell line HaCaT (29Boukamp P. Petrussevska R.T. Breitkreutz D. Hornung J. Markham A. Fusenig N.E. J. Cell Biol. 1988; 106: 761-771Crossref PubMed Scopus (3427) Google Scholar) was cultured in Dulbecco's modified Eagle's medium supplemented with antibiotics (50 μg/ml penicillin, 50 μg/ml streptomycin), with 1 mm sodium pyruvate, and 10% fetal calf serum.Cytokine, Antibodies, and Reagents—Human recombinant IL-4, kindly provided by Dr P. Ferrara (Sanofi, France), was added to the culture medium at a final concentration of 10 ng/ml. Anti-STAT6 (S-20), anti-Ets1/2 (C-275), and anti-RNA pol II (N-20) polyclonal antibodies were from Santa Cruz. Anti-Phospho-STAT6 (Tyr-641) polyclonal antibody was from Cell Signaling Technology. Anti-FLAG M2 monoclonal antibody was from Sigma. Anti-Ets antisera directed against Ets-1/2 (number 8), Ets-1 (number 41), and Ets-2 (number 38) were a generous gift of Dr. J. Ghysdael. c-DNA corresponding to hemagglutinin (HA)-p51-Ets-1 was a generous gift of Dr. F. Soncin.PCR Analysis—Total RNA was extracted with Trizol (Invitrogen) as described by the manufacturer and quantified at 260 nm. Total RNA was treated with DNase from Ambion. 2 μg of total cellular RNA was reverse-transcribed using a (dT) oligomer primer and 2 units of avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI) and then used as template for PCR. The specific primers corresponding to the region +919/+1241 of the SOCS-1 c-DNA were 5′-CACGCACTTCCGCACATTCC (forward) and 5′-TCCAGCAGCTCGAAGAGGCA (reverse). PCRs were carried out with 1 unit of Taq polymerase (Qbiogene, Carlsbad, CA) and 5% of Me2SO during 35 cycles of successive incubations at 94 °C (for 30 s), at 55 °C (for 1 min), and at 72 °C (for 1 min). PCR products were run on a 1.5% agarose gel. Real time PCR was performed using a Light Cycler. 1 μl of reverse transcription was amplified with the Socs-1-specific primers and 28S specific primers. Results obtained with SOCS-1-specific primers were normalized against 28S.Plasmids Constructs—The construct encoding FLAG-STAT6 was generated from pCMV-Tag1-STAT6 (8David M. Ford D. Bertoglio J. Maizel A.L. Pierre J. Oncogene. 2001; 20: 6660-6668Crossref PubMed Scopus (78) Google Scholar). The pCMV-Tag1-STAT6 was cut with NheI and HpaI and inserted into the same site in pIRESneo vector (Clontech). The double mutant STAT6VT was prepared by introducing two alanine residues at amino acid positions 547 and 548 (30Daniel C. Salvekar A. Schindler U. J. Biol. Chem. 2000; 275: 14255-14259Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar) by using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The STAT6ΔC was prepared by a deletion of the carboxyl-terminal domain at position 661. The correct nucleotide sequences of PCR products and cloning junctions were verified by DNA sequencing.For the construct encoding the Socs-1 promoter, HaCaT cells were lysed in a buffer containing 50 mm Tris, pH 8.1, 100 mm EDTA, 0.5% SDS, and 0.08 mg/ml proteinase K overnight at 55 °C. The Socs-1 promoter P1 was generated with a forward primer 5′-CGATGGTACCTTTCTTCCCGAGCCGGGTAG and a reverse primer 5′-ACGTAAGCTTGCGCATGCTCCGGGGCCAGG. The Socs-1 promoter P2 was generated with the same reverse primer and a forward primer 5′-ACGTGGTACCGAAGCCCGAGCCAAGACCAG. The PCR fragments were then cut with Hind III and KpnI and inserted into the same site in the pGL3 basic vector. The pGL3 IL-4-responsive elements (IL-4RE) was generated from the pGL3-P1. It was generated with a forward primer 5′-CGATGGTACCTTTCTTCCGCAGCCGGGTAG and a reverse primer 5′-AGGAGGCCACAGAAGGTGTC. The PCR fragment was then cut with KpnI and inserted into the KpnI and SmaI site in the pTATA vector. Each individual SBE was mutated (mut) by site-directed mutagenesis using the different oligomers, mut distal SBE, mut median SBE, and mut proximal SBE and mut distal Ets binding site (dEBS), described in Table I.Table IProbes used in EMSANoneSequenceOrigindSBECCGGCCCCGCCCAGTTTCCGAGGAACTGGGCCGGGGTGGASocs1 promoter (-684/-645)GGCCGGGGCGGGTCAAAGGCTCCTTGACCCGGCCCCACCTmut dSBECCGGCCCCGCCCAGTTAGCGAGCTACTGGGCCGGGGTGGASocs1 promoter (-684/-645)GGCCGGGGCGGGTCAATCGCTCGATGACCCGGCCCCACCTmut dEBSCCGGCCCCGCCCAGTTTCATGAACTGGGCCGGGGTGGASocs1 promoter (-684/-645)GGCCGGGGCGGGTCAAAGTCTACTTGACCCGGCCCCACCTmSBECCGCGCCGCCAGGGGGTTCCTCTGAAGCCTGTGGTCAGGCCSocs1 promoter (-639/-600)GGCGCGGCGGTCCCCAAGGAGACTTCGGACACCAGTCCGGmut mSBECCGCGCCGCCAGGGGTAGCTCTCTAGCCTGTGGTCAGGCCSocs1 promoter (-639/-600)GGCGCGGCGGTCCCCATCGAGAGATCGGACACCAGTCCGGpSBETGGTCAGGCCGCCGCTTCCCGGGAAGCCCGAGCCAAGACCSocs1 promoter (-609/-570)ACCAGTCCGGCGGCGAAGGGCCCTTCGGCGTCGGTTCTGGmut pSBETGGTCAGGCCGCCGTAGCCGGCTAGCCCGAGCCAAGACCSocs1 promoter (-609/-570)ACCAGTCCGGCGGCGATCGGCCGATCGGCGTCGGTTCTGG Open table in a new tab Primer Extension—92 ng of the 20-mer primer 5′-CATGCTCCGGGGCCAGGAGC complementary to +12–+32 of the first exon was end-labeled with 30 μCi of [γ-32P]ATP (3000 Ci/mmol, Amersham Biosciences) using T4 polynucleotide kinase (Invitrogen). Then, 10 μg of total RNA from HaCaT cells was hybridized with 2 × 105 cpm of the labeled primer in a total volume of 11 μl containing 50 mm KCl, 50 mm Tris-HCl, pH 8.3, 10 mm MgCl2, 10 mm DTT, 1 mm each dNTP, and 0.5 mm spermidine. The hybridization was performed at 58 °C for 20 min. After hybridization, the reverse transcription reaction was carried out at 42 °C for 60 min upon the addition of 20 mm pyrophosphate and 1 μl of reverse transcriptase SuperScript (Invitrogen). 50% formamide, 5 mm EDTA, 0.05% xylene cyanol, and 0.05% bromphenol blue was added to the total reaction mixture and run on a 8% polyacrylamide 7 m urea sequencing gel in 1× TBE (89 mm Tris base, 89 mm boric acid, and 1.9 mm EDTA). Detection was achieved by autoradiography on a phosphor-fluorimager (Storm 840).Immunoprecipitation, Coimmunoprecipitation, and Western Blotting—After stimulation for 30 min with IL-4 (10 ng/ml), cells were lysed in a buffer containing 50 mm Tris-HCl, pH 7.5, 1% Triton X-100 for immunoprecipitation (1% Nonidet P-40 for coimmunoprecipitation), 50 mm NaCl, 50 mm NaF, 10 mm NaPP, 5 mm EDTA, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 10 μg/ml pepstatin, and 10 μg/ml leupeptin. The cell lysates were clarified by centrifugation. 500 μg of total protein was incubated with appropriate antibodies overnight and with protein G-Sepharose for 1 h at 4 °C. The immunoprecipitates were separated through 8% SDS-PAGE. Proteins were transferred to Hybond-C extra membrane (Amersham Biosciences). Membranes were probed with the appropriate antibodies. This was followed by incubation with appropriate horseradish peroxidase-conjugated secondary antibody. Detection was achieved by enhanced chemiluminescence assay (Amersham Biosciences).Transfection Experiments—For transient transfection, cells were seeded at 4 × 105 cells/well in 6-well dishes 24 h before transfection. The different plasmid DNA and the pCMVβ-galactosidase were adjusted to 3 μg of DNA and 6 μl of jet-PEI™ solution (Polyplus transfection, Illkirch, France). After 24 h incubation, cells were supplemented with fresh serum-free culture medium and stimulated with IL-4 or not stimulated. Cells were lysed 16 h later in reporter lysis buffer (Promega). Luciferase gene expression was monitored using a commercial kit (Promega) and photon counting (MicroLumat Plus 96V, Berthold, Nashua, NH). Each transfection experiment was performed in triplicate.For stable transfection experiments, HaCaT cells were transfected with a pIRES plasmid containing the different c-DNA coding for the different STAT6 variants and then cultured under 500 μg/ml G418 selective conditions for at least 1 month. Resistant cells were used for further experiments.Chromatin Immunoprecipitation Assay—Chromatin immunoprecipitation experiments were performed essentially as previously described (31Giraud S. Bienvenu F. Avril S. Gascan H. Heery D.M. Coqueret O. J. Biol. Chem. 2002; 277: 8004-8011Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 32Shang Y. Hu X. DiRenzo J. Lazar M.A. Brown M. Cell. 2000; 103: 843-852Abstract Full Text Full Text PDF PubMed Scopus (1436) Google Scholar). For PCR, 5 μl from a 25-μl DNA preparation were used for 35 cycles of amplification. The following primers, region –825/–439 of the Socs-1 promoter 5′-AGGCGAGATCCAGGTCCAGA (forward) and 5′-AGGAGGCCACAGAAGGTGTC (reverse), were used after anti-STAT6 or anti-Ets1/2 immunoprecipitation and region –165/+52 of the Socs-1 promoter, was used after anti-RNA pol II immunoprecipitation, primers 5′-TCCAGAAGAGAGGGAAACAG (forward) and 5′-GGCGGCTCTCGCGCATGCTC (reverse).Electrophoretic Mobility Shift Assays (EMSA)—HaCaT cells were stimulated with IL-4 during 30 min, scrapped in phosphate-buffered saline supplemented with 1 mm Na3VO4, and pelleted. Nuclear extracts, radiolabeled double-strand oligonucleotides, were prepared, and EMSA experiments were performed as described previously (33Wery-Zennaro S. Zugaza J.L. Letourneur M. Bertoglio J. Pierre J. Oncogene. 2000; 19: 1596-1604Crossref PubMed Scopus (55) Google Scholar). The probes used in EMSA are listed in Table I. Supershift experiments were performed using the anti-STAT6 or with anti-Ets specific antibodies.Oligonucleotide Pull-down Assays—Streptavidin-agarose beads were incubated overnight with 3 μg of biotin-labeled oligonucleotides corresponding to the distal specific probes in binding buffer (20 mm HEPES, pH 7.5, 2.5 mm MgCl2, 40 mm KCl, 3 mm EDTA, 1 mm dithiothreitol, and 40% glycerol). Total cell extracts (1 mg of protein) were added for 90 min at 4 °C. Beads were washed in binding buffer and in TNE buffer (50 mm Tris-HCl, pH 8, 140 mm NaCl, 5 mm EDTA) and then resuspended in SDS-PAGE loading buffer and analyzed by SDS-PAGE. After electrophoresis, proteins were transferred to Hybond C-extra membrane and then probed with the appropriate antibodies.RESULTSTranscriptional Regulation of SOCS-1 mRNA by IL-4 Stimulation—To analyze whether IL-4 enhances Socs-1 gene expression in keratinocytes, we first performed reverse transcription (RT)-PCR to determine its transcript level. HaCaT cells were stimulated with IL-4 (10 ng/ml) for increasing periods of time. As shown in Fig. 1A (top), a low level of expression of Socs-1 was observed in unstimulated cells; the expression of Socs-1 appeared after 30 min of stimulation, peaked at 2 h, and declined thereafter to the basal level in 8 h. The level of 28S mRNA expression, used as RNA loading control, was not modified by IL-4 treatment (Fig. 1A, middle). We also examined whether IL-4 could regulate the expression of two other members of the Socs family. In unstimulated cells no SOCS-3 mRNA was detected, and no modulation of its expression was detected after IL-4 stimulation (data not shown). Comparatively, a relatively high level of SOCS-2 mRNA was observed in unstimulated cells, which was not modified by cytokine treatment (Fig. 1A, bottom). To quantify SOCS-1 mRNA expression after IL-4 stimulation we used quantitative real time RT-PCR. As shown in Fig. 1B, we observed the same time course of activation and determined a 120-fold induction of SOCS-1 mRNA expression above the basal level after 2 h of IL-4 stimulation.Cloning of the 5′-Flanking Region of Human Socs-1 Gene— We therefore undertook the cloning of the promoter region of the human Socs-1 gene. Dot plot comparison of human versus mouse sequences indicated that putative promoter elements are located on the human sequence (accession number Z46940) between 25,800 and 26,650 base position (23Schluter G. Boinska D. Nieman-Seyde S.C. Biochem. Biophys. Res. Commun. 2000; 268: 255-261Crossref PubMed Scopus (40) Google Scholar). The DNA sequence was subjected to computational analysis (MatInspector Software) (34Quandt K. Frech K. Karas H. Wingender E. Werner T. Nucleic Acids Res. 1995; 23: 4878-4884Crossref PubMed Scopus (2421) Google Scholar). Putative binding sites for STAT6 (3 sites), Ets (2 sites), Sp1 (4 sites), IRF-1, AP-1, and GATA-1 were found in the proximal region of the promoter. The sequence and the DNA boxes are shown in Fig. 2. Alignment of the 5′-flanking region containing the 3xSTAT6 binding sites of the human and mouse Socs-1 genes revealed a 78% sequence identity in this part of the promoter (not shown).Fig. 2Sequence of the 5′-flanking region of the human Socs-1 gene. 780 base pairs of 5′-flanking region upstream and 50 base pairs downstream from the transcriptional initiation site of 5′-untranslated region of the Socs-1 gene are depicted. The major transcription initiation site (+1) and the minor (*) are shown; potential binding sites for TATA box and transcriptional factor binding sites are underlined. The first exon of the Socs-1 gene is shaded. Arrows indicate the position of the 3′-primer (3) and 5′-primers used to generate P1-(1) and P2-PGL3 (2) reporter plasmids. PGL3-IL-4RE also used in this study was generated by using (4) as 3′-primer and (1) as 5′-primer, respectively.View Large Image Figure ViewerDownload (PPT)The transcriptional start site was determined by computational analysis (TSSW using Softberry Software) and predicted to be located at nucleotide –16 from the first nucleotide of the previously described start of the first exon (accession number NM_003745). The real transcriptional site was determined by primer extension analysis carried out with RNA preparation from IL-4-stimulated cells using a 20-nucleotide-labeled primer. Two initiation sites were determined at nucleotide –20 and –16 from the start of the first exon (Fig. 3). This latter site seems to be the major initiation transcription site. DNA sequencing analysis revealed that the Socs-1 gene contains a TATA box located –30 nucleotide from the most proximal start of transcription (Fig. 2).Fig. 3Primer extension analysis. Shown is the primer extension product obtained by reverse transcription using a specific 20-mer primer (underlined) and 30 μg of total mRNA from IL-4-stimulated HaCaT cells. The bands of 51 and 56 bp reflect the transcription initiation start sites (arrows) at positions –18 and –23 relative to the start of the first exon (shaded).View Large Image Figure ViewerDownload (PPT)Our next aim was to determine whether RNA polymerase II could occupy the transcriptional initiation site after IL-4 stimulation. Chromatin immunoprecipitation experiments showed that RNA pol II was indeed recruited to the Socs-1 promoter after IL-4 stimulation of HaCaT cells (Fig. 4A).Fig. 4Recruitment of RNA pol II and STAT6 to the Socs-1 promoter after IL-4 stimulation. Soluble chromatin was prepared from HaCaT cells treated with IL-4 (10 ng/ml) for various times and immunoprecipitated with antibodies directed against RNA pol II or STAT6. The final DNA extractions were amplified using pairs of primers that cover the RNA pol II binding site (–165/+52) (A) or the three STAT6 binding sites (–825/–439) (B) region of the promoter. Input represents amplification of total DNA sample before immunoprecipitation.View Large Image Figure ViewerDownload (PPT)Sequence analysis of the putative promoter revealed the existence of three STAT6-binding element (TTCN4GAA) located in a region of 80 nucleotides, which begins at nucleotide –570 and ends at nucleotide –684 from the initiation start site. Chromatin immunoprecipitation experiments showed that STAT6 was recruited to this Socs-1 promoter region after IL-4 stimulation. The time course study indicated that the occupancy of the Socs-1 promoter by STAT6 was detectable as soon as 15 min after IL-4 stimulation (Fig. 4B).To identify the elements that are important for IL-4-stimulated transcription of the Socs-1 promoter, two DNA fragments were generated by PCR with two 5′-primers surrounding the three STAT6 binding sites one upstream (Fig. 2, (1)) and the other downstream (Fig. 2, (2)). The 3′-primer corresponds to the previously described start of the first exon (Fig. 2, (3)). We used genomic HaCaT DNA as the template for the Socs-1 promoter cloning. We have therefore cloned these two DNA fragments, one of ∼780 bp (PGL3-P1) and the other of ∼580 bp (PGL3-P2) into the promoterless PGL3 basic, a luciferase reporter plasmid. Transient transfection in HaCaT cells of these two promoter constructs indicated that the activity of P1 promoter was indeed enhanced by IL-4, whereas the expression of P2 was not modified by IL-4 stimulation. These results suggested that IL-4REs are located between positions –587 and –747 (Fig. 5).Fig. 5Analysis of the promoter activity of the P1 region. The [–747/+52] or [–584/+52] regions of the Socs-1 promoter were cloned in the PGL3 basic vector to give PGL3-P1 and PGL3-P2, respectively. They were cotransfected with the pCMVβ-galactosidase plasmid in HaCaT cells. Cells were stimulated 36 h after transfection for 16 h with IL-4 or left unstimulated. Luciferase activity was normalized for β-galactosidase activity. The results are expressed as the -fold increase in relative light units to the level in unstimulated cell. The data are given as means of three independent experiments.View Large Image Figure ViewerDownload (PPT)Implication of STAT6 in the Regulation of the Promot" @default.
• W1985384612 created "2016-06-24" @default.
• W1985384612 creator A5004065684 @default.
• W1985384612 creator A5011356649 @default.
• W1985384612 creator A5015189542 @default.
• W1985384612 creator A5057941580 @default.
• W1985384612 date "2004-08-01" @default.
• W1985384612 modified "2023-10-01" @default.
• W1985384612 title "STAT6 and Ets-1 Form a Stable Complex That Modulates Socs-1 Expression by Interleukin-4 in Keratinocytes" @default.
• W1985384612 cites W1482383475 @default.
• W1985384612 cites W1488478985 @default.
• W1985384612 cites W1510351486 @default.
• W1985384612 cites W1656645373 @default.
• W1985384612 cites W1668039320 @default.
• W1985384612 cites W1818471554 @default.
• W1985384612 cites W1913308048 @default.
• W1985384612 cites W1964464038 @default.
• W1985384612 cites W1967894253 @default.
• W1985384612 cites W1969499006 @default.
• W1985384612 cites W1972319496 @default.
• W1985384612 cites W1976382957 @default.
• W1985384612 cites W1976989643 @default.
• W1985384612 cites W1979676829 @default.
• W1985384612 cites W1999946768 @default.
• W1985384612 cites W2001713238 @default.
• W1985384612 cites W2002186586 @default.
• W1985384612 cites W2004593694 @default.
• W1985384612 cites W2019835417 @default.
• W1985384612 cites W2020438689 @default.
• W1985384612 cites W2023948035 @default.
• W1985384612 cites W2027844562 @default.
• W1985384612 cites W2029860358 @default.
• W1985384612 cites W2030922722 @default.
• W1985384612 cites W2037682763 @default.
• W1985384612 cites W2039576757 @default.
• W1985384612 cites W2039945589 @default.
• W1985384612 cites W2046462560 @default.
• W1985384612 cites W2050959683 @default.
• W1985384612 cites W2054205310 @default.
• W1985384612 cites W2060265430 @default.
• W1985384612 cites W2064879068 @default.
• W1985384612 cites W2071516626 @default.
• W1985384612 cites W2074912610 @default.
• W1985384612 cites W2077634926 @default.
• W1985384612 cites W2082390264 @default.
• W1985384612 cites W2083189092 @default.
• W1985384612 cites W2107690874 @default.
• W1985384612 cites W2119596771 @default.
• W1985384612 cites W2119657383 @default.
• W1985384612 cites W2138502702 @default.
• W1985384612 cites W2143001254 @default.
• W1985384612 cites W2143464311 @default.
• W1985384612 cites W2152000177 @default.
• W1985384612 cites W2155449991 @default.
• W1985384612 cites W2156860267 @default.
• W1985384612 cites W2163859874 @default.
• W1985384612 cites W2319340548 @default.
• W1985384612 cites W2327077909 @default.
• W1985384612 cites W4313333868 @default.
• W1985384612 doi "https://doi.org/10.1074/jbc.m403223200" @default.
• W1985384612 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15199062" @default.
• W1985384612 hasPublicationYear "2004" @default.
• W1985384612 type Work @default.
• W1985384612 sameAs 1985384612 @default.
• W1985384612 citedByCount "36" @default.
• W1985384612 countsByYear W19853846122012 @default.
• W1985384612 countsByYear W19853846122013 @default.
• W1985384612 countsByYear W19853846122014 @default.
• W1985384612 countsByYear W19853846122016 @default.
• W1985384612 countsByYear W19853846122018 @default.
• W1985384612 countsByYear W19853846122019 @default.
• W1985384612 countsByYear W19853846122022 @default.
• W1985384612 crossrefType "journal-article" @default.
• W1985384612 hasAuthorship W1985384612A5004065684 @default.
• W1985384612 hasAuthorship W1985384612A5011356649 @default.
• W1985384612 hasAuthorship W1985384612A5015189542 @default.
• W1985384612 hasAuthorship W1985384612A5057941580 @default.
• W1985384612 hasBestOaLocation W19853846121 @default.
• W1985384612 hasConcept C145430368 @default.
• W1985384612 hasConcept C185592680 @default.
• W1985384612 hasConcept C191732599 @default.
• W1985384612 hasConcept C199360897 @default.
• W1985384612 hasConcept C203014093 @default.
• W1985384612 hasConcept C2778690821 @default.
• W1985384612 hasConcept C3020625565 @default.
• W1985384612 hasConcept C41008148 @default.
• W1985384612 hasConcept C74172505 @default.
• W1985384612 hasConcept C86803240 @default.
• W1985384612 hasConcept C8891405 @default.
• W1985384612 hasConcept C90559484 @default.
• W1985384612 hasConcept C95444343 @default.
• W1985384612 hasConceptScore W1985384612C145430368 @default.
• W1985384612 hasConceptScore W1985384612C185592680 @default.
• W1985384612 hasConceptScore W1985384612C191732599 @default.
• W1985384612 hasConceptScore W1985384612C199360897 @default.
• W1985384612 hasConceptScore W1985384612C203014093 @default.
• W1985384612 hasConceptScore W1985384612C2778690821 @default.
• W1985384612 hasConceptScore W1985384612C3020625565 @default.

• next