FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1986376992> ?p ?o ?g. }

• W1986376992 endingPage "20161" @default.
• W1986376992 startingPage "20152" @default.
• W1986376992 abstract "Xenopus transcription factor IIIA (TFIIIA) binds to over 50 base pairs in the internal control region of the 5 S rRNA gene, yet the binding energy for this interaction (ΔG 0 = −12.8 kcal/mol) is no greater than that exhibited by many proteins that occupy much smaller DNA targets. Despite considerable study, the distribution of the DNA binding energy among the various zinc fingers of TFIIIA remains poorly understood. By analyzing TFIIIA mutants with disruptions of individual zinc fingers, we have previously shown that each finger contributes favorably to binding (Del Rio, S., Menezes, S. R., and Setzer, D. R. (1993) J. Mol. Biol. 233, 567–579). Those results also suggested, however, that simultaneous binding by all nine zinc fingers of TFIIIA may involve a substantial energetic cost. Using complementary N- and C-terminal fragments and full-length proteins containing pairs of disrupted fingers, we now show that energetic interference indeed occurs between zinc fingers when TFIIIA binds to the 5 S rRNA gene and that the greatest interference occurs between fingers at opposite ends of the protein in the TFIIIA·5 S rRNA gene complex. Some, but not all, of the thermodynamically unfavorable strain in the TFIIIA·5 S rRNA gene complex may be derived from bending of the DNA that is necessary to accommodate simultaneous binding by all nine zinc fingers of TFIIIA. The energetics of DNA binding by TFIIIA thus emerges as a compromise between individual favorable contacts of importance along the length of the internal control region and long range strain or distortion in the protein, the 5 S rRNA gene, or both that is necessary to accommodate the various local interactions. Xenopus transcription factor IIIA (TFIIIA) binds to over 50 base pairs in the internal control region of the 5 S rRNA gene, yet the binding energy for this interaction (ΔG 0 = −12.8 kcal/mol) is no greater than that exhibited by many proteins that occupy much smaller DNA targets. Despite considerable study, the distribution of the DNA binding energy among the various zinc fingers of TFIIIA remains poorly understood. By analyzing TFIIIA mutants with disruptions of individual zinc fingers, we have previously shown that each finger contributes favorably to binding (Del Rio, S., Menezes, S. R., and Setzer, D. R. (1993) J. Mol. Biol. 233, 567–579). Those results also suggested, however, that simultaneous binding by all nine zinc fingers of TFIIIA may involve a substantial energetic cost. Using complementary N- and C-terminal fragments and full-length proteins containing pairs of disrupted fingers, we now show that energetic interference indeed occurs between zinc fingers when TFIIIA binds to the 5 S rRNA gene and that the greatest interference occurs between fingers at opposite ends of the protein in the TFIIIA·5 S rRNA gene complex. Some, but not all, of the thermodynamically unfavorable strain in the TFIIIA·5 S rRNA gene complex may be derived from bending of the DNA that is necessary to accommodate simultaneous binding by all nine zinc fingers of TFIIIA. The energetics of DNA binding by TFIIIA thus emerges as a compromise between individual favorable contacts of importance along the length of the internal control region and long range strain or distortion in the protein, the 5 S rRNA gene, or both that is necessary to accommodate the various local interactions. Xenopus transcription factor IIIA (TFIIIA) 1The abbreviations used are: TFIIIA, transcription factor IIIA; ICR, internal control region; PCR, polymerase chain reaction. is a multifunctional protein that recognizes the major cis-acting transcriptional control element in 5 S rRNA genes (the internal control region, or ICR) and thereby nucleates the formation of transcription complexes that result in the synthesis of 5 S rRNA (1Engelke D.R. Ng S.Y. Shastry B.S. Roeder R.G. Cell. 1980; 19: 717-728Abstract Full Text PDF PubMed Scopus (432) Google Scholar, 2Setzer D.R. Brown D.D. J. Biol. Chem. 1985; 260: 2483-2492Abstract Full Text PDF PubMed Google Scholar, 3Lassar A.B. Martin P.L. Roeder R.G. Science. 1983; 222: 740-748Crossref PubMed Scopus (239) Google Scholar). It also binds to 5 S rRNA itself to form a ribonucleoprotein storage particle that accumulates inXenopus oocytes (4Picard B. Wegnez M. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 241-245Crossref PubMed Scopus (171) Google Scholar, 5Pelham H.R. Brown D.D. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 4170-4174Crossref PubMed Scopus (345) Google Scholar) and that may mediate feedback regulation of 5 S rRNA gene expression in somatic cells (5Pelham H.R. Brown D.D. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 4170-4174Crossref PubMed Scopus (345) Google Scholar, 6Rollins M.B. Del Rio S. Galey A.L. Setzer D.R. Andrews M.T. Mol. Cell. Biol. 1993; 13: 4776-4783Crossref PubMed Scopus (25) Google Scholar). As the first sequence-specific DNA-binding protein to be purified from eukaryotic cells (1Engelke D.R. Ng S.Y. Shastry B.S. Roeder R.G. Cell. 1980; 19: 717-728Abstract Full Text PDF PubMed Scopus (432) Google Scholar) and the archetypal zinc finger protein (7Miller J. McLachlan A.D. Klug A. EMBO J. 1985; 4: 1609-1614Crossref PubMed Scopus (1692) Google Scholar), TFIIIA has been an influential model protein for understanding the mechanisms of sequence-specific DNA and RNA recognition. The nine zinc fingers of TFIIIA define the sequence features that can be used to recognize zinc finger motifs in other proteins (7Miller J. McLachlan A.D. Klug A. EMBO J. 1985; 4: 1609-1614Crossref PubMed Scopus (1692) Google Scholar). These include two cysteine and two histidine residues with conserved spacing; these four amino acids coordinate a Zn2+ ion (8Diakun G.P. Fairall L. Klug A. Nature. 1986; 324: 698-699Crossref PubMed Scopus (169) Google Scholar) that contributes substantially to the stability of the folded domain (9Del Rio S. Menezes S.R. Setzer D.R. J. Mol. Biol. 1993; 233: 567-579Crossref PubMed Scopus (57) Google Scholar, 10Frankel A.D. Berg J.M. Pabo C.O. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 4841-4845Crossref PubMed Scopus (256) Google Scholar, 11Lee M.S. Gottesfeld J.M. Wright P.E. FEBS Lett. 1991; 279: 289-294Crossref PubMed Scopus (29) Google Scholar). Three conserved hydrophobic residues are also likely to stabilize TFIIIA-like zinc finger domains through interactions in a hydrophobic pocket. The large number of zinc fingers in TFIIIA has made its structural analysis difficult, and structural studies of zinc finger proteins have therefore focused on peptide fragments containing 1–3 zinc fingers from TFIIIA or other proteins (10Frankel A.D. Berg J.M. Pabo C.O. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 4841-4845Crossref PubMed Scopus (256) Google Scholar, 12Lee M.S. Gippert G.P. Soman K.V. Case D.A. Wright P.E. Science. 1989; 245: 635-637Crossref PubMed Scopus (542) Google Scholar, 13Liao X. Clemens K. Cavanagh J. Tennant L. Wright P.E. J. Biomol. NMR. 1994; 4: 433-454Crossref PubMed Scopus (11) Google Scholar, 14Bruschweiler R. Liao X. Wright P.E. Science. 1995; 268: 886-889Crossref PubMed Scopus (316) Google Scholar, 15Omichinski J.G. Clore G.M. Robien M. Sakaguchi K. Appella E. Gronenborn A.M. Biochemistry. 1992; 31: 3907-3917Crossref PubMed Scopus (55) Google Scholar, 16Kochoyan M. Havel T.F. Nguyen D.T. Dahl C.E. Keutmann H.T. Weiss M.A. Biochemistry. 1991; 30: 3371-3386Crossref PubMed Scopus (66) Google Scholar, 17Qian X. Weiss M.A. Biochemistry. 1992; 31: 7463-7476Crossref PubMed Scopus (28) Google Scholar, 18Klevit R.E. Herriott J.R. Horvath S.J. Proteins. 1990; 7: 215-226Crossref PubMed Scopus (93) Google Scholar) or on proteins containing a smaller number of consecutive zinc finger motifs (19Pavletich N.P. Pabo C.O. Science. 1991; 252: 809-817Crossref PubMed Scopus (1750) Google Scholar, 20Pavletich N.P. Pabo C.O. Science. 1993; 261: 1701-1707Crossref PubMed Scopus (611) Google Scholar, 21Fairall L. Schwabe J.W.R. Chapman L. Finch J.T. Rhodes D. Nature. 1993; 366: 483-487Crossref PubMed Scopus (298) Google Scholar). These studies have confirmed an earlier model of zinc finger structure (22Berg J.M. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 99-102Crossref PubMed Scopus (339) Google Scholar) in which the N terminus of the domain folds into a pair of antiparallel β strands containing the Zn2+-coordinating cysteines and the C terminus into a helix containing the conserved histidines. Crystallographic analyses of complexes between the zinc finger proteins zif268 (19Pavletich N.P. Pabo C.O. Science. 1991; 252: 809-817Crossref PubMed Scopus (1750) Google Scholar), GLI (20Pavletich N.P. Pabo C.O. Science. 1993; 261: 1701-1707Crossref PubMed Scopus (611) Google Scholar), or tramtrack (21Fairall L. Schwabe J.W.R. Chapman L. Finch J.T. Rhodes D. Nature. 1993; 366: 483-487Crossref PubMed Scopus (298) Google Scholar) and the specific DNA sequences recognized by each protein have revealed that specific DNA binding is mediated largely through major groove and phosphate contacts with the helical region of the zinc finger. The initial solution of the zif268-DNA structure raised hopes that a simple code for zinc finger recognition of DNA might be possible, but later structures have suggested that a multiplicity of recognition modes are used by different zinc finger proteins, even when the overall structures of the zinc finger domains exhibit considerable similarity. This observation, coupled with much biochemical data as well as theoretical considerations, suggests that extrapolating from the properties of known zinc fingers to the structure of TFIIIA in a complex with the 5 S rRNA gene may be misleading. TFIIIA binds to the 5 S rRNA gene with an equilibrium binding affinity (K d ) of about 0.4 nm (23Del Rio S. Setzer D.R. Nucleic Acids Res. 1991; 19: 6197-6203Crossref PubMed Scopus (36) Google Scholar, 24Romaniuk P.J. J. Biol. Chem. 1990; 265: 17593-17600Abstract Full Text PDF PubMed Google Scholar), which is comparable to the affinity exhibited by many other sequence-specific DNA-binding proteins that occupy much smaller recognition surfaces than that represented by the 52 base pairs bound by TFIIIA (positions 45–96 of the Xenopus borealis somatic-type 5 S rRNA gene). A variety of analyses has demonstrated that the zinc fingers of TFIIIA are aligned more or less in order along the length of the internal control region of the 5 S rRNA gene, with the N-terminal fingers near the 3′ end of the control region and the C-terminal fingers near the 5′ end (9Del Rio S. Menezes S.R. Setzer D.R. J. Mol. Biol. 1993; 233: 567-579Crossref PubMed Scopus (57) Google Scholar, 25Smith D.R. Jackson I.J. Brown D.D. Cell. 1984; 37: 645-652Abstract Full Text PDF PubMed Scopus (149) Google Scholar, 26Vrana K.E. Churchill M.E. Tullius T.D. Brown D.D. Mol. Cell. Biol. 1988; 8: 1684-1696Crossref PubMed Scopus (124) Google Scholar, 27Hayes J.J. Clemens K.R. Biochemistry. 1992; 31: 11600-11605Crossref PubMed Scopus (41) Google Scholar, 28Clemens K.R. Liao X. Wolf V. Wright P.E. Gottesfeld J.M. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10822-10826Crossref PubMed Scopus (87) Google Scholar). Results obtained with truncation mutants have been interpreted to mean that almost all the free energy of DNA binding can be attributed to interactions between the first three zinc fingers of TFIIIA and the C box of the internal control region, whereas fingers 4–6 or 4–7 perform an analogous function in providing most of the specificity and free energy for 5 S rRNA recognition (29Clemens K.R. Wolf V. McBryant S.J. Zhang P. Liao X. Wright P.E. Gottesfeld J.M. Science. 1993; 260: 530-533Crossref PubMed Scopus (112) Google Scholar, 30Pieler T. Theunissen O. Trends Biochem. Sci. 1993; 18: 226-230Abstract Full Text PDF PubMed Scopus (39) Google Scholar, 31Clemens K.R. Zhang P. Liao X. McBryant S.J. Wright P.E. Gottesfeld J.M. J. Mol. Biol. 1994; 244: 23-35Crossref PubMed Scopus (58) Google Scholar). In fact, numerous studies have confirmed that a fragment containing only zinc fingers 1–3 binds with high affinity and specificity to the 3′ end of the 5 S rRNA gene's ICR (26Vrana K.E. Churchill M.E. Tullius T.D. Brown D.D. Mol. Cell. Biol. 1988; 8: 1684-1696Crossref PubMed Scopus (124) Google Scholar, 32Christensen J.H. Hansen P.K. Lillelund O. Thogersen H.C. FEBS Lett. 1991; 281: 181-184Crossref PubMed Scopus (71) Google Scholar, 33Liao X. Clemens K.R. Tennant L. Wright P.E. Gottesfeld J.M. J. Mol. Biol. 1992; 223: 857-871Crossref PubMed Scopus (94) Google Scholar, 34Darby M.K. Joho K.E. Mol. Cell. Biol. 1992; 12: 3155-3164Crossref PubMed Scopus (38) Google Scholar, 35Theunissen O. Rudt F. Guddat U. Mentzel H. Pieler T. Cell. 1992; 71: 679-690Abstract Full Text PDF PubMed Scopus (142) Google Scholar), whereas the central 3–4 zinc fingers of TFIIIA suffice for high affinity 5 S rRNA binding (29Clemens K.R. Wolf V. McBryant S.J. Zhang P. Liao X. Wright P.E. Gottesfeld J.M. Science. 1993; 260: 530-533Crossref PubMed Scopus (112) Google Scholar,35Theunissen O. Rudt F. Guddat U. Mentzel H. Pieler T. Cell. 1992; 71: 679-690Abstract Full Text PDF PubMed Scopus (142) Google Scholar, 36McBryant S.J. Veldhoen N. Gedulin B. Leresche A. Foster M.P. Wright P.E. Romaniuk P.J. Gottesfeld J.M. J. Mol. Biol. 1995; 248: 44-57Crossref PubMed Scopus (40) Google Scholar). Thus, the surprising dual specificity of TFIIIA, which permits recognition of both 5 S rRNA and the 5 S rRNA gene, has been explained by proposing that zinc fingers are specialized either for DNA binding (fingers 1–3) or RNA binding (4Picard B. Wegnez M. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 241-245Crossref PubMed Scopus (171) Google Scholar, 5Pelham H.R. Brown D.D. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 4170-4174Crossref PubMed Scopus (345) Google Scholar, 6Rollins M.B. Del Rio S. Galey A.L. Setzer D.R. Andrews M.T. Mol. Cell. Biol. 1993; 13: 4776-4783Crossref PubMed Scopus (25) Google Scholar, 7Miller J. McLachlan A.D. Klug A. EMBO J. 1985; 4: 1609-1614Crossref PubMed Scopus (1692) Google Scholar) (29Clemens K.R. Wolf V. McBryant S.J. Zhang P. Liao X. Wright P.E. Gottesfeld J.M. Science. 1993; 260: 530-533Crossref PubMed Scopus (112) Google Scholar, 30Pieler T. Theunissen O. Trends Biochem. Sci. 1993; 18: 226-230Abstract Full Text PDF PubMed Scopus (39) Google Scholar, 35Theunissen O. Rudt F. Guddat U. Mentzel H. Pieler T. Cell. 1992; 71: 679-690Abstract Full Text PDF PubMed Scopus (142) Google Scholar). The results of various footprinting studies with intact TFIIIA and a nested set of TFIIIA truncation mutants have also been used to support models for the alignment of the zinc fingers of TFIIIA relative to the underlying sequence of the 5 S rRNA gene (27Hayes J.J. Clemens K.R. Biochemistry. 1992; 31: 11600-11605Crossref PubMed Scopus (41) Google Scholar, 28Clemens K.R. Liao X. Wolf V. Wright P.E. Gottesfeld J.M. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10822-10826Crossref PubMed Scopus (87) Google Scholar, 30Pieler T. Theunissen O. Trends Biochem. Sci. 1993; 18: 226-230Abstract Full Text PDF PubMed Scopus (39) Google Scholar, 37Hayes J.J. Tullius T.D. J. Mol. Biol. 1992; 227: 407-417Crossref PubMed Scopus (80) Google Scholar). In these models, zinc fingers 1–3 and 7–9 assume zif268-like conformations at the 3′ and 5′ ends of the ICR, respectively, whereas finger 5 interacts in the major groove of the so-called intermediate element. Fingers 4 and 6 are proposed to bind on a single face and cross the minor groove on either side of the intermediate element. Although studies of truncation mutants of TFIIIA have been most informative, it is important to realize that the interpretation of such analyses is strongly dependent on the assumption that functional interactions between zinc fingers are absent or unimportant and that the structure and function of a protein fragment reflect those of the same moiety in the context of the full-length protein. As a complement to the study of TFIIIA fragments, we have therefore taken an alternative approach in which individual zinc fingers have been structurally disrupted in the context of an otherwise normal, full-length protein. These “broken finger” mutants have been generated by the mutation of one of the Zn2+-coordinating residues of a single zinc finger, and their structural and functional analysis has also been described previously (9Del Rio S. Menezes S.R. Setzer D.R. J. Mol. Biol. 1993; 233: 567-579Crossref PubMed Scopus (57) Google Scholar). Two points are worthy of comment in the context of the current study. First, footprinting analyses of the broken finger mutants on the 5 S rRNA gene suggested that existing models for alignment of the various zinc fingers of TFIIIA with respect to the underlying DNA sequence are unlikely to be correct in detail, particularly for the C-terminal fingers, since footprint alterations observed with the relevant broken finger mutants occurred up to 10 base pairs away from their putative sites of interaction in models based on the study of truncation mutants. Second, quantitative analysis of the DNA binding affinity of broken finger mutants suggested that all the zinc fingers of TFIIIA contribute favorably to the free energy of binding of the intact protein to the 5 S rRNA gene, with little indication of thermodynamic dominance by the first three zinc fingers. Furthermore, the data suggested that thermodynamically unfavorable interactions between zinc fingers occurred during the DNA binding reaction, resulting in a “compensatory” mode of binding. This mode of binding would result in a kind of “thermodynamic buffering” in which loss of binding by a single zinc finger would be partially compensated by relief of thermodynamically unfavorable strain in the complex. This interpretation, however, was dependent on the assumption that the mutations used to disrupt zinc finger structure resulted in complete loss of DNA binding activity by the relevant finger. Based on the binding properties of two complementary N- and C-terminal fragments of TFIIIA, and of a set of full-length proteins that contain pairs of disrupted zinc fingers, we now document that thermodynamic interference indeed occurs in the TFIIIA·ICR complex and that the degree of interference is greatest between zinc fingers at opposite ends of the protein. The fact that energetic strain is built into the TFIIIA·5 S rRNA gene complex has interesting implications for the assembly and function of the 5 S rRNA transcription complex, for the evolutionary divergence of TFIIIAs from different species, and for the interpretation of data derived from the analysis of TFIIIA fragments. E. coli expression plasmids pTA1–100 and pTA100–344 were designed to produce complementary N- and C-terminal fragments of TFIIIA. pTA1–100 encodes the polypeptide A1–100, which contains amino acids 1–100 of TFIIIA, whereas pTA100–344 encodes the polypeptide A100–344, containing amino acids 100–344, preceded by a methionine residue. The boundaries of these fragments lie in the linker between histidine 98, the most C-terminal Zn2+-binding residue of zinc finger 3, and cysteine 105, the first Zn2+-binding residue of finger 4. pTA1–100 was constructed by inserting a polymerase chain reaction (PCR)-generated fragment containing the first 100 codons of TFIIIA between the NdeI and BamHI sites of pET11b (38Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-88Crossref PubMed Scopus (6005) Google Scholar). Specifically, the relevant DNA fragment was synthesized from the plasmid pTA102 using the 5′ primer CTTTAAGAAGGAGATA and the 3′ primer 5′ TAGACGGGATCCTAGATGTTATGGAATC. The PCR product was doubly cut withNdeI and BamHI, and the cut product was gel-purified, concentrated by precipitation in ethanol, and ligated into the large NdeI/BamHI vector fragment of pET11b. Plasmids from resulting colonies were screened by digestion with PstI, and a positive clone sequenced throughout the A1–100-coding region to ensure that no unanticipated mutations were introduced by the PCR process. To construct pTA100–344, an NdeI site was introduced into the plasmid pGA13 (see below) in place of TFIIIA codons 98 and 99 by site-directed mutagenesis (39Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4558) Google Scholar), using the anticodon strand primer TCTTGATGTTCATATGTCTGTTAAAG. Potential positives were screened for introduction of the new NdeI site, and a single clone was chosen and sequenced throughout the TFIIIA-coding region to verify the expected alteration. An NdeI-BamHI fragment from this plasmid was ligated into NdeI/BamHI-cut pET11b to generate pTA100–344. Plasmids encoding mutant TFIIIAs with two-finger disruptions were generated in the plasmid pTA105. pTA105 was constructed by insertion of the NdeI-BamHI fragment of pGA13–894 between theNdeI and BamHI sites of pET11b-150. pGA13–894 was derived by directed mutagenesis of pGA13 and contains a substitution of the codons GAG AAG AAC for codons 309–311 of TFIIIA, which are GAA AAA AAT in the wild type. These alterations do not affect the sequence of TFIIIA encoded and were made for reasons that are irrelevant in the context of this paper. pGA13 was derived from pGA11-NdeI (23Del Rio S. Setzer D.R. Nucleic Acids Res. 1991; 19: 6197-6203Crossref PubMed Scopus (36) Google Scholar) and contains the EP-(300–304) sequence changes that have been described previously in the construction of pTA102 (23Del Rio S. Setzer D.R. Nucleic Acids Res. 1991; 19: 6197-6203Crossref PubMed Scopus (36) Google Scholar) but is otherwise identical to pGA11-NdeI. pET11b-150 was prepared by excising theAlwNI-PstI fragment of pZ150 (40Brown M.L. Schroth G.P. Gottesfeld J.M. Bazett-Jones D.P. J. Mol. Biol. 1996; 262: 600-614Crossref PubMed Scopus (10) Google Scholar) that contains the M13 replication origin and using it to replace the correspondingAlwNI-PstI fragment of pET11b. pTA105 therefore can be used to express wild-type TFIIIA protein from the T7 promoter in pET11b and also can be used to obtain single-stranded DNA for purposes of directed mutagenesis or sequencing. In pTA105, the single strand packaged in phage particles corresponds to the anticodon-sense strand of TFIIIA. Five codon-sense primers were used for introduction of the histidine to asparagine substitutions in the mutant sequences; the H33N mutation and a HindIII site were introduced using TGGAAGCTTCAGGCGAATCTG; the H63N mutation and an EcoRI site were introduced using TTAACCCGGAATTCACTCACT; the H183N mutation and aDraI site were introduced using GACATTATATTTAAAAAACGTGGCAG; the H241N mutation and a HindIII site were introduced using AGAAGCAATATACAAAGCTTTCAT; the H272N mutation and an EcoRI site were introduced using CTAGAAAGGAATTCAGTT. In the construction of the double mutants, two mutagenic primers were used simultaneously in a standard oligonucleotide-directed mutagenesis experiment (39Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4558) Google Scholar). Resulting clones were screened for the introduction of both mutations using the restriction site tags associated with the desired changes. The presence of the desired mutations was then verified by sequencing the entire TFIIIA coding sequence from a single positive clone. Plasmids encoding each construct were transformed intoE. coli strain BL21(DE3), and mutant TFIIIA proteins were expressed and purified as described previously (23Del Rio S. Setzer D.R. Nucleic Acids Res. 1991; 19: 6197-6203Crossref PubMed Scopus (36) Google Scholar), with the following modifications. We found A1–100 to be considerably more soluble than wild-type TFIIIA in E. coli, so recombinant A1–100 was recovered in the initial supernatant after cell lysis by sonication. Further extraction of the insoluble pellet with urea was unnecessary. In contrast, A100–344 is substantially more difficult to solubilize than is wild-type TFIIIA, so initial cell lysis by sonication was performed in the presence of 5 m urea, and the resulting pellet after centrifugation was extracted in 5 murea-containing buffer for several days to recover reasonable yields of solubilized protein. Full-length mutants with two disrupted zinc fingers behaved similarly to wild-type TFIIIA and the single-finger mutants (9Del Rio S. Menezes S.R. Setzer D.R. J. Mol. Biol. 1993; 233: 567-579Crossref PubMed Scopus (57) Google Scholar). After ammonium sulfate fractionation and binding to Bio-Rex 70 in 5 m urea as described previously (23Del Rio S. Setzer D.R. Nucleic Acids Res. 1991; 19: 6197-6203Crossref PubMed Scopus (36) Google Scholar), the column was washed with the binding buffer lacking urea and then eluted in a single step with binding buffer containing 1 m NaCl and no urea. This modification aided in keeping the proteins soluble without adversely affecting purity of the final product. In most cases, mutant proteins were further purified on phenyl-Superose or phenyl-Sepharose as described previously (23Del Rio S. Setzer D.R. Nucleic Acids Res. 1991; 19: 6197-6203Crossref PubMed Scopus (36) Google Scholar). In some cases, additional purification was achieved instead by chromatography of the Bio-Rex 70-eluted material on Superose 12 in buffer identical to that used to elute TFIIIA from the Bio-Rex 70 column. While overall recoveries were sometimes lower using the Superose 12 column, we often found that a higher percentage of the purified protein was active when assayed for DNA binding. In some cases, further purification beyond the Bio-Rex 70 stage proved technically infeasible, and Bio-Rex 70-eluted material was used directly in the analysis. To ensure that the double broken finger mutants contained structural disruptions in the proteins only within the mutated fingers and that no unanticipated longer range structural “cooperativity” resulted in more global or extended unfolding of the mutant proteins, we analyzed H33N/H63N, H241N/H272N, H33N/H272N, H33N/H241N, H63N/H241N, and H63N/H272N by partial proteolysis with thermolysin in a manner similar to that described previously for analysis of the single broken finger mutants (9Del Rio S. Menezes S.R. Setzer D.R. J. Mol. Biol. 1993; 233: 567-579Crossref PubMed Scopus (57) Google Scholar). In each case, the proteolytic digestion pattern was compared with that of wild-type TFIIIA and the corresponding single finger mutants. In every case, we observed proteolytic products of sizes equal to those predicted from the sites of proteolytic sensitivity observed in the corresponding single finger mutants (data not shown). Thus, even in the double finger mutants, there is no reason to believe the histidine to asparagine substitutions we have engineered to result in structural disruption of specific zinc fingers have longer range structural effects in the mutant proteins. K d values were measured and the data from multiple independent determinations used in analysis of covariance to arrive at a single best estimate of the K d with associated statistical measures of precision as described previously (9Del Rio S. Menezes S.R. Setzer D.R. J. Mol. Biol. 1993; 233: 567-579Crossref PubMed Scopus (57) Google Scholar). DNase I footprinting studies were conducted as described previously, with selection of bound complexes after DNase I treatment but before analysis of cleavage events on a denaturing gel (9Del Rio S. Menezes S.R. Setzer D.R. J. Mol. Biol. 1993; 233: 567-579Crossref PubMed Scopus (57) Google Scholar). We have noted the sporadic appearance of an electrophoretic artifact resulting in a prominent band and smear in some footprinting results when using gels containing 8.33 murea but no formamide (see Fig. 1 B). The inclusion of 40% formamide in the gel eliminates this artifact, suggesting it is the result of some structural feature in the end-labeled DNA fragment used that persists in the presence of urea. The results of Fig.1 B were obtained using a gel containing 8.33 murea but lacking formamide.Table IIEquilibrium binding constants of double broken finger mutantsMutantFingers mutatedNnK dRelativeK dΔG 0nmkcal/molWild type6480.416 ± 0.031.0−12.79(−12.75 to −12.83)H33N-H63N1 + 25329.30 ± 0.5222.4−10.95(−10.92 to −10.99)H33N-H241N1 + 842920.21 ± 1.548.6−10.49(−10.45 to −10.54)H33N-H272N1 + 943414.55 ± 1.435.0−10.69(−10.63 to −10.74)H63N-H241N2 + 863735.19 ± 2.484.6−10.16(−10.12 to −10.21)H63N-H272N2 + 942325.70 ± 2.561.8−10.35(−10.29 to −10.41)H183N-H241N6 + 85367.44 ± 0.5717.9−11.08(−11.04 to −11.13)H241N-H272N8 + 96568.78 ± 0.6121.1−10.98(−10.95 to −11.03)The notation is as described for Table I. The range of values given in parentheses following the ΔG 0 provide the ΔG 0 interval corresponding to (K d ± S.E.). Open table in a new tab Table IDNA binding properties of A1–100 and A100–344 fragmentsFragmentFingers deletedNnK dRelativeK dΔG 0Percent of wild-type ΔG 0nmkcal/mol%Wild-type6480.416 ± 0.031.0−12.79A1–1004–96524.00 ± 0.669.6−11.4789.7A100–3441–332915.5 ± 2.337.2−10.6683.3Sum of fragment ΔG 0values−22.13173.0N, number of independent determinations of theK d . n, total number of data points. TheK d is given with an associated standard error determined by analysis of covariance using data sets from the independent K d determinations. The relativeK d is normalized to that of wild-type TFIIIA. The data for wild-type TFIIIA are from Table II of Del Rio et al. (9Del Rio S. Menezes S.R. Setzer D.R. J. Mol. Biol. 1993; 233: 567-579Crossref PubMed Scopus (57) Google Scholar). Open table in a new tab The notation is as described for Table I. The range of values given in parentheses following the ΔG 0 provide the ΔG 0 interval corresponding to (K d ± S.E.). N, number of independent determinations of theK d . n, total number of data points. TheK d is given with an associated standard error determined by analysis of covariance using data sets from the" @default.
• W1986376992 created "2016-06-24" @default.
• W1986376992 creator A5036844367 @default.
• W1986376992 creator A5041393861 @default.
• W1986376992 creator A5059742158 @default.
• W1986376992 creator A5060869098 @default.
• W1986376992 creator A5062684664 @default.
• W1986376992 date "1997-08-01" @default.
• W1986376992 modified "2023-09-27" @default.
• W1986376992 title "Energetically Unfavorable Interactions among the Zinc Fingers of Transcription Factor IIIA When Bound to the 5 S rRNA Gene" @default.
• W1986376992 cites W1038211084 @default.
• W1986376992 cites W1482729845 @default.
• W1986376992 cites W1504141518 @default.
• W1986376992 cites W1531234455 @default.
• W1986376992 cites W1597423304 @default.
• W1986376992 cites W1873199501 @default.
• W1986376992 cites W1964006283 @default.
• W1986376992 cites W1967598896 @default.
• W1986376992 cites W1973080393 @default.
• W1986376992 cites W1973763076 @default.
• W1986376992 cites W1974266455 @default.
• W1986376992 cites W1975057427 @default.
• W1986376992 cites W1976459530 @default.
• W1986376992 cites W1983309341 @default.
• W1986376992 cites W1988159427 @default.
• W1986376992 cites W1988836624 @default.
• W1986376992 cites W1989372611 @default.
• W1986376992 cites W1995246183 @default.
• W1986376992 cites W1997706668 @default.
• W1986376992 cites W2002107168 @default.
• W1986376992 cites W2002515925 @default.
• W1986376992 cites W2006624258 @default.
• W1986376992 cites W2007272508 @default.
• W1986376992 cites W2007490638 @default.
• W1986376992 cites W2009821284 @default.
• W1986376992 cites W2011198690 @default.
• W1986376992 cites W2020542035 @default.
• W1986376992 cites W2023257749 @default.
• W1986376992 cites W2030333654 @default.
• W1986376992 cites W2031682614 @default.
• W1986376992 cites W2032205265 @default.
• W1986376992 cites W2038597359 @default.
• W1986376992 cites W2039292958 @default.
• W1986376992 cites W2040487729 @default.
• W1986376992 cites W2041601475 @default.
• W1986376992 cites W2042359837 @default.
• W1986376992 cites W2042765757 @default.
• W1986376992 cites W2044900718 @default.
• W1986376992 cites W2051520229 @default.
• W1986376992 cites W2053801865 @default.
• W1986376992 cites W2055134764 @default.
• W1986376992 cites W2055488548 @default.
• W1986376992 cites W2058720015 @default.
• W1986376992 cites W2061162943 @default.
• W1986376992 cites W2062104167 @default.
• W1986376992 cites W2067765294 @default.
• W1986376992 cites W2084234979 @default.
• W1986376992 cites W2085732532 @default.
• W1986376992 cites W2090889370 @default.
• W1986376992 cites W2099051060 @default.
• W1986376992 cites W2109448523 @default.
• W1986376992 cites W2119692824 @default.
• W1986376992 cites W2124100270 @default.
• W1986376992 cites W2132291850 @default.
• W1986376992 cites W2137585149 @default.
• W1986376992 cites W2330567837 @default.
• W1986376992 cites W2888511473 @default.
• W1986376992 doi "https://doi.org/10.1074/jbc.272.32.20152" @default.
• W1986376992 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9242690" @default.
• W1986376992 hasPublicationYear "1997" @default.
• W1986376992 type Work @default.
• W1986376992 sameAs 1986376992 @default.
• W1986376992 citedByCount "17" @default.
• W1986376992 crossrefType "journal-article" @default.
• W1986376992 hasAuthorship W1986376992A5036844367 @default.
• W1986376992 hasAuthorship W1986376992A5041393861 @default.
• W1986376992 hasAuthorship W1986376992A5059742158 @default.
• W1986376992 hasAuthorship W1986376992A5060869098 @default.
• W1986376992 hasAuthorship W1986376992A5062684664 @default.
• W1986376992 hasBestOaLocation W19863769921 @default.
• W1986376992 hasConcept C104317684 @default.
• W1986376992 hasConcept C185592680 @default.
• W1986376992 hasConcept C24284526 @default.
• W1986376992 hasConcept C54355233 @default.
• W1986376992 hasConcept C86339819 @default.
• W1986376992 hasConcept C86803240 @default.
• W1986376992 hasConceptScore W1986376992C104317684 @default.
• W1986376992 hasConceptScore W1986376992C185592680 @default.
• W1986376992 hasConceptScore W1986376992C24284526 @default.
• W1986376992 hasConceptScore W1986376992C54355233 @default.
• W1986376992 hasConceptScore W1986376992C86339819 @default.
• W1986376992 hasConceptScore W1986376992C86803240 @default.
• W1986376992 hasIssue "32" @default.
• W1986376992 hasLocation W19863769921 @default.
• W1986376992 hasOpenAccess W1986376992 @default.
• W1986376992 hasPrimaryLocation W19863769921 @default.
• W1986376992 hasRelatedWork W1984265061 @default.
• W1986376992 hasRelatedWork W1991523530 @default.

• next