FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1986332014> ?p ?o ?g. }

• W1986332014 endingPage "14129" @default.
• W1986332014 startingPage "14119" @default.
• W1986332014 abstract "We investigated the molecular mechanism of transcriptional activation of the gp34 gene by the Tax oncoprotein of human T cell leukemia virus type I (HTLV-I). gp34 is a type II transmembrane molecule belonging to the tumor necrosis factor family and is constitutively expressed on HTLV-I-producing cells but not normal resting T cells. The transcriptional regulatory region of the gp34 gene was activated by HTLV-I Tax in the human T cell line Jurkat, in which endogenous gp34 is induced by Tax. Sequence analysis demonstrated that two NF-κB-like elements (1 and 2) were present in the regulatory region. Both NF-κB-like elements were able to bind to NF-κB or its related factor(s) in a Tax-dependent manner. Chloramphenicol acetyltransferase assays indicated that NF-κB-like element 1 was Tax-responsive, although the activity was lower than that the native promoter. NF-κB-like element 2 elevated promoter activity when combined with NF-κB-like element 1, indicating cooperative function of the elements for maximum promoter function. Unlike typical NF-κB elements, the NF-κB-like elements in gp34 were not activated by treatment of Jurkat cells with phorbol ester despite induction of the NF-κB-like binding activity. Chloramphenicol acetyltransferase reporter assays using the region upstream of the NF-κB-like elements identified an upstream region that reduced transcription from cognate and noncognate core promoters in a Tax-independent manner. Our results imply complex regulation of expression of the gp34 gene and suggest implication of gp34 in proliferation of HTLV-I infected T cells. We investigated the molecular mechanism of transcriptional activation of the gp34 gene by the Tax oncoprotein of human T cell leukemia virus type I (HTLV-I). gp34 is a type II transmembrane molecule belonging to the tumor necrosis factor family and is constitutively expressed on HTLV-I-producing cells but not normal resting T cells. The transcriptional regulatory region of the gp34 gene was activated by HTLV-I Tax in the human T cell line Jurkat, in which endogenous gp34 is induced by Tax. Sequence analysis demonstrated that two NF-κB-like elements (1 and 2) were present in the regulatory region. Both NF-κB-like elements were able to bind to NF-κB or its related factor(s) in a Tax-dependent manner. Chloramphenicol acetyltransferase assays indicated that NF-κB-like element 1 was Tax-responsive, although the activity was lower than that the native promoter. NF-κB-like element 2 elevated promoter activity when combined with NF-κB-like element 1, indicating cooperative function of the elements for maximum promoter function. Unlike typical NF-κB elements, the NF-κB-like elements in gp34 were not activated by treatment of Jurkat cells with phorbol ester despite induction of the NF-κB-like binding activity. Chloramphenicol acetyltransferase reporter assays using the region upstream of the NF-κB-like elements identified an upstream region that reduced transcription from cognate and noncognate core promoters in a Tax-independent manner. Our results imply complex regulation of expression of the gp34 gene and suggest implication of gp34 in proliferation of HTLV-I infected T cells. Human T cell leukemia virus type I (HTLV-I) 1The abbreviations used are: HTLV-I, human T cell leukemia virus type I; IL-2, interleukin 2; CAT, chloramphenicol acetyltransferase; TPA, 12-O-tetradecanoylphorbol-13-acetate; PHA, phytohemagglutinin; CREB/ATF, cyclic AMP-responsive element binding factor; TNF, tumor necrosis factor; bp, base pair(s); PIPES, 1,4-piperazinediethanesulfonic acid. is an etiologic agent of adult T cell leukemia (1Hinuma Y. Nagata K. Hanaoka M. Nakai M. Matsumoto T. Kinoshita K.I. Shirakawa S. Miyoshi I. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 6476-6480Crossref PubMed Scopus (1855) Google Scholar, 2Poiesz B.J. Ruscetti F.W. Gazdar A.F. Bunn P.A. Minna J.D. Gallo R.C. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 7415-7419Crossref PubMed Scopus (4001) Google Scholar, 3Yoshida M. Miyoshi I. Hinuma Y. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 2031-2035Crossref PubMed Scopus (1729) Google Scholar) and HTLV-I-associated myelopathy/tropical spastic paraparesis (4Gessain A. Barin F. Vernant J.C. Gout O. Maurs L. Calender A. de The G. Lancet. 1985; 2: 407Abstract PubMed Scopus (2437) Google Scholar, 5Osame M. Igata A. Usuku K. Rosales R.L. Matsumoto M. Lancet. 1986; 11031Abstract PubMed Scopus (1943) Google Scholar). At least two regulatory molecules, Tax and Rex, are encoded by the HTLV-I genome (6Nagashima K. Yoshida M. Seiki M. J. Virol. 1986; 60: 394-399Crossref PubMed Google Scholar). Tax was initially found to be a trans-acting transcriptional activator of viral gene expression (7Felber B.K. Paskaris H. Kleinman-Ewing C. Wong-Staal F. Pavlakis G.N. Science. 1985; 229: 675-679Crossref PubMed Scopus (334) Google Scholar, 8Sodroski J. Rosen C. Goh W.C. Haseltine W. Science. 1985; 228: 1430-1434Crossref PubMed Scopus (232) Google Scholar, 9Seiki M. Inoue J. Takeda T. Yoshida M. EMBO J. 1986; 5: 561-565Crossref PubMed Scopus (139) Google Scholar) and was subsequently shown to induce or enhance the expression of a myriad of cellular genes, most of which are implicated in cell growth. These include genes for growth factors (interleukin 2 (IL-2) and granulocyte/macrophage colony-stimulating factor) (10Ruben S. Poteat H. Tan T.H. Kawakami K. Roeder R. Haseltine W. Rosen C.A. Science. 1988; 241: 89-92Crossref PubMed Scopus (204) Google Scholar, 11Li M. Siekevitz M. Mol. Cell. Biol. 1993; 13: 6490-6500Crossref PubMed Scopus (26) Google Scholar, 12McGuire K.L. Curtiss V.E. Larson E.L. Haseltine W.A. J. Virol. 1993; 67: 1590-1599Crossref PubMed Google Scholar, 13Himes S.R. Coles L.S. Katsikeros R. Lang R.K. Shannon M.F. Oncogene. 1993; 8: 3189-3197PubMed Google Scholar, 14Nimer S. New Biol. 1991; 3: 997-1004PubMed Google Scholar), growth factor receptors (IL-2 receptor α and γ subunits) (15Inoue J. Seiki M. Taniguchi T. Tsuru S. Yoshida M. EMBO J. 1986; 5: 2883-2888Crossref PubMed Scopus (364) Google Scholar, 16Maruyama M. Shibuya H. Harada H. Hatakeyama M. Seiki M. Fujita T. Inoue J. Yoshida M. Taniguchi T. Cell. 1987; 48: 343-350Abstract Full Text PDF PubMed Scopus (309) Google Scholar, 17Ohbo K. Takasawa N. Ishii N. Tanaka N. Nakamura M. Sugamura K. J. Biol. Chem. 1995; 270: 7479-7486Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar), a cytoplasmic signal mediator (lyn) (18Uchiumi F. Semba K. Yamanashi Y. Fujisawa J. Yoshida M. Inoue K. Toyoshima K. Yamamoto T. Mol. Cell. Biol. 1992; 12: 3784-3795Crossref PubMed Scopus (41) Google Scholar), and nuclear transcription factors (c-fos and c-jun) (19Fujii M. Sassone C.P. Verma I.M. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8526-8530Crossref PubMed Scopus (285) Google Scholar, 20Nagata K. Ohtani K. Nakamura M. Sugamura K. J. Virol. 1989; 63: 3220-3226Crossref PubMed Google Scholar, 21Fujii M. Niki T. Mori T. Matsuda T. Matsui M. Nomura N. Seiki M. Oncogene. 1991; 6: 1023-1029PubMed Google Scholar). Modulation of expression of these genes is thought to be closely associated with disease. Nevertheless, the mechanisms of Tax-induced cellular gene expression and involvement in disease onset are yet to be elucidated. Analyses of target DNA sequences showed that three enhancer elements that bound to cyclic AMP-responsive element binding factor (CREB/ATF) (22Jeang K.T. Shank P.R. Kumar A. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8291-8295Crossref PubMed Scopus (43) Google Scholar, 23Nakamura M. Niki M. Ohtani K. Sugamura K. Nucleic Acids Res. 1989; 17: 5207-5221Crossref PubMed Scopus (25) Google Scholar, 24Poteat H.T. Chen F.Y. Kadison P. Sodroski J.G. Haseltine W.A. J. Virol. 1990; 64: 1264-1270Crossref PubMed Google Scholar, 25Tan T.H. Horikoshi M. Roeder R.G. Mol. Cell. Biol. 1989; 9: 1733-1745Crossref PubMed Scopus (50) Google Scholar), NF-κB (26Ballard D.W. Bohnlein E. Lowenthal J.W. Wano Y. Franza B.R. Greene W.C. Science. 1988; 241: 1652-1655Crossref PubMed Scopus (350) Google Scholar, 27Bohnlein E. Lowenthal J.W. Siekevitz M. Ballard D.W. Franza B.R. Greene W.C. Cell. 1988; 53: 827-836Abstract Full Text PDF PubMed Scopus (248) Google Scholar, 28Leung K. Nabel G.J. Nature. 1988; 333: 776-778Crossref PubMed Scopus (359) Google Scholar), and serum-responsive factor (29Fujii M. Tsuchiya H. Chuhjo T. Akizawa T. Seiki M. Genes Dev. 1992; 6: 2066-2076Crossref PubMed Scopus (217) Google Scholar) were activated by Tax. Tax itself cannot bind directly to target DNA sequences, although it activates via direct association with the cellular transcription factors, cyclic AMP-responsive element binding factor, NF-κB and serum-responsive factor (29Fujii M. Tsuchiya H. Chuhjo T. Akizawa T. Seiki M. Genes Dev. 1992; 6: 2066-2076Crossref PubMed Scopus (217) Google Scholar, 30Zhao L.J. Giam C.Z. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7070-7074Crossref PubMed Scopus (296) Google Scholar, 31Suzuki T. Fujisawa J.I. Toita M. Yoshida M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 610-614Crossref PubMed Scopus (246) Google Scholar, 32Suzuki T. Hirai H. Fujisawa J. Fujita T. Yoshida M. Oncogene. 1993; 8: 2391-2397PubMed Google Scholar), and an inhibitor of NF-κB, IκB (33Hirai H. Fujisawa J. Suzuki T. Ueda K. Muramatsu M. Tsuboi A. Arai N. Yoshida M. Oncogene. 1992; 7: 1737-1742PubMed Google Scholar, 34Watanabe M. Muramatsu M. Hirai H. Suzuki T. Fujisawa J. Yoshida M. Arai K. Arai N. Oncogene. 1993; 8: 2949-2958PubMed Google Scholar). We cloned a cellular gene encoding a type II membrane glycoprotein, named gp34, which was expressed on HTLV-I-producing cells (35Tanaka Y. Inoi T. Tozawa H. Yamamoto N. Hinuma Y. Int. J. Cancer. 1985; 36: 549-555Crossref PubMed Scopus (67) Google Scholar, 36Miura S. Ohtani K. Numata N. Niki M. Ohbo K. Ina Y. Gojobori T. Tanaka Y. Tozawa H. Nakamura M. Sugamura K. Mol. Cell. Biol. 1991; 11: 1313-1325Crossref PubMed Scopus (139) Google Scholar). gp34 has been also shown to bind OX40, a marker of activated T cells, which is also expressed on HTLV-I-producing cells (37Paterson D.J. Jefferies W.A. Green J.R. Brandon M.R. Corthesy P. Puklavec M. Williams A.F. Mol. Immunol. 1987; 24: 1281-1290Crossref PubMed Scopus (404) Google Scholar, 38Baum P.R. Gayle R.B. r. Ramsdell F. Srinivasan S. Sorensen R.A. Watson M.L. Seldin M.F. Baker E. Sutherland G.R. Clifford K.N. Alderson M.R. Goodwin R.G. Franslow W.C. EMBO J. 1994; 13: 3992-4001Crossref PubMed Scopus (262) Google Scholar, 39Godfrey W.R. Fagnoni F.F. Harara M.A. Buck D. Engleman E.G. J. Exp. Med. 1994; 180: 757-762Crossref PubMed Scopus (256) Google Scholar). Apart from HTLV-I-producing T cells, gp34 and OX40 are also expressed on activated normal T and B cells (38Baum P.R. Gayle R.B. r. Ramsdell F. Srinivasan S. Sorensen R.A. Watson M.L. Seldin M.F. Baker E. Sutherland G.R. Clifford K.N. Alderson M.R. Goodwin R.G. Franslow W.C. EMBO J. 1994; 13: 3992-4001Crossref PubMed Scopus (262) Google Scholar, 39Godfrey W.R. Fagnoni F.F. Harara M.A. Buck D. Engleman E.G. J. Exp. Med. 1994; 180: 757-762Crossref PubMed Scopus (256) Google Scholar, 40Stuber E. Neurath M. Calderhead D. Fell H.P. Strober W. Immunity. 1995; 2: 507-521Abstract Full Text PDF PubMed Scopus (361) Google Scholar). Transcriptional transactivation of the gp34 and OX40 genes by Tax has been demonstrated (36Miura S. Ohtani K. Numata N. Niki M. Ohbo K. Ina Y. Gojobori T. Tanaka Y. Tozawa H. Nakamura M. Sugamura K. Mol. Cell. Biol. 1991; 11: 1313-1325Crossref PubMed Scopus (139) Google Scholar, 41Higashimura N. Takasawa N. Tanaka Y. Nakamura M. Sugamura K. Jpn. J. Cancer Res. 1996; 87: 227-231Crossref PubMed Scopus (42) Google Scholar). OX40 is a member of the tumor necrosis factor (TNF) receptor family, which includes FAS and CD40 (42Mallett S. Fossum S. Barclay A.N. EMBO J. 1990; 9: 1063-1068Crossref PubMed Scopus (329) Google Scholar, 43Smith C.A. Farrah T. Goodwin R.G. Cell. 1994; 76: 959-962Abstract Full Text PDF PubMed Scopus (1839) Google Scholar), and gp34 belongs to the TNF family (39Godfrey W.R. Fagnoni F.F. Harara M.A. Buck D. Engleman E.G. J. Exp. Med. 1994; 180: 757-762Crossref PubMed Scopus (256) Google Scholar,44Gruss H.J. Dower S.K. Blood. 1995; 85: 3378-3404Crossref PubMed Google Scholar). Functions of the TNF receptor/TNF and FAS/FAS ligand systems are well documented with regard to cell proliferation and apoptosis (43Smith C.A. Farrah T. Goodwin R.G. Cell. 1994; 76: 959-962Abstract Full Text PDF PubMed Scopus (1839) Google Scholar). Defects of the CD40 ligand are associated with hyper-IgM syndrome (45Allen R.C. Armitage R.J. Conley M.E. Rosenblatt H. Jenkins N.A. Copeland N.G. Bedell M.A. Edelhoff S. Disteche C.M. Simoneaux D.K. Fanslow W.C. Belmont J. Springgs M.K. Science. 1993; 259: 990-993Crossref PubMed Scopus (768) Google Scholar, 46Aruffo A. Farrington M. Hollenbaugh D. Li X. Milatovich A. Nonoyama S. Bajorath J. Grosmaire L.S. Stenkamp R. Neubauer M. Roberts R.L. Nuelle R.J. Ledbetter J.A. Francke U. Ochs H.D. Cell. 1993; 72: 291-300Abstract Full Text PDF PubMed Scopus (752) Google Scholar, 47DiSanto J.P. Bonnefoy J.Y. Gauchat J.F. Fischer A. de Saint Basile G. Nature. 1993; 361: 541-543Crossref PubMed Scopus (651) Google Scholar). Interestingly, unlike those molecules, gp34 and OX40 are not detected on the cell surface until lymphocytes are activated, suggesting that they function at later stages of lymphocyte activation and proliferation. However, little is known about the function of the gp34/OX40 system. Recent studies indicate that both gp34 and OX40 transmit signals into the cytoplasm (38Baum P.R. Gayle R.B. r. Ramsdell F. Srinivasan S. Sorensen R.A. Watson M.L. Seldin M.F. Baker E. Sutherland G.R. Clifford K.N. Alderson M.R. Goodwin R.G. Franslow W.C. EMBO J. 1994; 13: 3992-4001Crossref PubMed Scopus (262) Google Scholar, 39Godfrey W.R. Fagnoni F.F. Harara M.A. Buck D. Engleman E.G. J. Exp. Med. 1994; 180: 757-762Crossref PubMed Scopus (256) Google Scholar, 40Stuber E. Neurath M. Calderhead D. Fell H.P. Strober W. Immunity. 1995; 2: 507-521Abstract Full Text PDF PubMed Scopus (361) Google Scholar, 48Stuber E. Strober W. J. Exp. Med. 1996; 183: 979-989Crossref PubMed Scopus (246) Google Scholar). Unlike other cellular genes transactivated by HTLV-I Tax, gp34 is not induced on T cells by stimulation with mitogens, phorbol ester, or IL-2 (35Tanaka Y. Inoi T. Tozawa H. Yamamoto N. Hinuma Y. Int. J. Cancer. 1985; 36: 549-555Crossref PubMed Scopus (67) Google Scholar). These observations imply that the gp34/OX40 system may be involved in growth regulation of T cells during immune responses and in growth of HTLV-I-infected T cells. Thus, elucidation of the molecular mechanisms of gp34 and OX40 expression would be useful in understanding normal and cancerous proliferation of T cells. In this study, we analyzed the mechanism of Tax-induced transcriptional regulation of gp34. Tax-induced gp34transactivation was mediated through a unique NF-κB-like element that was not activated by phorbol ester. We detected a region upstream of the NF-κB-like element that suppressed transcription from cognate and noncognate core promoters. The array of these regions may contribute to the strict and complex regulation of gp34 expression in T cells. TL-Mor (49Sugamura K. Fujii M. Kannagi M. Sakitani M. Takeuchi M. Hinuma Y. Int. J. Cancer. 1984; 34: 221-228Crossref PubMed Scopus (147) Google Scholar) and MT-2 (50Miyoshi I. Kubonishi I. Yoshimoto S. Akagi T. Ohtsuki Y. Shiraishi Y. Nagata K. Hinuma Y. Nature. 1981; 294: 770-771Crossref PubMed Scopus (1150) Google Scholar) are HTLV-I-producing human T cell lines. Jurkat (51Kaplan J. Tilton J. Peterson Jr., W.D. Am. J. Hematol. 1976; 1: 219-223Crossref PubMed Scopus (59) Google Scholar) is a human acute lymphocytic leukemia T cell line negative for HTLV-I. JPX-9 is a Jurkat subline that stably carries Tax expression plasmid, in which expression of Tax is inducible by the addition of CdCl2 (20Nagata K. Ohtani K. Nakamura M. Sugamura K. J. Virol. 1989; 63: 3220-3226Crossref PubMed Google Scholar, 52Ohtani K. Nakamura M. Saito S. Nagata K. Sugamura K. Hinuma Y. Nucleic Acids Res. 1989; 17: 1589-1604Crossref PubMed Scopus (80) Google Scholar). Cells were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum, 10 mml-glutamine, and antibiotics at 5% CO2 in air. A human genomic DNA library was constructed by introduction of Sau3AI partially digested genomic DNA from normal peripheral blood lymphocytes into theBamHI site of phage vector EMBL3. The library (5 × 105 plaques) was screened by plaque hybridization using the 5′-most EcoRI fragment of gp34 cDNA as a probe. Nucleotide sequencing was performed by the dideoxy chain termination method using Sequenase 2.0 (United States Biochemicals) according to the protocol recommended by the manufacturer. Total RNA was isolated from MT-2 and Jurkat cells by the guanidium thiocyanate method as described previously (53Sakitani M. Nakamura M. Fujii M. Sugamura K. Hinuma Y. Virus Genes. 1987; 1: 35-47PubMed Google Scholar). The probe used for S1 mapping was the 499-base pair (bp) AluI genomic DNA fragment. The end-labeled AluI fragment was annealed with 20 μg of RNA in 20 μl of solution containing 80% formamide, 20 mmPIPES (pH 6.4), 0.5 mm EDTA, and 200 mm NaCl at 52 °C for 3 h after initial incubation at 85 °C for 5 min. The annealed products were digested with S1 nuclease (100 units) in 100 μl of solution containing 270 mm NaCl, 1 mmZnSO4, 30 mm sodium acetate (pH 4.6) at 37 °C for 30 min. The reaction was terminated by phenol/chloroform extraction. DNA was ethanol-precipitated and analyzed by electrophoresis in an 8% acrylamide sequencing gel with 7m urea. The primer used for primer extension was a 30-mer oligonucleotide (CTTGTTCCTCTCGAATCTTGGCCTGGCTGC) corresponding to the 5′-end of the minus strand of the S1 mapping probe. End-labeled primer was annealed to 20 μg of RNA in 30 μl of solution containing 80% formamide, 100 mm Tris-HCl (pH 8.0), 120 mmKCl, and 20 mm MgCl2 at 30 °C for 8 h after initial incubation at 85 °C for 5 min. The annealed product was ethanol-precipitated and resuspended in 20 μl of solution containing 50 mm Tris-HCl (pH 7.6), 60 mm KCl, 10 mm MgCl2, 1 mm dNTPs, 1 mm dithiothreitol, and 1 unit/μl human placental ribonuclease inhibitor. The extension reaction was initiated by adding 50 units of reverse transcriptase and incubated at 37 °C for 2 h. The products were analyzed by electrophoresis along with the S1 mapping product. Size markers were sequencing ladders of thegp34 genomic DNA fragment using a 17-mer primer corresponding to the 5′-end of the 30-mer oligonucleotide used for primer extension analysis. The 9-kbp fragment (Sau3AI (−9000) -AvaII (+27)) upstream of the first exon of the gp34 gene was inserted in front of the chloramphenicol acetyltransferase (CAT) gene in a reporter plasmid, pSV0CAT (54Gorman C.M. Moffat L.F. Howard B.H. Mol. Cell. Biol. 1982; 2: 1044-1051Crossref PubMed Scopus (5292) Google Scholar), to generate pGP(−9000)CAT. Deletion mutants of both 5′- and 3′-ends of the genomic fragment were generated by digestion from restriction sites with exonuclease III and mung bean nuclease. The 5′ deletion mutants were derived from pGP(−9000)CAT. The 3′ deletion mutants were prepared by insertion of a series of 3′ deletion mutants of the −823 to −54 fragment into the −31 CAT reporter plasmid, pGP(−31)CAT, which contained the 58-bp (−31 to +27) genomic fragment. Plasmids with mutant fragments were named according to the numbers of the 5′- or 3′-end of the fragments. pGP(−31)CAT was also used as a backbone vector to be introduced with the −100 to −54 fragment, NF-κB-like elements 1 and 2, and the HTLV-I enhancer fragment. The −100 to −54 fragment was introduced into the pGP(−31)CAT plasmid in single form (pGP(−100∼−54) CAT) and four tandem repeat form (pGP(−100∼−54)x4CAT). Similarly, NF-κB-like elements 1 and 2 were inserted into the pGP(−31)CAT plasmid in single and four tandem repeat forms, yielding pGPκB1CAT, pGPκB2CAT, pGPκB1×4CAT, and pGPκB2×4 CAT, respectively. pHE(−31)CAT is a derivative of the pGP(−31)CAT plasmid carrying the 267-bp HTLV-I enhancer fragment (55Ohtani K. Nakamura M. Saito S. Noda T. Ito Y. Sugamura K. Hinuma Y. EMBO J. 1987; 6: 389-395Crossref PubMed Scopus (62) Google Scholar). pdHE4 is a CAT plasmid containing the HTLV-I core promoter (55Ohtani K. Nakamura M. Saito S. Noda T. Ito Y. Sugamura K. Hinuma Y. EMBO J. 1987; 6: 389-395Crossref PubMed Scopus (62) Google Scholar). pdHEκB-4 carries four tandemly repeated SV40 NF-κB sites in pdHE4(56). pdHE(−823∼−54)CAT is a derivative of the pdHE4 having the −823 to −54 fragment of the gp34 gene promoter. pMAXneo is a Tax expression vector in which the Tax gene is regulated by the mouse metallothionein promoter, whereas pMAXneo/M is a nonfunctional Tax mutant (55Ohtani K. Nakamura M. Saito S. Noda T. Ito Y. Sugamura K. Hinuma Y. EMBO J. 1987; 6: 389-395Crossref PubMed Scopus (62) Google Scholar). Reexamination of the DNA sequence for the Tax mutant demonstrated that the mutant gene has a 3-base insertion at the MluI site in the coding region, rather than a 4-base insertion as reported initially (55Ohtani K. Nakamura M. Saito S. Noda T. Ito Y. Sugamura K. Hinuma Y. EMBO J. 1987; 6: 389-395Crossref PubMed Scopus (62) Google Scholar), resulting in a mutant with an additional Arg residue between amino acids 62 and 63. Tax mutants TaxM22, Tax703, and Taxd3, which are not effective in activation of the NF-κB, serum-responsive factor, and CREB/ATF binding sites, respectively, have been described previously (32Suzuki T. Hirai H. Fujisawa J. Fujita T. Yoshida M. Oncogene. 1993; 8: 2391-2397PubMed Google Scholar, 57Akagi T. Ono H. Nyunoya H. Shimotohno K. Oncogene. 1997; 14: 2071-2078Crossref PubMed Scopus (80) Google Scholar, 58Smith M.R. Greene W.C. Virology. 1992; 187: 316-320Crossref PubMed Scopus (85) Google Scholar). Wild type Tax and these Tax mutant genes were cloned into pHβAPr-1-neo, which has a β-actin promoter (59Gunning P. Leavitt J. Muscat G. Ng S.Y. Kedes L. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 4831-4835Crossref PubMed Scopus (667) Google Scholar). Plasmid DNA was transfected into Jurkat cells by the DEAE-dextran method and assayed for CAT activity as described previously (55Ohtani K. Nakamura M. Saito S. Noda T. Ito Y. Sugamura K. Hinuma Y. EMBO J. 1987; 6: 389-395Crossref PubMed Scopus (62) Google Scholar). CAT activities were shown as percent acetylation, and transactivation was expressed as fold induction of CAT activity with pMAXneo compared with that with pMAXneo/M. In CAT assays with 12-O-tetradecanoylphorbol-13-acetate (TPA), TPA was added to cells transfected with CAT plasmids at a concentration of 20 nm, 12 h after transfection, and incubation was continued for a further 36 h. We also compared CAT activity with TPA to that without TPA. All CAT assays were carried out at least three times in duplicate. Repeated assays showed similar results, and representative data are presented. The gel shift assay was performed as described previously (56Nakamura M. Niki M. Nagata K. Ohtani K. Saito S. Hinuma Y. Sugamura K. J. Biol. Chem. 1989; 264: 20189-20192Abstract Full Text PDF PubMed Google Scholar). DNA probes were end-labeled with polynucleotide kinase and [γ-32P]ATP (5000 Ci/mmol; Amersham). Nuclear extracts were prepared from TL-Mor, Jurkat, and JPX-9 cells as described previously (56Nakamura M. Niki M. Nagata K. Ohtani K. Saito S. Hinuma Y. Sugamura K. J. Biol. Chem. 1989; 264: 20189-20192Abstract Full Text PDF PubMed Google Scholar). Oligonucleotides used as probes and competitors were as follows: bases−100∼−54. 5′­cgatGAAAGAAAGTAAAGGGGAAATTCAGATTAGTCACAAAGAAGTTCCCCat­3′3′­taCTTTCTTTCATTTCCCCTTTAAGTCTAATCAGTGTTTCTTCAAGGGGtagc­5′NF-κB-like element 1. 5′­cgatAAAGGGGAAATTCAGat­3′3′­taTTTCCCCTTTAAGTCtagc­5′NF-κB-like element 1 mutant. 5′­cgatAAAGGAACAATTCAGat­3′3′­taTTTCCTTGTTAAGTCtagc­5′NF-κB-like element 2. 5′­cgatGCGGGGGAACTTCTTat­3′3′­taCGCCCCCTTGAAGAAtagc­5′NF-κB-like element 2 mutant. 5′­cgatGCGGGAACACTTCTTagc­5′3′­taCGCCCTTGTGAAGAAtagc­5′Typical NF-κB. 5′­cgatAGAGGGGACTTTCCGat­3′3′­taTCTCCCCTGAAAGGCtagc­5′HTLV-I C26. 5′­cgatCCGGGAAGCCACCGGAACCACCTATTat­3′3′­taGGCCCTTCGGTGGCCTTGGTGGATAAtagc­5′HTLV-I 21-bp motif. 5′­cgatAAGGCTCTGACGTCTCCCCCCat­3′3′­taTTCCGAGACTGCAGAGGGGGGtagc­5′ Antibodies used for gel mobility supershift assay were anti-NF-κB p65 (sc-372X), anti-NF-κB p50 (sc-114X), anti-c-Rel (sc-1827X), anti-RelB (sc-226X), and anti-NF-κB p52 (sc-298X) antibodies (Santa Cruz Biotechnology). In order to analyze the regulatory mechanism of gp34 gene transcription, we cloned the promoter region of the gp34 gene. A human genomic DNA library constructed with EMBL3 was screened with the 5′-most EcoRI fragment of thegp34 cDNA. Several positive clones were identified, and one clone, which contained sequences 9 kbp upstream of the ATG initiation codon for gp34, was further analyzed. The promoter activity of this region was examined by CAT assays. The 9-kbp 5′-flanking fragment was isolated and ligated to the CAT reporter gene. CAT activity was examined with or without a Tax expression vector, pMAXneo, in the human Jurkat T cell line. As expected, in Jurkat cells, the 9-kbp fragment showed little or no promoter activity in the absence of Tax (Fig. 1 A). Tax expression induced promoter activity of this fragment. Thus, the promoter of the gp34 gene was present in this region, and its activity was dependent on Tax. Experiments using 5′ deletion mutants of the 9-kbp fragment showed that most, if not all, of the promoter activity was associated with the 850-bp KpnI-AvaII fragment in the 9-kbp 5′-flanking region. The nucleotide sequence of the 850-bp fragment was then determined (Fig. 1 B). To confirm that the transcriptional start site was contained in this fragment, S1 mapping and primer extension analyses were performed. Total RNA was isolated from an HTLV-I infected T cell line (TL-Mor) and an HTLV-I-unrelated T cell line (Jurkat). RNA was hybridized with an S1 mapping probe of the 497-bp AluI genomic fragment. A 224-base fragment protected from nuclease digestion was detected using RNA from TL-Mor but not Jurkat cells (Fig. 1 C). A product of the same size was observed using TL-Mor but not Jurkat RNA by primer extension analysis using a 30-mer primer with the same 5′-end as the minus strand of the S1 probe. These results showed that the transcriptional start site was located 154 bp upstream of the ATG initiation codon and that most of the promoter activity resided in the region extending from −824 to +27. Sequence analysis showed that there were two NF-κB site-like sequences (−87 to −77 and −64 to −54) and one AP-1 site-like sequence (−74 to −68) between the two NF-κB-like sequences (Fig.1 B). Although a typical TATA box sequence was not found around 30 bp upstream of the transcriptional start site, it is possible that the TTAAA sequence located at −29 might be TATA-related. In order to examine the function of each subregion in the regulatory region, a series of deletion mutants of the regulatory region was generated, and the mutants were assayed for their promoter activities with or without Tax. A 5′-end deletion (up to −31) of the −824 to +27 fragment completely abolished Tax responsiveness (Fig. 2). This −31 mutant retained the TATA-related sequence TTAAA and was thought to contain the core promoter as evidenced by the fact that addition of the HTLV-I enhancer to the −31 mutant restored Tax responsiveness. Thus, the core promoter of the gp34 gene seemed to be Tax-independent, and the upstream region appeared to be responsible for Tax-dependent activation. As expected, the −31 mutant linked to the −823 to −54 fragment exhibited the same CAT activity in response to Tax as did the −823 mutant. Combination of the −823 to −54 fragment with the HTLV-I core promoter also showed Tax-dependent activation. These results indicate that the region between −823 and −54 of the gp34 gene mediates transactivation by Tax. Note that the −31 mutant showed higher CAT activity than the −823 mutant in the absence of Tax. Similarly, the −823 to −54 fragment, when linked to the HTLV-I core promoter, significantly reduced CAT activity in the absence of Tax, although it endowed Tax-dependent activation. These results indicate that in addition to a region enhancing transcription in response to Tax, there is a region in the −823 to −54 fragment that suppresses basal transcription in the absence of Tax. The Tax-responsive region was further localized by CAT assays using 5′ and 3′ deletion mutants of the 5′-flanking fragment. A mutant with a −106 deletion at the 5′-end retained Tax responsiveness although it showed an increased inherent CAT activity without Tax. This result suggests that an element responsible for Tax-dependent activation is retained in a region downstream of −106 and that the suppressive activity is associated with a region upstream of −106. To determine the 3′-border of the Tax-responsive region, a set of 3′ deletion mutants of the −823 to −54 fragment were linked to the −31 mutant and assayed for their Tax-dependent activation. Addition of the −823 to −54 fragment to the −31 core CAT vector gave as high an activation (more than 30-fold induction) in response to Tax as did the native −823 to +27 fragment (Fig. 2). A 3′ mutant deleted to −57 exhibited a profoundly reduced response to Tax with induction of only 7.7-fold. Further deletion to −118 completely abolished Tax-dependent activation. Collectively, these results indicate that a Tax-responsive element is present in the region between −106 and −54. Interestingly, all 3′ deletion mutants exhibited reduced CAT activity as compared with the −31 mutant in the absence of Tax (Fig. 2). This implies that suppressive activity is associated with a region upstream of −118, consistent with observations from the 5′ deletion mutants. To identify an element responsible for" @default.
• W1986332014 created "2016-06-24" @default.
• W1986332014 creator A5003887816 @default.
• W1986332014 creator A5035156230 @default.
• W1986332014 creator A5046409450 @default.
• W1986332014 creator A5051642123 @default.
• W1986332014 creator A5085732658 @default.
• W1986332014 creator A5087838405 @default.
• W1986332014 creator A5014770114 @default.
• W1986332014 date "1998-06-01" @default.
• W1986332014 modified "2023-10-14" @default.
• W1986332014 title "Molecular Mechanisms of Promoter Regulation of the gp34 Gene That Is Trans-activated by an Oncoprotein Tax of Human T Cell Leukemia Virus Type I" @default.
• W1986332014 cites W105127712 @default.
• W1986332014 cites W1481259039 @default.
• W1986332014 cites W1483636703 @default.
• W1986332014 cites W1516457342 @default.
• W1986332014 cites W1602037964 @default.
• W1986332014 cites W1935210417 @default.
• W1986332014 cites W1969033718 @default.
• W1986332014 cites W1974428835 @default.
• W1986332014 cites W1977348907 @default.
• W1986332014 cites W1983795855 @default.
• W1986332014 cites W1987438129 @default.
• W1986332014 cites W1998461588 @default.
• W1986332014 cites W2000090884 @default.
• W1986332014 cites W2002507218 @default.
• W1986332014 cites W2002601205 @default.
• W1986332014 cites W2006552010 @default.
• W1986332014 cites W2013063662 @default.
• W1986332014 cites W2016534065 @default.
• W1986332014 cites W2019698681 @default.
• W1986332014 cites W2022627708 @default.
• W1986332014 cites W2023262811 @default.
• W1986332014 cites W2025959287 @default.
• W1986332014 cites W2028368276 @default.
• W1986332014 cites W2028809209 @default.
• W1986332014 cites W2032496145 @default.
• W1986332014 cites W2033447452 @default.
• W1986332014 cites W2042043269 @default.
• W1986332014 cites W2048022927 @default.
• W1986332014 cites W2049496770 @default.
• W1986332014 cites W2058350611 @default.
• W1986332014 cites W2063480372 @default.
• W1986332014 cites W2069667541 @default.
• W1986332014 cites W2079473939 @default.
• W1986332014 cites W2086143621 @default.
• W1986332014 cites W2088493593 @default.
• W1986332014 cites W2089559330 @default.
• W1986332014 cites W2102572112 @default.
• W1986332014 cites W2117716734 @default.
• W1986332014 cites W2126217474 @default.
• W1986332014 cites W2144766409 @default.
• W1986332014 cites W2146419650 @default.
• W1986332014 cites W2152922534 @default.
• W1986332014 cites W2162039003 @default.
• W1986332014 cites W2167813683 @default.
• W1986332014 cites W2325363379 @default.
• W1986332014 cites W2395185936 @default.
• W1986332014 cites W42043509 @default.
• W1986332014 cites W63931606 @default.
• W1986332014 doi "https://doi.org/10.1074/jbc.273.23.14119" @default.
• W1986332014 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9603911" @default.
• W1986332014 hasPublicationYear "1998" @default.
• W1986332014 type Work @default.
• W1986332014 sameAs 1986332014 @default.
• W1986332014 citedByCount "39" @default.
• W1986332014 countsByYear W19863320142012 @default.
• W1986332014 countsByYear W19863320142013 @default.
• W1986332014 countsByYear W19863320142014 @default.
• W1986332014 countsByYear W19863320142015 @default.
• W1986332014 countsByYear W19863320142016 @default.
• W1986332014 countsByYear W19863320142023 @default.
• W1986332014 crossrefType "journal-article" @default.
• W1986332014 hasAuthorship W1986332014A5003887816 @default.
• W1986332014 hasAuthorship W1986332014A5014770114 @default.
• W1986332014 hasAuthorship W1986332014A5035156230 @default.
• W1986332014 hasAuthorship W1986332014A5046409450 @default.
• W1986332014 hasAuthorship W1986332014A5051642123 @default.
• W1986332014 hasAuthorship W1986332014A5085732658 @default.
• W1986332014 hasAuthorship W1986332014A5087838405 @default.
• W1986332014 hasBestOaLocation W19863320141 @default.
• W1986332014 hasConcept C104317684 @default.
• W1986332014 hasConcept C1491633281 @default.
• W1986332014 hasConcept C159047783 @default.
• W1986332014 hasConcept C2522874641 @default.
• W1986332014 hasConcept C2778461978 @default.
• W1986332014 hasConcept C2779562191 @default.
• W1986332014 hasConcept C502942594 @default.
• W1986332014 hasConcept C54355233 @default.
• W1986332014 hasConcept C86803240 @default.
• W1986332014 hasConcept C95444343 @default.
• W1986332014 hasConceptScore W1986332014C104317684 @default.
• W1986332014 hasConceptScore W1986332014C1491633281 @default.
• W1986332014 hasConceptScore W1986332014C159047783 @default.
• W1986332014 hasConceptScore W1986332014C2522874641 @default.
• W1986332014 hasConceptScore W1986332014C2778461978 @default.
• W1986332014 hasConceptScore W1986332014C2779562191 @default.
• W1986332014 hasConceptScore W1986332014C502942594 @default.

• next