FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1986094891> ?p ?o ?g. }

• W1986094891 endingPage "21417" @default.
• W1986094891 startingPage "21409" @default.
• W1986094891 abstract "The Hrp pilus plays an essential role in the long-distance type III translocation of effector proteins from bacteria into plant cells. HrpA is the structural subunit of the Hrp pilus in Pseudomonas syringae pv. tomato (Pst) DC3000. Little is known about the molecular features in the HrpA protein for pilus assembly or for transporting effector proteins. From previous collections of nonfunctional HrpA derivatives that carry random pentapeptide insertions or single amino acid mutations, we identified several dominant-negative mutants that blocked the ability of wild-type Pst DC3000 to elicit host responses. The dominant-negative phenotype was correlated with the disappearance of the Hrp pilus in culture and inhibition of wild-type HrpA protein self-assembly in vitro. Dominant-negative HrpA mutants can be grouped into two functional classes: one class exerted a strong dominant-negative effect on the secretion of effector proteins AvrPto and HopPtoM in culture, and the other did not. The two classes of mutant HrpA proteins carry pentapeptide insertions in discrete regions, which are interrupted by insertions without a dominant-negative effect. These results enable prediction of possible subunit-subunit interaction sites in the assembly of the Hrp pilus and suggest the usefulness of dominant-negative mutants in dissection of the role of the wild-type HrpA protein in various stages of type III translocation: protein exit across the bacterial cell wall, the assembly and/or stabilization of the Hrp pilus in the extracellular space, and Hrp pilus-mediated long-distance transport beyond the bacterial cell wall. The Hrp pilus plays an essential role in the long-distance type III translocation of effector proteins from bacteria into plant cells. HrpA is the structural subunit of the Hrp pilus in Pseudomonas syringae pv. tomato (Pst) DC3000. Little is known about the molecular features in the HrpA protein for pilus assembly or for transporting effector proteins. From previous collections of nonfunctional HrpA derivatives that carry random pentapeptide insertions or single amino acid mutations, we identified several dominant-negative mutants that blocked the ability of wild-type Pst DC3000 to elicit host responses. The dominant-negative phenotype was correlated with the disappearance of the Hrp pilus in culture and inhibition of wild-type HrpA protein self-assembly in vitro. Dominant-negative HrpA mutants can be grouped into two functional classes: one class exerted a strong dominant-negative effect on the secretion of effector proteins AvrPto and HopPtoM in culture, and the other did not. The two classes of mutant HrpA proteins carry pentapeptide insertions in discrete regions, which are interrupted by insertions without a dominant-negative effect. These results enable prediction of possible subunit-subunit interaction sites in the assembly of the Hrp pilus and suggest the usefulness of dominant-negative mutants in dissection of the role of the wild-type HrpA protein in various stages of type III translocation: protein exit across the bacterial cell wall, the assembly and/or stabilization of the Hrp pilus in the extracellular space, and Hrp pilus-mediated long-distance transport beyond the bacterial cell wall. The bacterial type III secretion system (TTSS) 1The abbreviations used are: TTSS, type III secretion system; Pst, Pseudomonas syringae pv. tomato; HR, hypersensitive response; MM, hrp-inducing fructose minimal media.1The abbreviations used are: TTSS, type III secretion system; Pst, Pseudomonas syringae pv. tomato; HR, hypersensitive response; MM, hrp-inducing fructose minimal media. is a long-distance protein transport system, moving bacterial effector proteins from the bacterial cytoplasm into a eukaryotic cell (1Galán J.E. Collmer A. Science. 1999; 284: 1322-1328Crossref PubMed Scopus (1015) Google Scholar, 2Cornelis G.R. Van Gijsegem F. Annu. Rev. Microbiol. 2000; 54: 735-774Crossref PubMed Scopus (640) Google Scholar, 3He S.Y. Jin Q. Curr. Opinion. Microbiol. 2003; 6: 5-19Crossref Scopus (47) Google Scholar, 4Romantschuk M. Roine E. Taira S. Eur. J. Plant Pathol. 2001; 107: 153-160Crossref Scopus (19) Google Scholar). During this long-distance transport, several physical barriers must be traversed: the bacterial cell wall, the host extracellular matrix layer (e.g. plant cell wall or animal mucous layer/glycocalyx), and the host plasma membrane. The TTSS has adapted to such long-distance transport by assembling extracellular needle/pilus-like appendages of various lengths (3He S.Y. Jin Q. Curr. Opinion. Microbiol. 2003; 6: 5-19Crossref Scopus (47) Google Scholar, 4Romantschuk M. Roine E. Taira S. Eur. J. Plant Pathol. 2001; 107: 153-160Crossref Scopus (19) Google Scholar). For example, the TTSS of mammalian pathogenic bacteria assembles a needle complex, which consists of a base structure embedded in the bacterial cell wall and a primarily extracellular hollow needle of 6–8 nm in diameter and 50–80 nm in length (5Kubori T. Matsushima Y. Nakamura D. Uralil J. Lara-Tejero M. Sukhan A. Galán J.E. Aizawa S.-I. Science. 1998; 280: 602-605Crossref PubMed Scopus (695) Google Scholar, 6Kimbrough T.G. Miller S.I. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 11008-11013Crossref PubMed Scopus (192) Google Scholar, 7Blocker A. Jouihri N. Larquet E. Gounon P. Ebel F. Parsot C. Sansonetti P. Allaoui A. Mol. Microbiol. 2001; 39: 652-663Crossref PubMed Scopus (288) Google Scholar, 8Hoiczyk E. Blobel G. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4669-4674Crossref PubMed Scopus (138) Google Scholar, 9Tamano K. Aizawa S.-I. Katayama E. Nonaka T. Imajoh-Ohmi A. Kuwae A. Nagai S. Sasakawa C. EMBO J. 2000; 19: 3876-3887Crossref PubMed Scopus (196) Google Scholar, 10Journet L. Agrain C. Broz P. Cornelis G.R. Science. 2003; 302: 1757-1760Crossref PubMed Scopus (235) Google Scholar). In enteropathogenic Escherichia coli, the needle is connected with another extracellular filament called the EspA filament (11Daniell S.J. Kocsis E. Morris E. Knutton S. Booy F.P. Frankel G. Mol. Microbiol. 2003; 49: 301-308Crossref PubMed Scopus (78) Google Scholar, 12Sekiya K. Ohishi M. Ogino T. Tamano K. Sasakawa C. Abe A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 11638-11643Crossref PubMed Scopus (249) Google Scholar). The EspA filament is 12 nm in diameter and can be several micrometers long (13Knutton S. Rosenshine I. Pallen M.J. Nisan I. Neves B.C. Bain C. Wolff C. Dougan G. Frankel G. EMBO J. 1998; 17: 2166-2176Crossref PubMed Scopus (464) Google Scholar, 14Ebel F. Podzadel T. Rohde M. Kresse A.U. Kramer S. Deibel C. Guzman C.A. Chakraborty T. Mol. Microbiol. 1998; 30: 147-161Crossref PubMed Scopus (137) Google Scholar). The TTSS of plant pathogenic bacteria assembles an extracellular appendage called the Hrp pilus, which is 6–8 nm wide and several micrometers long (15Roine E. Wei W. Yuan J. Nurmiaho-Lassila E.-L. Kalkkinen N. Romantschuk M. He S.Y. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3459-3464Crossref PubMed Scopus (263) Google Scholar, 16Roine E. Saarinen J. Kalkkinen N. Romantschuk M. FEBS Lett. 1997; 417: 168-172Crossref PubMed Scopus (30) Google Scholar, 17Van Gijsegem F. Vasse J. Camus J. Marenda M. Boucher C. Mol. Microbiol. 2000; 36: 249-260Crossref PubMed Scopus (106) Google Scholar, 18Jin Q. Hu W. Brown I. McGhee G. Hart P. McGhee G. Hart P. Jones A.L. He S.Y. Mol. Microbiol. 2001; 40: 1129-1139Crossref PubMed Scopus (79) Google Scholar, 19Buttner D. Bonas U. EMBO J. 2002; 21: 5313-5322Crossref PubMed Scopus (177) Google Scholar, 20Van Gijsegem F. Vasse J. De Rycke R. Castello P. Boucher C. Mol. Microbiol. 2002; 44: 935-946Crossref PubMed Scopus (29) Google Scholar). The needle, EspA filament, and Hrp pilus are believed to be tunnels linking the type III “secreton” embedded in the bacterial cell wall and a type III “translocon” in the host plasma membrane. The secreton allows the exit of effector proteins across the bacterial cell wall, which can be studied in culture as a separate step, whereas the translocon allows the translocation of effectors into the host cell. In vivo, type III secretion/translocation likely occurs as a continuous process through the secreton, the needle/EspA filament/Hrp pilus, and the translocon.The structural subunits of Hrp pili in Pst strain DC3000 and Ralstonia solanacearum are HrpA and HrpY proteins, respectively (15Roine E. Wei W. Yuan J. Nurmiaho-Lassila E.-L. Kalkkinen N. Romantschuk M. He S.Y. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3459-3464Crossref PubMed Scopus (263) Google Scholar, 17Van Gijsegem F. Vasse J. Camus J. Marenda M. Boucher C. Mol. Microbiol. 2000; 36: 249-260Crossref PubMed Scopus (106) Google Scholar). The hrpA and hrpY genes are required for bacterial causation of TTSS-associated host responses: disease in susceptible plants and the hypersensitive response (HR) in resistant plants (15Roine E. Wei W. Yuan J. Nurmiaho-Lassila E.-L. Kalkkinen N. Romantschuk M. He S.Y. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3459-3464Crossref PubMed Scopus (263) Google Scholar, 17Van Gijsegem F. Vasse J. Camus J. Marenda M. Boucher C. Mol. Microbiol. 2000; 36: 249-260Crossref PubMed Scopus (106) Google Scholar). A comprehensive mutational study of type III secretion (hrp) genes in R. solanacearum showed a close correlation between Hrp pilus assembly, type III protein secretion, and bacterial elicitation of TTSS-associated plant responses (20Van Gijsegem F. Vasse J. De Rycke R. Castello P. Boucher C. Mol. Microbiol. 2002; 44: 935-946Crossref PubMed Scopus (29) Google Scholar). Microscopic studies show that newly secreted effector proteins are localized near the tip of the Hrp pilus, suggesting that the Hrp pilus serves as a conduit for long-distance transport of effector proteins in the extracellular space (21Jin Q. He S.Y. Science. 2001; 294: 2556-2558Crossref PubMed Scopus (147) Google Scholar, 22Li C.M. Brown I. Mansfield J. Stevens C. Boureau T. Romantschuk M. Taira S. EMBO J. 2002; 21: 1909-1915Crossref PubMed Scopus (97) Google Scholar).Little is known about the molecular details of subunit-subunit interactions during the assembly of TTSS needle/pilus or the exact mechanisms by which these filaments function in long-distance protein transport. Dominant-negative mutants are powerful tools for understanding the structure, assembly, and function of protein complexes in biological systems. We focused this study on the identification and characterization of dominant-negative mutants of HrpA. We reasoned that identification and characterization of dominant-negative mutants of HrpA will not only improve our understanding of HrpA function in pilus assembly and type III protein transport but also create an opportunity for determination of the HrpA tertiary structure. Currently, no high-resolution x-ray crystal structure of a type III conduit protein in the final conformation has been reported. This is likely due to the technical problem that these proteins preferentially form multimeric superstructures rather than three-dimensional crystals. We reasoned that a subset of dominant-negative mutant HrpA monomers may be partially defective in assembly and may more readily crystallize.In a previous study, Taira et al. (23Taira S. Jarno T. Elina R. Eeva-Liisa N.-L. Harri S. Martin R. Mol. Microbiol. 1999; 34: 737-744Crossref PubMed Scopus (46) Google Scholar) created a comprehensive set of pentapeptide insertions in the Pst DC3000 HrpA protein and identified 21 nonfunctional HrpA mutants with insertions located in the C-terminal half of the HrpA protein. These mutant HrpA proteins could not complement a Pst DC3000 hrpA mutant for either production of the extracellular Hrp pilus or elicitation of plant responses. In another study, Wei et al. (24Wei W. Plovanich-Jones A. Deng W.-L. Collmer A. Huang H.-C. He S.Y. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 2247-2252Crossref PubMed Scopus (102) Google Scholar) reported several nonfunctional HrpA proteins caused by single amino acid mutations. The biochemical defects of all these mutant HrpA proteins are not understood. In this study, we found that several pentapeptide-induced nonfunctional HrpA proteins, when expressed from a plasmid, exerted a strong dominant-negative effect on the function of the wild-type HrpA protein in vitro and in vivo. A detailed analysis of these dominant-negative HrpA mutants led to the identification of several specific regions within the HrpA protein that differentially affect the ability of wild-type Pst DC3000 to elicit TTSS-associated plant responses, assemble/stabilize the extracellular pilus, and/or secrete effector proteins across the bacterial cell wall in culture.EXPERIMENTAL PROCEDURESBacterial Strains and Growth Conditions—The Pst strain used in this research was DC3000. pHRPA derivatives carrying single amino acid mutations were reported previously (24Wei W. Plovanich-Jones A. Deng W.-L. Collmer A. Huang H.-C. He S.Y. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 2247-2252Crossref PubMed Scopus (102) Google Scholar). The hrpA plasmids carrying random 15-bp insertions were kindly provided by Dr. Suvi Taira (23Taira S. Jarno T. Elina R. Eeva-Liisa N.-L. Harri S. Martin R. Mol. Microbiol. 1999; 34: 737-744Crossref PubMed Scopus (46) Google Scholar). The hrpA gene inserts in the latter hrpA plasmids were amplified by PCR using oligonucleotides ATATAGGATCCTGCAAAGACGCTGGAACC (EcoRI is underlined) and ATATAGAATTCGGGGTACCTCCTCAAGGTAGCGGCCCCCTC (BamHI is underlined) and cloned into pUCP19 (25Schweizer H.P. Gene (Amst.). 1991; 97: 109-112Crossref PubMed Scopus (335) Google Scholar). The resulting plasmids were introduced into Pst DC3000 by electroporation. The truncated avrRpt280–255 gene (26Mudgett M.B. Chesnokova O. Dahlbeck D. Clark E.T. Rossier O. Bonas U. Staskawicz B.J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 13324-13329Crossref PubMed Scopus (125) Google Scholar) was cloned into the XbaI-HindIII site of pUCP19. The hrpA gene was amplified by PCR using primers TGAATTCTTGCAAAGACGCTGGAACCG (EcoRI site is underlined) and AATCTAGAGTAACTGATACCTTTAGCG (XbaI site is underlined) and fused to the 5′ end of avrRpt280–255.The bacteria were grown in Luria-Bertani (LB) medium (27Sambrook J. Fritsch E. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar) at 30 °C or in hrp-inducing fructose minimal media (MM) (28Huynh T.V. Dahlbeck D. Staskawicz B.J. Science. 1989; 245: 1374-1377Crossref PubMed Scopus (395) Google Scholar) at 20 °C. Antibiotics used were rifampicin (50 μg/ml) and ampicillin (100 μg/ml).Hypersensitive Response and Disease Assay—Bacteria were grown to an A600 of ∼0.6 in LB media. Bacteria were pelleted and then resuspended in sterilized distilled water to an A600 of 0.2 (∼1 × 108 cfu/ml; for HR assay) or 0.002 (∼1 × 106 cfu/ml; for disease assay). Bacterial suspensions were infiltrated into fully expanded leaves of tobacco (Nicotiana tabacum L. cv. Samsun NN) or Arabidopsis thaliana (accession Col-0) using a sterile, needleless plastic syringe. The HR symptom in tobacco leaves, characterized by tissue collapse in the infiltrated area, was observed 20 h after inoculation. Disease necrosis in Arabidopsis leaves was monitored over a 4-day period.Assay for Secretion of Effector Proteins in Culture—Bacteria were grown in LB broth until A600 = 0.6 and collected by centrifugation. The cells were resuspended in hrp-inducing MM or LB and incubated with shaking at 20 °C for 12 h. Cultures were separated into cell and supernatant fractions by centrifugation at 14,000 × g. The cell and supernatant fractions were concentrated 5 and 50 times, respectively. The proteins in these fractions were separated on 15% SDS-PAGE gels (29Laemmli U. Nature. 1970; 227: 680-685Crossref PubMed Scopus (205955) Google Scholar) and transferred to Immobilon-P membrane (Millipore Corp.). Immunoblot was performed with primary antibodies against HrpA, AvrPto, HopPtoM, or ShcM and a secondary alkaline phosphatase-conjugated antibody (Sigma).Scanning and Transmission Electron Microscopic Analyses—The methods for both electron microscopic analyses were essentially the same as those described by Flegler et al. (30Flegler S.L. Heckman J.W. Klomparens K.L. Scanning and Transmission Electron Microscopy: An Introduction. Oxford Press, Oxford1993: 43-168Google Scholar), except for a few modifications. Briefly, scanning electron microscopy was performed on bacterial cells grown on carbon/formvar-coated nickel grids (300 mesh). A 10-μl droplet of bacterial suspension, adjusted to an A600 of 0.1 in hrp-inducing MM, was placed on a grid and incubated at 20 °C for 14 h. Bacteria were fixed in 4% glutaraldehyde with 0.1 m cacodylate buffer (pH 7.4) and dehydrated in a series (25%, 50%, 75%, and 95%) of ethanol, critical-point dried using liquid as the transitional fluid, and sputter coated with gold (∼7 nm thick). At each step, the bacteria were treated as gently as possible to preserve the integrity of surface structures. The mounted bacteria were viewed with a JEOL 6300F scanning electron microscope. Images were captured and stored electronically.For examination of self-assembly of purified HrpA proteins into pilus-like structures, the pH of the HrpA solution (pH 5.0) was raised to 7.8 by adding 0.1 volume of 0.2 m Tris-HCl (pH 8.0; filtered). After a 20-min incubation at room temperature, a 10-μl drop of the sample was applied to a grid. Three minutes later, excess sample was removed using a piece of filter paper. The grid was dried in a fume hood for 5 min, stained with 1% phosphotungstic acid (pH 6.5), air-dried again, and examined using a JEOL 100-CEX transmission electron microscope at an accelerating voltage of 100 kV (18Jin Q. Hu W. Brown I. McGhee G. Hart P. McGhee G. Hart P. Jones A.L. He S.Y. Mol. Microbiol. 2001; 40: 1129-1139Crossref PubMed Scopus (79) Google Scholar). To investigate the effect of a mutant HrpA protein on the self-assembly of the wild-type HrpA protein, we mixed one part of wild-type HrpA protein with one part of the same concentration (∼2 mg/ml) or 10-, 25-, or 50-fold diluted mutant HrpA protein. The mixtures were treated as described above and examined with a transmission electron microscope.Overproduction and Purification of HrpA Protein—Wild-type and mutant hrpA genes were amplified using oligonucleotides 5′-GGA ATTCATATGGTCGCATTTGCAGGAT-3′ and 5′-GGGTAACGCCAGGGTTTT-3′ and cloned into the NdeI and EcoRI sites of pET28a (Novagen). HrpA proteins with the N-terminal His6 tag were overexpressed in E. coli BL21 (DE3) and purified using an NTA column (Qiagen) following the manufacturer's instructions. The elution buffer contained 50 mm NaH2PO4, 500 mm NaCl, and 250 mm imidazole. The HrpA protein preparations were concentrated using Amicon concentrators (molecular weight cutoff of 3000 daltons) to ∼2 mg/ml. The N-terminal His6 tag was removed using the thrombin cleavage capture kit (Novagen). The resulting HrpA protein solutions were stored in 20 mm sodium acetate buffer (pH 5.0).RESULTSDominant-negative Effect of HrpA-AvrRpt280–255 on Pst DC3000—In a previous study (31Zwiesler-Vollick J. Plovanich-Jones A. Nomura K. Bandyopadhyay S. Joardar V. Kunkel B.N. He S.Y. Mol. Microbiol. 2002; 45: 1207-1218Crossref PubMed Scopus (112) Google Scholar), we attempted to identify new type III effector genes in Pst DC3000 using the type III translocation reporter AvrRpt280–255 (26Mudgett M.B. Chesnokova O. Dahlbeck D. Clark E.T. Rossier O. Bonas U. Staskawicz B.J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 13324-13329Crossref PubMed Scopus (125) Google Scholar, 32Guttman D.S. Greenberg J.T. Mol. Plant-Microbe Interact. 2001; 14: 145-155Crossref PubMed Scopus (119) Google Scholar). As expected, DC3000(pAVRPTO-AVRRPT280–255) caused RPS2-dependent HR, suggesting that this effector is translocated into the Arabidopsis cell (30Flegler S.L. Heckman J.W. Klomparens K.L. Scanning and Transmission Electron Microscopy: An Introduction. Oxford Press, Oxford1993: 43-168Google Scholar). However, Pst DC3000(pHRPA-AVRRPT2) gave an unexpected result. Not only was there no RPS2-dependent HR (data not shown), but this strain also did not give an HR in the nonhost tobacco, nor did it cause disease in the host Arabidopsis (Fig. 1A). In these experiments, all fusion proteins were expressed from plasmid pUCP19 (33Keen N.T. Tamaki S. Kobayashi D. Trollinger D. Gene (Amst.). 1988; 70: 191-197Crossref PubMed Scopus (1266) Google Scholar).To determine whether the negative effect of the HrpA-AvrRpt280–255 fusion on the ability of DC3000 to elicit host responses was caused by an overexpression of HrpA from pUCP18/19, we analyzed pHRPA, which expresses only HrpA from pUCP18 (15Roine E. Wei W. Yuan J. Nurmiaho-Lassila E.-L. Kalkkinen N. Romantschuk M. He S.Y. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3459-3464Crossref PubMed Scopus (263) Google Scholar, 24Wei W. Plovanich-Jones A. Deng W.-L. Collmer A. Huang H.-C. He S.Y. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 2247-2252Crossref PubMed Scopus (102) Google Scholar). In contrast to pHRPA-AVRRPT280–255, pHRPA did not have a dominant-negative effect on the ability of DC3000 to elicit the HR or to cause disease (Fig. 1A). Furthermore, none of the other type III effector-AvrRpt280–255 fusions we made in pUCP18 had a negative effect on the ability of DC3000 to elicit host responses (30Flegler S.L. Heckman J.W. Klomparens K.L. Scanning and Transmission Electron Microscopy: An Introduction. Oxford Press, Oxford1993: 43-168Google Scholar, 34Badel J.L. Nomura K. Bandyopadhyay S. Shimizu R. Collmer A. He S.Y. Mol. Microbiol. 2003; 49: 1239-1251Crossref PubMed Scopus (79) Google Scholar). Thus, it appears that a negative effect on the ability of DC3000 to carry out TTSS-associated functions is unique to the fusion between AvrRpt2 and HrpA, even though both proteins are normal TTSS substrates.To determine the molecular basis of the effect of the addition of AvrRpt280–255 to the C terminus of HrpA, we examined the secretion of TTSS substrates across the bacterial cell wall in culture. Three substrates were monitored: HrpA, HopPtoM (34Badel J.L. Nomura K. Bandyopadhyay S. Shimizu R. Collmer A. He S.Y. Mol. Microbiol. 2003; 49: 1239-1251Crossref PubMed Scopus (79) Google Scholar), and AvrPto (24Wei W. Plovanich-Jones A. Deng W.-L. Collmer A. Huang H.-C. He S.Y. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 2247-2252Crossref PubMed Scopus (102) Google Scholar). We found that none of these three TTSS substrates was detectable in the culture medium of Pst DC3000(pHRPA-AVRRPT280–255), whereas wild-type DC3000 and DC3000 carrying pUCP18 (the vector control) or pHRPA secreted all three proteins (Fig. 1B). In DC3000(pHRPAAVRRPT280–255), the HrpA-AvrRpt2 fusion itself was detected in the cell but was not secreted to the medium (Fig. 1B). These results suggest that the dominant-negative effect of the HrpA-AvrRpt280–255 fusion results from HrpA-AvrRpt280–255-mediated poisoning of the secreton structure and blockage of the exit of TTSS substrates across the bacterial cell wall. Thus, addition of a normal TTSS substrate protein, AvrRpt2, to the C terminus of HrpA causes a dominant-negative effect on the function of the TTSS.Identification of HrpA Mutants that Exhibit Dominant-negative Effects—To determine whether mutations within the HrpA protein could also produce dominant-negative derivatives, we used the elicitation of the HR in the nonhost tobacco as a rapid method of screening of the 3 previously reported mutant HrpA proteins carrying single amino acid mutations (24Wei W. Plovanich-Jones A. Deng W.-L. Collmer A. Huang H.-C. He S.Y. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 2247-2252Crossref PubMed Scopus (102) Google Scholar) and 21 mutant HrpA proteins carrying random pentapeptide insertions (23Taira S. Jarno T. Elina R. Eeva-Liisa N.-L. Harri S. Martin R. Mol. Microbiol. 1999; 34: 737-744Crossref PubMed Scopus (46) Google Scholar). DC3000, DC3000(pUCP18), and DC3000(pHRPA) were used as positive controls in this screen. All three positive control strains elicited a robust HR in tobacco leaves (Fig. 2A). In contrast, 11 nonfunctional HrpA proteins carrying pentapeptide insertion F1, F2, F4, F5, F6, F9, F12, F13, F18, F19, or F20 (insertion 203, 204, 287, 211, 213, 379, 246, 248, 272, 288, and 289, respectively, in Ref. 23Taira S. Jarno T. Elina R. Eeva-Liisa N.-L. Harri S. Martin R. Mol. Microbiol. 1999; 34: 737-744Crossref PubMed Scopus (46) Google Scholar) exerted a strong dominant-negative effect, preventing DC3000 from eliciting an HR (Fig. 2). Three nonfunctional HrpA proteins containing single amino acid mutations and six nonfunctional HrpA proteins carrying pentapeptide insertion F7, F8, F10, F11, F16, or F17 (insertion 224, 239, 234, 245, 260, and 268, respectively, in Ref. 23Taira S. Jarno T. Elina R. Eeva-Liisa N.-L. Harri S. Martin R. Mol. Microbiol. 1999; 34: 737-744Crossref PubMed Scopus (46) Google Scholar) had no dominant-negative effect (Fig. 2B). Four nonfunctional HrpA proteins carrying insertion F3, F14, F15, or F22 (insertion 208, 254, 258, and 378, respectively, in Ref. 23Taira S. Jarno T. Elina R. Eeva-Liisa N.-L. Harri S. Martin R. Mol. Microbiol. 1999; 34: 737-744Crossref PubMed Scopus (46) Google Scholar) gave an intermediate dominant-negative effect. According to the HR phenotype, we grouped the analyzed non-functional HrpA proteins into class I (F1, F2, F4, F5, F6, F9, F12, F13, F18, F19, and F20), class II (F7, F8, F10, F11, F16, and F17), and class III (F3, F14, F15, and F22). Class III mutants were not studied further because of the significant variability in the HR phenotype in different experiments.Fig. 2Dominant-negative effects of pHRPA derivatives carrying pentapeptide insertions on the ability of Pst DC3000 to cause the HR in non-host tobacco and/or disease in host Arabidopsis leaves. A, Pst DC3000 (-) or Pst DC3000 carrying pHRPA-F4, -F5, -F6, -F7, -F8, or -F9 was infiltrated into tobacco or Arabidopsis leaves. The HR and disease assay conditions were identical to those described in Fig. 1A. B, a diagram of the C-terminal portion (nucleotides 241–436, amino acid residues 50–113) of HrpA (adapted from Taira et al., Ref. 23Taira S. Jarno T. Elina R. Eeva-Liisa N.-L. Harri S. Martin R. Mol. Microbiol. 1999; 34: 737-744Crossref PubMed Scopus (46) Google Scholar). The 21 pentapeptide insertions (F1–F20 and F22) are indicated by different symbols based on their dominant-negative phenotypes: ▵, dominant-negative mutants that block Pst DC3000 to cause the HR and disease but allow effector secretion in culture; □, mutants that have inconsistent dominant-negative phenotypes; ○, mutants that do not have a dominant-negative phenotype; and ⋄, mutants that block Pst DC3000 to cause the HR and disease and to secrete effector proteins in culture.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Dominant-negative Effect on the Secretion of HrpA and Effector Proteins in Culture—To determine whether the dominant-negative pentapeptide insertional HrpA mutants, like pHRPA-AVRRPT280–255, also poison the secreton function, we examined the secretion of HrpA, AvrPto, and HopPtoM in culture. The three proteins were produced in similar amounts in DC3000 and in DC3000 carrying the mutant hrpA plasmids (Fig. 3), suggesting that the dominant-negative effect was not exerted at the gene expression level. DC3000 containing class II mutants (e.g. F7) secreted HrpA, AvrPto, and HopPtoM normally to the outside of the cell (Fig. 3). However, DC3000 containing pHRPA-AVRRPT280–255 or some of the class I mutants (e.g. F4) secreted much reduced levels of HrpA and no detectable AvrPto and HopPtoM, whereas DC3000 containing other class I mutants (e.g. F5) secreted all three proteins. There was a tight correlation between secretion of HrpA and effector proteins AvrPto and HopPtoM; however, the dominant-negative effect on the secretion of AvrPto and HopPtoM seemed more severe than that on the secretion of HrpA. The cytoplasmic marker protein ShcM was detected only in the cell fraction, indicating no nonspecific leakage in these experiments (Fig. 3). Taken together, these results suggest that the dominant-negative effect of seven class I mutants (F2, F4, F6, F13, F18, F19, and F20; henceforth designated class IA), like pHRPA-AVRRPT280–255, can be attributed to the poisoning of the secreton structure in the bacterial cell wall. However, the dominant-negative effect of four class I mutants (F1, F5, F9, and F12; henceforth designated class IB) on HR elicitation cannot be explained by poisoning of the secreton structure.Fig. 3Immunoblot analysis of the effects of HrpA mutants on the ability of DC3000 to produce and/or secrete effector proteins in culture. Conditions for bacterial growth and immunoblotting were identical to those described in Fig. 1B. The cytosolic chaperone ShcM was used as a cytoplasmic protein control. All HrpA mutants were examined. Results from representative strains are shown here. In the cell fractions of the AvrPto and HopPtoM blots, arrows indicate AvrPto and HopPtoM, to distinguish them from cross-reacting proteins present in all lanes.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Dominant-negative Effect on the Production of Extracellular Hrp Pili in Vivo—We next examined a possible dominant-negative effect of pentapeptide-induced mutant HrpA proteins on the formation of the Hrp pilus in culture. Because of the time-consuming nature of electron microscopic experiments, we selected two" @default.
• W1986094891 created "2016-06-24" @default.
• W1986094891 creator A5007488043 @default.
• W1986094891 creator A5012023203 @default.
• W1986094891 creator A5063916067 @default.
• W1986094891 creator A5065928196 @default.
• W1986094891 creator A5069579045 @default.
• W1986094891 date "2005-06-01" @default.
• W1986094891 modified "2023-10-09" @default.
• W1986094891 title "Use of Dominant-negative HrpA Mutants to Dissect Hrp Pilus Assembly and Type III Secretion in Pseudomonas syringae pv. tomato" @default.
• W1986094891 cites W1776637609 @default.
• W1986094891 cites W1844213024 @default.
• W1986094891 cites W1899522406 @default.
• W1986094891 cites W1952362090 @default.
• W1986094891 cites W1970356669 @default.
• W1986094891 cites W1971096395 @default.
• W1986094891 cites W1972010400 @default.
• W1986094891 cites W1972449088 @default.
• W1986094891 cites W1975890187 @default.
• W1986094891 cites W1978028607 @default.
• W1986094891 cites W1981032027 @default.
• W1986094891 cites W1983160090 @default.
• W1986094891 cites W1989393852 @default.
• W1986094891 cites W2017728221 @default.
• W1986094891 cites W2019500447 @default.
• W1986094891 cites W2021862499 @default.
• W1986094891 cites W2022873862 @default.
• W1986094891 cites W2025184174 @default.
• W1986094891 cites W2030986720 @default.
• W1986094891 cites W2031703416 @default.
• W1986094891 cites W2039457979 @default.
• W1986094891 cites W2040955136 @default.
• W1986094891 cites W2041211295 @default.
• W1986094891 cites W2046359764 @default.
• W1986094891 cites W2051241165 @default.
• W1986094891 cites W2051359148 @default.
• W1986094891 cites W2076833953 @default.
• W1986094891 cites W2081305809 @default.
• W1986094891 cites W2084852164 @default.
• W1986094891 cites W2089055675 @default.
• W1986094891 cites W2089854636 @default.
• W1986094891 cites W2100837269 @default.
• W1986094891 cites W2101783575 @default.
• W1986094891 cites W2111247726 @default.
• W1986094891 cites W2113587066 @default.
• W1986094891 cites W2115453381 @default.
• W1986094891 cites W2122351989 @default.
• W1986094891 cites W2122746216 @default.
• W1986094891 cites W2124451323 @default.
• W1986094891 cites W2135090920 @default.
• W1986094891 cites W2137153249 @default.
• W1986094891 cites W2137749186 @default.
• W1986094891 cites W2146113572 @default.
• W1986094891 cites W2148234417 @default.
• W1986094891 cites W2158757814 @default.
• W1986094891 doi "https://doi.org/10.1074/jbc.m500972200" @default.
• W1986094891 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15797867" @default.
• W1986094891 hasPublicationYear "2005" @default.
• W1986094891 type Work @default.
• W1986094891 sameAs 1986094891 @default.
• W1986094891 citedByCount "14" @default.
• W1986094891 countsByYear W19860948912012 @default.
• W1986094891 countsByYear W19860948912014 @default.
• W1986094891 countsByYear W19860948912015 @default.
• W1986094891 countsByYear W19860948912017 @default.
• W1986094891 countsByYear W19860948912022 @default.
• W1986094891 crossrefType "journal-article" @default.
• W1986094891 hasAuthorship W1986094891A5007488043 @default.
• W1986094891 hasAuthorship W1986094891A5012023203 @default.
• W1986094891 hasAuthorship W1986094891A5063916067 @default.
• W1986094891 hasAuthorship W1986094891A5065928196 @default.
• W1986094891 hasAuthorship W1986094891A5069579045 @default.
• W1986094891 hasBestOaLocation W19860948911 @default.
• W1986094891 hasConcept C104317684 @default.
• W1986094891 hasConcept C130211564 @default.
• W1986094891 hasConcept C143065580 @default.
• W1986094891 hasConcept C174832134 @default.
• W1986094891 hasConcept C2776460866 @default.
• W1986094891 hasConcept C2778827730 @default.
• W1986094891 hasConcept C2780381237 @default.
• W1986094891 hasConcept C49039625 @default.
• W1986094891 hasConcept C54355233 @default.
• W1986094891 hasConcept C547475151 @default.
• W1986094891 hasConcept C55493867 @default.
• W1986094891 hasConcept C60987743 @default.
• W1986094891 hasConcept C86803240 @default.
• W1986094891 hasConcept C89423630 @default.
• W1986094891 hasConcept C95444343 @default.
• W1986094891 hasConceptScore W1986094891C104317684 @default.
• W1986094891 hasConceptScore W1986094891C130211564 @default.
• W1986094891 hasConceptScore W1986094891C143065580 @default.
• W1986094891 hasConceptScore W1986094891C174832134 @default.
• W1986094891 hasConceptScore W1986094891C2776460866 @default.
• W1986094891 hasConceptScore W1986094891C2778827730 @default.
• W1986094891 hasConceptScore W1986094891C2780381237 @default.
• W1986094891 hasConceptScore W1986094891C49039625 @default.
• W1986094891 hasConceptScore W1986094891C54355233 @default.
• W1986094891 hasConceptScore W1986094891C547475151 @default.

• next