SemOpenAlex |

SemOpenAlex

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1985941719> ?p ?o ?g. }

Showing items 1 to 95 of 95 with 100 items per page.

W1985941719 endingPage "1293" @default.
W1985941719 startingPage "1287" @default.
W1985941719 abstract "Phorbol ester-inducible mouse 8S-lipoxygenase (8-LOX) and its human homologue, 15S-lipoxygenase-2 (15-LOX-2), share 78% identity in amino acid sequences, yet there is no overlap in their positional specificities. In this study, we investigated the determinants of positional specificity using a random chimeragenesis approach in combination with site-directed mutagenesis. Exchange of the C-terminal one-third of the 8-LOX with the corresponding portion of 15-LOX-2 yielded a chimeric enzyme with exclusively 15S-lipoxygenase activity. The critical region was narrowed down to a cluster of five amino acids by expression of multiple cDNAs obtained by in situ chimeragenesis in Escherichia coli. Finally, a pair of amino acids, Tyr603 and His604, was identified as the positional determinant by site-directed mutagenesis. Mutation of both of these amino acids to the corresponding amino acids in 15-LOX-2 (Asp and Val, respectively) converted the positional specificity from 8S to 90% 15S without yielding any other by-products. Mutation of the corresponding residues in 15-LOX-2 to the 8-LOX sequence changed specificity to 50% oxygenation at C-8 for one amino acid substitution and 70% at C-8 for the double mutant. Based on the crystal structure of the reticulocyte 15-LOX, these two amino acids lie opposite the open coordination position of the catalytic iron in a likely site for substrate binding. The change from 8 to 15 specificity entails a switch in the head to tail binding of substrate. Enzymes that react with substrate “head first” (5-LOX and 8-LOX) have a bulky aromatic amino acid and a histidine in these positions, whereas lipoxygenases that accept substrates “tail first” (12-LOX and 15-LOX) have an aliphatic residue with a glutamine or aspartate. Thus, this positional determinant of the 8-LOX and 15-LOX-2 may have significance for other lipoxygenases. Phorbol ester-inducible mouse 8S-lipoxygenase (8-LOX) and its human homologue, 15S-lipoxygenase-2 (15-LOX-2), share 78% identity in amino acid sequences, yet there is no overlap in their positional specificities. In this study, we investigated the determinants of positional specificity using a random chimeragenesis approach in combination with site-directed mutagenesis. Exchange of the C-terminal one-third of the 8-LOX with the corresponding portion of 15-LOX-2 yielded a chimeric enzyme with exclusively 15S-lipoxygenase activity. The critical region was narrowed down to a cluster of five amino acids by expression of multiple cDNAs obtained by in situ chimeragenesis in Escherichia coli. Finally, a pair of amino acids, Tyr603 and His604, was identified as the positional determinant by site-directed mutagenesis. Mutation of both of these amino acids to the corresponding amino acids in 15-LOX-2 (Asp and Val, respectively) converted the positional specificity from 8S to 90% 15S without yielding any other by-products. Mutation of the corresponding residues in 15-LOX-2 to the 8-LOX sequence changed specificity to 50% oxygenation at C-8 for one amino acid substitution and 70% at C-8 for the double mutant. Based on the crystal structure of the reticulocyte 15-LOX, these two amino acids lie opposite the open coordination position of the catalytic iron in a likely site for substrate binding. The change from 8 to 15 specificity entails a switch in the head to tail binding of substrate. Enzymes that react with substrate “head first” (5-LOX and 8-LOX) have a bulky aromatic amino acid and a histidine in these positions, whereas lipoxygenases that accept substrates “tail first” (12-LOX and 15-LOX) have an aliphatic residue with a glutamine or aspartate. Thus, this positional determinant of the 8-LOX and 15-LOX-2 may have significance for other lipoxygenases. hydro(pero)xyeicosatetraenoic acid hydroxyeicosatetraenoic acid lipoxygenase reversed-phase high pressure liquid chromatography polymerase chain reaction open reading frame Lipoxygenases are dioxygenases containing one atom of non-heme iron in their reaction center (1.Brash A.R. J. Biol. Chem. 1999; 274: 23679-23682Abstract Full Text Full Text PDF PubMed Scopus (1114) Google Scholar). These enzymes catalyze the hydroperoxidation of polyunsaturated fatty acids, usually with high positional specificity and stereospecificity. The lipoxygenase reaction is initiated by removal of a hydrogen from a methylene group between two cis double bonds, and then molecular oxygen reacts on the opposite face of the substrate to form a hydroperoxide product with a trans-cis-conjugated diene (1.Brash A.R. J. Biol. Chem. 1999; 274: 23679-23682Abstract Full Text Full Text PDF PubMed Scopus (1114) Google Scholar). The typical substrate of mammalian lipoxygenases is arachidonic acid, which is converted to hydroperoxyeicosatetraenoic acids (HPETEs).1 So far, the structures of three lipoxygenases, the soybean L-1 and L-3 isozymes and the rabbit reticulocyte 15-lipoxygenase, have been analyzed by x-ray crystallography (2.Boyington J.C. Gaffney B.J. Amzel L.M. Science. 1993; 260: 1482-1486Crossref PubMed Scopus (452) Google Scholar, 3.Minor W. Steczko J. Stec B. Otwinowski Z. Bolin J.T. Walter R. Axelrod B. Biochemistry. 1996; 35: 10687-10701Crossref PubMed Scopus (392) Google Scholar, 4.Skrzypczak-Jankun E. Amzel L.M. Kroa B.A. Funk Jr., M.O. Proteins Struct. Funct. Genet. 1997; 29: 15-31Crossref PubMed Scopus (149) Google Scholar, 5.Gillmor S.A. Villaseñor A. Fletterick R. Sigal E. Browner M.F. Nat. Struct. Biol. 1997; 4: 1003-1009Crossref PubMed Scopus (390) Google Scholar). These studies have helped clarify how the catalytic iron is held in place and the identity of the amino acid ligands. It remains unclear how substrate gains access to the active site, and there is no information on precisely how substrate binds. Several potential routes of substrate access into the catalytic domain have been proposed (2.Boyington J.C. Gaffney B.J. Amzel L.M. Science. 1993; 260: 1482-1486Crossref PubMed Scopus (452) Google Scholar, 3.Minor W. Steczko J. Stec B. Otwinowski Z. Bolin J.T. Walter R. Axelrod B. Biochemistry. 1996; 35: 10687-10701Crossref PubMed Scopus (392) Google Scholar, 4.Skrzypczak-Jankun E. Amzel L.M. Kroa B.A. Funk Jr., M.O. Proteins Struct. Funct. Genet. 1997; 29: 15-31Crossref PubMed Scopus (149) Google Scholar, 5.Gillmor S.A. Villaseñor A. Fletterick R. Sigal E. Browner M.F. Nat. Struct. Biol. 1997; 4: 1003-1009Crossref PubMed Scopus (390) Google Scholar). Most of the work on the positional determinants of lipoxygenases has been reported for specificity between C-12 and C-15 utilizing the reticulocyte type of 15S-lipoxygenase (referred to herein as 15-LOX-1) and the different mammalian 12S-lipoxygenases. In an early report, two amino acids involved in the C-12 and C-15 specificity were identified by analysis of conserved differences in the enzyme primary structures (6.Sloane D.L. Leung R. Craik C.S. Sigal E. Nature. 1991; 354: 149-152Crossref PubMed Scopus (180) Google Scholar). It was proposed that the bulkiness of these residues determined the depth of the substrate binding pocket and hence whether hydrogen abstraction would occur at C-10 (for 12-lipoxygenase activity) or at C-13 (for 15-lipoxygenase). Subsequently, two additional candidates have been identified, F353 in rabbit 15-LOX-1 and R402 in human 15-LOX-1 (7.Borngräber S. Kuban R.-J. Anton M. Kühn H. J. Mol. Biol. 1996; 264: 1145-1153Crossref PubMed Scopus (75) Google Scholar, 8.Gan Q.-F. Browner M.F. Sloane D.L. Sigal E. J. Biol. Chem. 1996; 271: 25412-25418Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). All of these determinants are viewed to work via a “frameshift” that targets the hydrogen abstraction either to C-10 or C-13 on the same face of the substrate molecule (cf. Ref. 9.Kühn H. Sprecher H. Brash A.R. J. Biol. Chem. 1990; 265: 16300-16305Abstract Full Text PDF PubMed Google Scholar). These determinants are not necessarily applicable to other lipoxygenases because in many cases the hydrogen abstraction occurs on a different carbon (e.g. at C-7 for 5-LOX) and/or on the opposite face of the substrate compared with the 12S- and 15S-lipoxygenases (Fig. 1) (10.Prigge S.T. Boyington J.C. Gaffney B.J. Amzel L.M. Proteins Struct. Funct. Genet. 1996; 24: 275-291Crossref PubMed Scopus (90) Google Scholar). In 1997 and 1998 (11.Brash A.R. Boeglin W.E. Chang M.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6148-6152Crossref PubMed Scopus (348) Google Scholar, 12.Jisaka M. Kim R.B. Nanney L.B. Boeglin W.E. Brash A.R. J. Biol. Chem. 1997; 272: 24410-24416Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar) we reported the cloning of a second type of human 15S-lipoxygenase (referred to here as 15-LOX-2) and a close structural homologue from the mouse, a phorbol ester-inducible 8S-lipoxygenase. These enzymes share 78% identity in their primary structures. Their nearest neighbors among other lipoxygenases show about 50% identity (13.Krieg P. Kinzig A. Heidt M. Marks F. Fürstenberger G. Biochim. Biophys. Acta. 1998; 1391: 7-12Crossref PubMed Scopus (50) Google Scholar, 14.Boeglin W.E. Kim R.B. Brash A.R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6744-6749Crossref PubMed Scopus (144) Google Scholar, 15.Sun D. McDonnell M. Chen X.-S. Lakkis M.M. Li H. Isaacs S.N. Elsea S.H. Patel P.I. Funk C.D. J. Biol. Chem. 1998; 273: 33540-33547Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 16.Kinzig A. Heidt M. Fürstenberger G. Marks F. Krieg P. Genomics. 1999; 58: 158-164Crossref PubMed Scopus (46) Google Scholar). Human 15-LOX-1 and 15-LOX-2 are quite distinct, both in amino acid identity (∼35%) and substrate specificity and also in sites of tissue expression (11.Brash A.R. Boeglin W.E. Chang M.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6148-6152Crossref PubMed Scopus (348) Google Scholar). Despite the structural resemblance between the mouse 8-LOX and human 15-LOX-2, their products are quite different. The 8-LOX produces solely 8S-HPETE from arachidonic acid (12.Jisaka M. Kim R.B. Nanney L.B. Boeglin W.E. Brash A.R. J. Biol. Chem. 1997; 272: 24410-24416Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar), whereas 15S-HPETE is the sole product from 15-LOX-2 (11.Brash A.R. Boeglin W.E. Chang M.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6148-6152Crossref PubMed Scopus (348) Google Scholar). The hydrogen abstractions associated with these two reactions occur on different carbons (C-10 and C-13, respectively) and on different faces of the substrate. Thus, the mouse 8-LOX and human 15-LOX-2 represent new issues related to the reaction specificity of lipoxygenases. We addressed the basis of their positional specificities using chimeric enzymes and site-directed mutagenesis. Complementary DNAs of mouse 8S-lipoxygenase (8-LOX) and human 15S-lipoxygenase-2 (15-LOX-2) were obtained by PCR from cDNAs prepared from the mRNAs of phorbol ester-treated mouse skin and human hair root, respectively. 8-LOX was cloned into pCR3.1 mammalian expression vector (Invitrogen, Carlsbad, CA) (12.Jisaka M. Kim R.B. Nanney L.B. Boeglin W.E. Brash A.R. J. Biol. Chem. 1997; 272: 24410-24416Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar), and 15-LOX-2 was originally cloned into pcDNA3 mammalian expression vector (Invitrogen, Carlsbad, CA) (11.Brash A.R. Boeglin W.E. Chang M.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6148-6152Crossref PubMed Scopus (348) Google Scholar) and then transferred to pCR3.1. Both pCR3.1 and pcDNA3 contain a T7 promoter for effective expression. [1-14C]Arachidonic acid was purchased from NEN Life Science Products. 8-LOX and 15-LOX-2 cDNAs contain XcmI andEcoRV sites at the corresponding positions, which separate their ORFs into three parts of almost same size: C-terminal, middle, and N-terminal regions. C-terminal chimeras, I and II (Fig.2 A), were prepared by mixed ligation between the C-terminal region cut out by double digestion ofHindIII and XcmI and the rest of the plasmids. N-terminal chimeras, III and IV (Fig. 2 A), were prepared in the same way using only EcoRV except that the rest of the plasmids were dephosphorylated before ligation. Various restriction site-independent chimeras between 8-LOX and 15 LOX-2 were prepared based on the method by Moore and Blakely (17.Moore K.R. Blakely R.D. BioTechniques. 1994; 17: 130-136PubMed Google Scholar). A tandemly connected 8-LOX and 15-LOX-2 cDNA in pCR3.1 was constructed in two steps in order to get some proper restriction sites between the two ORFs (Fig. 3 A). First, 15-LOX-2 cDNA cut out from pCR3.1 using NheI andXbaI was cloned into pSE280 (Invitrogen) pre-cut withXbaI. A clone containing the 15-LOX-2 cDNA in an inverse direction compared with the T7 promoter of the pSE280 was selected and digested with NotI to obtain a 15-LOX-2 cDNA fragment containing an HpaI site in the 5′ side of 15-LOX-2. This fragment was then transferred into a pCR3.1/8-LOX linearized by cutting with NotI. A clone containing tandemly connected 8-LOX and 15-LOX-2 cDNAs was selected, linearized by cutting the linker region between 8-LOX and 15-LOX-2 cDNAs with HpaI andKpnI, and purified from agarose gel using QIAEX II resin (Qiagen, Chatsworth, CA). Using 100 μg of the purified linear plasmid, TOP10F′-competent cells (Invitrogen) were transformed by heat shock at 42 °C. After selection of the correct size clones by gel electrophoresis, the switching point in each chimera cDNA was narrowed down by examining the restriction cut profiles and finally determined by sequencing. This first trial of chimera preparation ultimately yielded 3 useful chimeras, V, VI, and XII (Fig.4).Figure 4Structure of the in siturandom chimeras. The C-terminal regions of 8-LOX and 15-LOX-2 containing EcoRV and SmaI sites are shown. Amino acid differences are marked with asterisks. Theblack dots indicate the switching point of each chimera.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In order to obtain much more variety of chimeras switched in the C-terminal region, a new tandem clone containing a full-length of 8-LOX cDNA and C-terminal 426 bases of 15-LOX-2 was constructed (Fig.3 B). The C-terminal portion of the parent 15-LOX-2 cDNA in pCR3.1 was cut out with SmaI and EcoRV and was cloned into pBS(SK−) (Stratagene, La Jolla, CA). The target portion was cut out again with ApaI/XbaI and transferred into pSE280 (Invitrogen), and then cut out again with ApaI and NotI and cloned into the downstream of the 8-LOX ORF in pCR3.1. The resulting chimera cDNA composed of a full-length of 8-LOX ORF and C-terminal 426 bases of 15-LOX-2 was linearized by cutting with NotI and XbaI and used to transform TOP10F′-competent cells. This chimerization resulted in 5 useful chimeras, VII, VIII, IX, X, and XI (Fig. 4). Site-directed mutagenesis in the Ser600-His604 region in 8-LOX and Tyr602-Asp603 in 15-LOX-2 was performed by PCR-based overlap extension mutagenesis using mutated synthetic oligonucleotides. The mismatching primers used are shown in Table I. Four kinds of mutants of successive two amino acids and then three kinds of mutants of one amino acid were prepared from 8-LOX, and three kinds of mutants were prepared from 15-LOX-2. The specific upstream primers for the primary PCR of 8-LOX and 15-LOX-2 anneal to SFVSEIV region (5′ GAGCTTTGTCTCTGAAATAGTCAG 3′) and GFSELIQR region (5′ GGCTTCTCTGAGTTGATACAGAGG 3′), respectively. The pCR3.1 reverse primer was used as the specific downstream primer for both enzymes. The resulting mutated fragments were digested with EcoRV and then exchanged with the corresponding region of the wild type cDNA.Table IPrimers used for the site-directed mutagenesisNameSequenceWild typeCCAGCAGTTAATTCGTCAAGTTATCACATCATTGCTCTCSS/ATCCAGCAGTTAATGCGACAAGTTATCACATCSS/TCGCAGTTAATTCGACATGTTATCACATCATTSY/CDGTTAATTCGTCATGTGATCACATCATTGCTYH/DVAATTCGTCAAGTGATGTCATCATTGCTCTCS602CGTTAATTCGTCATGTTATCACATCATTY603DAATTCGTCAAGTGATCACATCATTGCTH604VTCGTCAAGTTATGTCATCATTGCTCTCThe sequences of the primers used for the site-directed mutagenesis are shown with the original wild type sequence. The mutated codons are underlined. Open table in a new tab The sequences of the primers used for the site-directed mutagenesis are shown with the original wild type sequence. The mutated codons are underlined. All the cDNAs were expressed in HeLa cells using VTF-7, a recombinant vaccinia virus containing the T7 RNA polymerase gene (18.Blakely R.D. Clark J.A. Rudnick G. Amara S.G. Anal. Biochem. 1991; 194: 302-308Crossref PubMed Scopus (151) Google Scholar). Cells plated at 1 × 106 cells/35-mm well 48 h earlier were transfected with 1 μg of plasmid DNA and 3 μg of Lipofectin and harvested after 12 h. The harvested cells were sonicated on ice, and the resulting homogenate was used for LOX activity assay and Western analysis. The cell homogenates were incubated with 100 μm[1-14C]arachidonic acid for 45 min at room temperature. The products were extracted by the method of Bligh and Dyer (19.Bligh E.G. Dyer W.J. Can. J. Biochem. Physiol. 1959; 37: 911-917Crossref PubMed Scopus (41848) Google Scholar), and the extracts were analyzed directly by RP-HPLC first and then by normal phase HPLC after reduction using triphenylphosphine. For stereochemical analysis, the reduced hydroperoxide products were purified by normal phase HPLC, methylated with diazomethane, re-purified by normal phase HPLC, and then applied to chiral HPLC as described previously (11.Brash A.R. Boeglin W.E. Chang M.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6148-6152Crossref PubMed Scopus (348) Google Scholar,12.Jisaka M. Kim R.B. Nanney L.B. Boeglin W.E. Brash A.R. J. Biol. Chem. 1997; 272: 24410-24416Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). The expression level of each enzyme was estimated by Western analysis. The cell homogenate containing 20 μg of protein was separated by SDS-polyacrylamide gel electrophoresis and then transferred to a nylon membrane (Amersham Pharmacia Biotech). The enzymes were stained as described previously (12.Jisaka M. Kim R.B. Nanney L.B. Boeglin W.E. Brash A.R. J. Biol. Chem. 1997; 272: 24410-24416Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar) using an antisera raised against 15-LOX-2, which cross-reacts with 8-LOX but not with 15-LOX-1, and an ECL detection kit (Amersham Pharmacia Biotech), according to the manufacturers specifications. The mouse 8-LOX cDNA and the human 15-LOX-2 cDNA contain XcmI and EcoRV sites at equivalent positions (at 730 and 1380 base pairs, respectively, in the murine sequence). These restriction sites separate the cDNAs into three almost equally sized parts: N-terminal, middle, and C-terminal regions. Four chimeric cDNAs were prepared using these restriction sites (Fig. 2 A). Chimeras I and II have the N-terminal regions exchanged at the XcmI site, whereas chimeras III and IV have the C-terminal regions exchanged at the EcoRV site. Following transfection into HeLa cells, all chimeras were expressed at the same level as the original wild type 8-LOX and 15-LOX-2 (Fig.2 B). Thus, substitution of their N- or C-terminal regions does not affect the enzyme expression probably due to the high sequential homology between the original enzymes. When expressed in HeLa cells, the wild type 8-LOX and 15-LOX-2 converted arachidonic acid exclusively to 8S-HETE and 15S-HETE, respectively, as reported previously (Fig. 2,C and D) (11.Brash A.R. Boeglin W.E. Chang M.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6148-6152Crossref PubMed Scopus (348) Google Scholar, 12.Jisaka M. Kim R.B. Nanney L.B. Boeglin W.E. Brash A.R. J. Biol. Chem. 1997; 272: 24410-24416Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). Chimeras I and III, containing the C-terminal region of 15-LOX-2, exhibited a lower level of enzymatic activity and produced solely 15-HETE (Fig. 2 E for chimera III and data not shown for chimera I). Two other chimeras, II and IV, containing the C-terminal region of 8-LOX were enzymatically inactive (data not shown). The 15-HETE product of chimera III was shown by chiral column analysis to have the 15S configuration (Fig.2 F). These data indicate that the C-terminal region of the mouse 8-LOX contains structural elements that determine its 8S specificity. In order to narrow down the positional determinants in the C-terminal region of the 8-LOX, a variety of chimeras were produced by in situchimeragenesis in Escherichia coli (17.Moore K.R. Blakely R.D. BioTechniques. 1994; 17: 130-136PubMed Google Scholar). In the first trial the bacteria were transformed with a plasmid containing the full-length 8-LOX and 15-LOX-2 cDNAs. We identified constructs that contained part of the C-terminal region of 15-LOX-2 cDNA exchanged with the corresponding region in the wild type 8-LOX sequence. Three useful chimeras were obtained (Fig. 3 A): chimera V, switched at Trp482; chimera VI at His554; and chimera XII at Leu610 (Fig. 4). After expression in HeLa cells, chimeras V and VI exhibited purely 15-LOX activity, similar to chimera III, and without any other detectable products including 8-HETE (data not shown). The activity of chimera XII was identical to the original 8-LOX (data not shown). This first set of chimeras preparedin situ showed that the positional determinants of the 8-LOX were located between the switching points of chimera VI (switched at His554) and XII (switched at Leu610) and that the downstream region beyond Leu610 is not involved. To obtain a greater number of chimeras switched in the region between His554 and Leu610, the second set of chimeras was prepared using the full-length 8-LOX ORF together with the C-terminal region of 15-LOX-2 in place of its complete ORF (Fig.3 B). This time, five useful chimera cDNAs were obtained as follows: chimera VII switched at Phe562, chimera VIII at Pro569, chimera IX at Gly584, chimera X at Ala586, and chimera XI at Val598 (Fig. 4). After expression in HeLa cells, all of these chimeras exhibited 15-lipoxygenase activity (data not shown). This allowed the positional determinant to be narrowed down to the amino acids between Val598 and Leu610. In this region, aside from an Ile/Leu substitution that we did not investigate, the mouse 8-LOX sequence differs from 15-LOX-2 only in the series of amino acids from Ser600 to His604 inclusive. The cluster of amino acids in positions 600–604 of the mouse 8-LOX, SSSYH, differ from the corresponding residues in human 15-LOX-2, ATCDV (Fig. 4). By site-directed mutagenesis using the primers shown in TableI, adjacent pairs of amino acids in 8-LOX were substituted with the corresponding amino acids in 15-LOX-2. As before, the resulting chimeras were expressed in HeLa cells, and their lipoxygenase activity was determined. The SS/AT mutant (data not shown) and the SS/TC mutant showed unchanged regiospecificity from wild type 8-LOX (Fig. 5, A andB). On the other hand, the SY/CD mutant produced mainly 8-HETE and a significant amount of 15-HETE product (Fig.5 C). The YH/DV mutant produced mainly 15-HETE and a small amount of 8-HETE (Fig. 5 D). Chiral HPLC analyses showed that both the 8-HETE produced by the SS/TC mutant and the 15-HETE by the YH/DV mutant were S isomers (Fig. 5, E andF). These data suggested that the positional determinants of the 8-LOX reside within the three amino acids, Ser602, Tyr603, and His604. To define further the positional determinants, Ser602, Tyr603, and His604 in 8-LOX were substituted with the corresponding amino acids in 15-LOX-2 (Cys, Asp, and Val, respectively) by site-directed mutagenesis using the primers shown in Table I. After expression in HeLa cells, the S602C mutant produced only 8S-HETE, indicating that this mutation has no effect on regiospecificity (Fig. 6 A). The Y603D mutant still produced mainly 8S-HETE, whereas there is also a significant amount of 15-HETE product (8S-HETE:15-HETE = 11:1) (Fig. 6 B). The H604V mutant gave significant amounts of 8- and 15-HETEs (38:62) (Fig.6 C), and furthermore, both products wereS-enantiomers (Fig. 6 D). Thus, His604appears to be a key amino acid determinant of positional specificity, and the neighboring Tyr603 seems to support it. Change at both positions is required to switch the 8-LOX to an enzyme with predominantly 15-lipoxygenase activity. In order to examine whether the Tyr-His pair can also function as an 8-preferring determinant in 15-LOX-2, the corresponding amino acids in 15-LOX-2 were mutated to Tyr or His. Switching of Asp602 to Tyr did not affect the positional specificity of the wild type 15-LOX-2 (Fig. 7 A), whereas the Val603 → His mutant gave almost equal amounts of 15- and 8-HETEs (Fig. 7 B). Furthermore, the double mutation of Asp602 and Val603 in 15-LOX-2 to the corresponding Tyr and His, respectively, yielded a mutant enzyme with a positional specificity of 70% 8-HETE and 30% 15-HETE (Fig.7 C). Again in these cases, additional normal phase and chiral HPLC analyses detected no other HETEs with different positional specificity or stereospecificity from those of wild type 8-LOX and 15-LOX-2 (data not shown). Initially, the presence of common restriction sites in the mouse 8-LOX and human 15-LOX-2 permitted ready exchange of their N and C termini. Two chimeras containing the C-terminal region of 15-LOX-2 exhibited significant 15S-lipoxygenase activity with no other products formed, suggesting that the C-terminal region of the 8-LOX contains positional determinants that distinguish the 8S and 15S specificities. To narrow this down, a variety of chimeric enzymes was prepared by the random mutagenesis method of Moore and Blakely (17.Moore K.R. Blakely R.D. BioTechniques. 1994; 17: 130-136PubMed Google Scholar). The two cDNAs to be interchanged are cloned into a single plasmid with the sequences lying in series, separated by an intervening linker containing two unique restriction sites. After the double enzyme digest at the linker site, the linearized plasmid is transfected into E. coli. Because of the mismatching ends, the bacteria are unable to effect repair by re-ligation. Instead, the repair systems align the two related sequences and reconstitute chimeric sequences with a homologous region of one sequence exchanged with the other. Repair of the linearized construct gives many different recombinants, mainly consisting of circularized plasmids containing a single chimeric species of cDNA. As a refinement of this approach, we placed the full-length 8-LOX cDNA in series with only the C-terminal part of 15-LOX-2, thus effectively focusing the switching onto the C-terminal region. From analysis of the various C-terminal chimeras, a cluster of 5 amino acids was identified (SSSYH, positions 600–604 of the mouse 8-LOX) that conferred 15-lipoxygenase activity on the murine 8-LOX. Further site-directed mutagenesis showed that His604 is the major positional determinant as its mutation to valine led to formation of almost comparable amounts of 15- and 8-products, both of which were pure S-isomers (Fig. 6 D). The nearly complete conversion of positional specificity observed in the YH/DV double mutant indicated that Tyr603 augments the 8Sspecificity favored by His604 (Fig. 5 D). The reverse substitutions in the human 15-LOX-2 produced the opposite effects, with the double mutant having primarily 8-lipoxygenase activity (Fig. 7 C). Three serines in this region do not affect the positional specificity. Our approach to identification of the positional determinants was independent of structural considerations. The results immediately beg the question, where do these critical amino acids lie in the enzyme three-dimensional structure? Although three-dimensional data are not available on the mouse 8-LOX or human 15-LOX-2, the primary structures of all the mammalian lipoxygenases show an unambiguous alignment in the region encompassing Tyr603 and His604(Fig. 8). Consequently, the positions of the corresponding residues in the x-ray structure of the rabbit reticulocyte 15-LOX should predict the approximate location of these residues (Fig. 9). The reticulocyte 15-LOX residues (Leu589 and Gln590) lie in the catalytic domain, on helix 21, on the opposite side of the iron from the β-barrel domain (5.Gillmor S.A. Villaseñor A. Fletterick R. Sigal E. Browner M.F. Nat. Struct. Biol. 1997; 4: 1003-1009Crossref PubMed Scopus (390) Google Scholar).Figure 9Location of the two residues equivalent to the 8-LOX/15-LOX-2 positional determinants in the x-ray structure of the rabbit reticulocyte lipoxygenase. From alignment of primary structures, the equivalent amino acids in the reticulocyte structure are Leu589 and Gln590 (Fig. 8). These arise from helix 21; Leu589 projects out of helix 21 and away from the viewpoint of this figure, whereas Gln590 projects down and away. The two residues protrude into a potential open pocket on the far side of helix 21 that leads down to the iron. This view of the enzyme is identical to that used before in describing the amino acid environment of the iron (1.Brash A.R. J. Biol. Chem. 1999; 274: 23679-23682Abstract Full Text Full Text PDF PubMed Scopus (1114) Google Scholar); the iron is shown here as theblack ball. This structure of the reticulocyte lipoxygenase is available under Protein Data Bank code 1LOX (5.Gillmor S.A. Villaseñor A. Fletterick R. Sigal E. Browner M.F. Nat. Struct. Biol. 1997; 4: 1003-1009Crossref PubMed Scopus (390) Google Scholar).View Large Image Figure ViewerDownload Hi-res image Download (PPT) The non-heme iron of the catalytic domain is surrounded by five amino acids lying approximately at the corners of an octahedron, with the sixth position open, or in some structures occupied by a water molecule (3.Minor W. Steczko J. Stec B. Otwinowski Z. Bolin J.T. Walter R. Axelrod B. Biochemistry. 1996; 35: 10687-10701Crossref PubMed Scopus (392) Google Scholar). This open side of the iron also corresponds to the area where an inhibitor was bound in the x-ray crystal structure of the reticulocyte 15-LOX enzyme (5.Gillmor S.A. Villaseñor A. Fletterick R. Sigal E. Browner M.F. Nat. Struct. Biol. 1997; 4: 1003-1009Crossref PubMed Scopus (390) Google Scholar). The Leu589/Gln590 in the reticulocyte 15-LOX structure stand back about 15–20 Å from this open face of the iron (Fig. 9). This is somewhat further away from the iron than usually anticipated for substrate binding. Nonetheless, the linear length of arachidonic acid, ≈24 Å, is easily sufficient to reach this area. Assuming that the residues Tyr603/His604 of the murine 8-LOX lie in very approximately the same position as the Leu-Gln of the reticulocyte LOX structure, we can infer that they may have direct contact with the substrate and/or they may alter the positions of the helices that help form the putative substrate binding pocket in this region. When the amino acid alignments are extended to include plant lipoxygenases, there are lower overall similarities to the mouse 8-LOX and 15-LOX-2. Nonetheless, alignments utilizing either the clustal or Jotun-Hein algorithms of the DNAStar program identify Ile746/Ser747 of the soybean l-1 isozyme as the residues corresponding to Tyr603/His604 of the mouse 8-LOX (Fig. 8). These soybean amino acids lie in helix 21 (2.Boyington J.C. Gaffney B.J. Amzel L.M. Science. 1993; 260: 1482-1486Crossref PubMed Scopus (452) Google Scholar) in approximately the equivalent positions identified in the reticulocyte LOX structure. The change from 8S to 15S oxygenation would appear to entail a major alteration in specificity, yet it can be accounted for by a relatively simple change in binding of the substrate. For all lipoxygenases, the same stereochemical relationship pertains between the initial hydrogen abstraction and the reaction with molecular oxygen, namely that hydrogen removal from the CH2group between two cis double bonds occurs on one face of the substrate and oxygen reacts on the opposite face (20.Hamberg M. Samuelsson B. J. Biol. Chem. 1967; 242: 5329-5335Abstract Full Text PDF PubMed Google Scholar). This antarafacial “rule” applies to all lipoxygenases tested (at least 10 different enzymes, including the mouse 8-LOX (21.Hughes M.A. Brash A.R. Biochim. Biophys. Acta. 1991; 1081: 347-354Crossref PubMed Scopus (54) Google Scholar)), and it should apply to each of the selective oxygenations of the 8-LOX, the 15-LOX-2, and the chimeras. Fig. 10 illustrates how a reorientation of the substrate can allow 8S or 15S oxygenation through stereochemically equivalent hydrogen abstractions and reactions with molecular oxygen. This change in binding provides a simple and straightforward mechanism that can account for the apparently major shift in positional specificity. There is ample precedent for this model in the lipoxygenase literature (e.g. Refs. 22.Egmond M.R. Vliegenthart J.F.G. Boldingh J. Biochem. Biophys. Res. Commun. 1972; 48: 1055-1060Crossref PubMed Scopus (99) Google Scholar and 23.Schwarz K. Borngräber S. Anton M. Kühn H. Biochemistry. 1998; 37: 15327-15335Crossref PubMed Scopus (41) Google Scholar). The appropriateness of the model is further supported by the fact that the single amino acid mutants produce both 8S- and 15S-hydroperoxides, andonly these products (Fig. 6, C and D). There were no products at intermediary positions or products of opposite stereoconfiguration. This all but eliminates the possibility of a frameshift type of binding change (5.Gillmor S.A. Villaseñor A. Fletterick R. Sigal E. Browner M.F. Nat. Struct. Biol. 1997; 4: 1003-1009Crossref PubMed Scopus (390) Google Scholar) in which the substrate sinks deeper into the active site pocket as oxygenation specificity changes between C-15 and C-8. A potential role of the individual amino acids in substrate binding is speculative. The basic side chain of His604 could be a strong acceptor for the polar carboxyl group of the substrate fatty acid, whereas Tyr603 could support the substrate binding through hydrogen bonding and/or π-π interaction with the C terminus. Mutation of Tyr603 and His604 to Asp and Val, respectively, changes the character of the polarity and introduces a negative charge. This charge reversal might encourage a major repositioning of the substrate carboxyl group and hence promote the type of change proposed in Fig. 10. It is notable, however, that the experiments with single amino acid substitutions include the expression of the Tyr-Val (neutral) and Asp-His (acid-base) mutants; both of these enzymes produced mixtures of 8S- and 15S-hydroperoxides. It might be concluded, therefore, that in the context of the similar active sites of the 8-LOX and 15-LOX, substitutions in these key positions alter the contacts between amino acids on adjacent helices, the consequence being a change in the available space for substrate binding. This indirect effect may determine the shift in specificity. As noted in the Introduction, the molecular mechanisms determining the positional specificity in lipoxygenases have been approached before mainly using enzymes that exhibit frameshift differences in specificity. Several 12S-LOX and 15S-LOX-1 have received the most attention. Sequence comparisons led to the identification of residues of differing size that might influence the available space in the substrate binding pocket (6.Sloane D.L. Leung R. Craik C.S. Sigal E. Nature. 1991; 354: 149-152Crossref PubMed Scopus (180) Google Scholar). The evidence suggests that making more space is associated with oxygenation further along the carbon chain and, assuming a tail-first projection of the substrate into the active site, produces a change from 15Sto 12S specificity. These previously identified positional determinants do not seem to be applicable directly to 8-LOX and 15-LOX-2. Either the previously identified residues are not conserved in 8-LOX and 15-LOX-2 (this applies to Refs. 6.Sloane D.L. Leung R. Craik C.S. Sigal E. Nature. 1991; 354: 149-152Crossref PubMed Scopus (180) Google Scholar and 8.Gan Q.-F. Browner M.F. Sloane D.L. Sigal E. J. Biol. Chem. 1996; 271: 25412-25418Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar) or they are conserved but are present in both enzymes (7.Borngräber S. Kuban R.-J. Anton M. Kühn H. J. Mol. Biol. 1996; 264: 1145-1153Crossref PubMed Scopus (75) Google Scholar). More recently, an amino acid was identified from modeling and sequence comparisons that could change a plant 13S-LOX to 9S-LOX specificity (24.Hornung E. Walther M. Kühn H. Feussner I. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 4192-4197Crossref PubMed Scopus (133) Google Scholar). This change is more akin to the positional specificity issues with the enzymes we have been studying. In both instances the change in LOX specificity must involve a turning around of the substrate in the active site. The residue identified in the plant enzyme is His608 of the cucumber lipid body 13-LOX. (Owing to the longer N-terminal sequence of plant lipoxygenases, this is roughly equivalent to position 420 in the mammalian enzymes.) Due to the weak percent identities of plant and mammalian lipoxygenases in this region, location of the equivalent residues in the 8-LOX and 15-LOX-2 is problematic; the alignments point to residues within a few amino acids of the mammalian consensus Gly-Gly-Gly-Gly motif that is not found in the plant enzymes. From sequence alignments, there appears to be a strong possibility that the residues we identified in the mouse 8-LOX will have an influence on the specificity of other mammalian lipoxygenases. This applies especially to the mammalian 5-LOX enzymes, as they conserve the histidine equivalent to His604 of the mouse 8-LOX (Fig. 8). A potential role of this 5-LOX histidine in positional specificity has been speculated upon before on the basis of sequence alignment and modeling studies (10.Prigge S.T. Boyington J.C. Gaffney B.J. Amzel L.M. Proteins Struct. Funct. Genet. 1996; 24: 275-291Crossref PubMed Scopus (90) Google Scholar). In addition, the conserved tryptophan just before the histidine in the 5-LOX primary structures has a related character to Tyr603 of the 8-LOX. The likeness between the 5-LOX and 8-LOX is all the more compelling because both C-5 and C-8 oxygenations involve a similar mode of substrate binding (10.Prigge S.T. Boyington J.C. Gaffney B.J. Amzel L.M. Proteins Struct. Funct. Genet. 1996; 24: 275-291Crossref PubMed Scopus (90) Google Scholar, 23.Schwarz K. Borngräber S. Anton M. Kühn H. Biochemistry. 1998; 37: 15327-15335Crossref PubMed Scopus (41) Google Scholar), differing only in a frameshift along the carbon chain. Mutation studies of these amino acids of mammalian 5-LOX would be interesting. We thank Brenda Leake for excellent technical assistance in expression experiments using HeLa cells and vaccinia virus." @default.
W1985941719 created "2016-06-24" @default.
W1985941719 creator A5007321180 @default.
W1985941719 creator A5037990142 @default.
W1985941719 creator A5039450987 @default.
W1985941719 creator A5075104884 @default.
W1985941719 date "2000-01-01" @default.
W1985941719 modified "2023-09-30" @default.
W1985941719 title "Identification of Amino Acid Determinants of the Positional Specificity of Mouse 8S-Lipoxygenase and Human 15S-Lipoxygenase-2" @default.
W1985941719 cites W1531198291 @default.
W1985941719 cites W1532774873 @default.
W1985941719 cites W1965700036 @default.
W1985941719 cites W1975207791 @default.
W1985941719 cites W1978704058 @default.
W1985941719 cites W1994701129 @default.
W1985941719 cites W1998036446 @default.
W1985941719 cites W2003515696 @default.
W1985941719 cites W2008215698 @default.
W1985941719 cites W2010355242 @default.
W1985941719 cites W2028705982 @default.
W1985941719 cites W2030771414 @default.
W1985941719 cites W2032763669 @default.
W1985941719 cites W2048310961 @default.
W1985941719 cites W2048855990 @default.
W1985941719 cites W2058699308 @default.
W1985941719 cites W2062213512 @default.
W1985941719 cites W2072537434 @default.
W1985941719 cites W2074203890 @default.
W1985941719 cites W2104512614 @default.
W1985941719 cites W2162832897 @default.
W1985941719 cites W2163782474 @default.
W1985941719 cites W2300552860 @default.
W1985941719 doi "https://doi.org/10.1074/jbc.275.2.1287" @default.
W1985941719 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10625675" @default.
W1985941719 hasPublicationYear "2000" @default.
W1985941719 type Work @default.
W1985941719 sameAs 1985941719 @default.
W1985941719 citedByCount "95" @default.
W1985941719 countsByYear W19859417192012 @default.
W1985941719 countsByYear W19859417192013 @default.
W1985941719 countsByYear W19859417192014 @default.
W1985941719 countsByYear W19859417192015 @default.
W1985941719 countsByYear W19859417192016 @default.
W1985941719 countsByYear W19859417192017 @default.
W1985941719 countsByYear W19859417192018 @default.
W1985941719 countsByYear W19859417192019 @default.
W1985941719 countsByYear W19859417192020 @default.
W1985941719 countsByYear W19859417192021 @default.
W1985941719 countsByYear W19859417192022 @default.
W1985941719 countsByYear W19859417192023 @default.
W1985941719 crossrefType "journal-article" @default.
W1985941719 hasAuthorship W1985941719A5007321180 @default.
W1985941719 hasAuthorship W1985941719A5037990142 @default.
W1985941719 hasAuthorship W1985941719A5039450987 @default.
W1985941719 hasAuthorship W1985941719A5075104884 @default.
W1985941719 hasBestOaLocation W19859417191 @default.
W1985941719 hasConcept C116834253 @default.
W1985941719 hasConcept C181199279 @default.
W1985941719 hasConcept C185592680 @default.
W1985941719 hasConcept C2778078955 @default.
W1985941719 hasConcept C2780857362 @default.
W1985941719 hasConcept C55493867 @default.
W1985941719 hasConcept C59822182 @default.
W1985941719 hasConcept C86803240 @default.
W1985941719 hasConcept C90342290 @default.
W1985941719 hasConceptScore W1985941719C116834253 @default.
W1985941719 hasConceptScore W1985941719C181199279 @default.
W1985941719 hasConceptScore W1985941719C185592680 @default.
W1985941719 hasConceptScore W1985941719C2778078955 @default.
W1985941719 hasConceptScore W1985941719C2780857362 @default.
W1985941719 hasConceptScore W1985941719C55493867 @default.
W1985941719 hasConceptScore W1985941719C59822182 @default.
W1985941719 hasConceptScore W1985941719C86803240 @default.
W1985941719 hasConceptScore W1985941719C90342290 @default.
W1985941719 hasIssue "2" @default.
W1985941719 hasLocation W19859417191 @default.
W1985941719 hasOpenAccess W1985941719 @default.
W1985941719 hasPrimaryLocation W19859417191 @default.
W1985941719 hasRelatedWork W1938854368 @default.
W1985941719 hasRelatedWork W1966418295 @default.
W1985941719 hasRelatedWork W2048893408 @default.
W1985941719 hasRelatedWork W2072160198 @default.
W1985941719 hasRelatedWork W2073339995 @default.
W1985941719 hasRelatedWork W2592360891 @default.
W1985941719 hasRelatedWork W2769069686 @default.
W1985941719 hasRelatedWork W3035988091 @default.
W1985941719 hasRelatedWork W861079828 @default.
W1985941719 hasRelatedWork W89645382 @default.
W1985941719 hasVolume "275" @default.
W1985941719 isParatext "false" @default.
W1985941719 isRetracted "false" @default.
W1985941719 magId "1985941719" @default.
W1985941719 workType "article" @default.