FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1986644498> ?p ?o ?g. }

• W1986644498 endingPage "1406" @default.
• W1986644498 startingPage "1398" @default.
• W1986644498 abstract "Novel splice variants of the α1 subunit of the Cav1.2 voltage-gated Ca2+ channel were identified that predicted two truncated forms of the α1 subunit comprising domains I and II generated by alternative splicing in the intracellular loop region linking domains II and III. In rabbit heart splice variant 1 (RH-1), exon 19 was deleted, which resulted in a reading frameshift of exon 20 with a premature termination codon and a novel 19-amino acid carboxyl-terminal tail. In the RH-2 variant, exons 17 and 18 were deleted, leading to a reading frameshift of exons 19 and 20 with a premature stop codon and a novel 62-amino acid carboxyl-terminal tail. RNase protection assays with RH-1 and RH-2 cRNA probes confirmed the expression in cardiac and neuronal tissue but not skeletal muscle. The deduced amino acid sequence from full-length cDNAs encoding the two variants predicted polypeptides of 99.0 and 99.2 kDa, which constituted domains I and II of the α1 subunit of the Cav1.2 channel. Antipeptide antibodies directed to sequences in the second intracellular loop between domains II and III identified the 240-kDa Cav1.2 subunit in sarcolemmal and heavy sarcoplasmic reticulum (HSR) membranes and a 99-kDa polypeptide in the HSR. An antipeptide antibody raised against unique sequences in the RH-2 variant also identified a 99-kDa polypeptide in the HSR. These data reveal the expression of additional Ca2+ channel structural units generated by alternative splicing of the Cav 1.2 gene. Novel splice variants of the α1 subunit of the Cav1.2 voltage-gated Ca2+ channel were identified that predicted two truncated forms of the α1 subunit comprising domains I and II generated by alternative splicing in the intracellular loop region linking domains II and III. In rabbit heart splice variant 1 (RH-1), exon 19 was deleted, which resulted in a reading frameshift of exon 20 with a premature termination codon and a novel 19-amino acid carboxyl-terminal tail. In the RH-2 variant, exons 17 and 18 were deleted, leading to a reading frameshift of exons 19 and 20 with a premature stop codon and a novel 62-amino acid carboxyl-terminal tail. RNase protection assays with RH-1 and RH-2 cRNA probes confirmed the expression in cardiac and neuronal tissue but not skeletal muscle. The deduced amino acid sequence from full-length cDNAs encoding the two variants predicted polypeptides of 99.0 and 99.2 kDa, which constituted domains I and II of the α1 subunit of the Cav1.2 channel. Antipeptide antibodies directed to sequences in the second intracellular loop between domains II and III identified the 240-kDa Cav1.2 subunit in sarcolemmal and heavy sarcoplasmic reticulum (HSR) membranes and a 99-kDa polypeptide in the HSR. An antipeptide antibody raised against unique sequences in the RH-2 variant also identified a 99-kDa polypeptide in the HSR. These data reveal the expression of additional Ca2+ channel structural units generated by alternative splicing of the Cav 1.2 gene. membrane-spanning regions 1–6 second intracellular loop between domains II and III reverse transcription-polymerase chain reaction rabbit heart splice variant nucleotide base pair sarcolemma sarcoplasmic reticulum heavy sarcoplasmic reticulum protein kinase C antipeptide antibody to loop II–III The voltage-gated ion channels determine membrane excitability and regulate signal transduction (1Catterall W.A. Annu. Rev. Biochem. 1995; 64: 493-531Crossref PubMed Scopus (777) Google Scholar, 2Catterall W.A. J. Bioenerg. Biomembr. 1996; 28: 219-230Crossref PubMed Scopus (78) Google Scholar, 3Tsien R.W. Lipscombe D. Madison D. Bley K. Fox A. Trends Neurosci. 1995; 18: 52-54Abstract Full Text PDF PubMed Scopus (144) Google Scholar, 4Hofmann F. Biel M. Flockerzi V. Annu. Rev. Neurosci. 1994; 17: 399-418Crossref PubMed Scopus (452) Google Scholar, 5Jones S.W. J. Bioenerg. Biomembr. 1998; 30: 299-312Crossref PubMed Scopus (115) Google Scholar). These ion channels consist of multimeric complexes comprising a central α subunit, which contains the structural determinants for ion selectivity, conductance, and voltage sensing, and several auxiliary subunits, which confer regulation on the α subunits (6Sather W.A. Yang J. Tsien R.W. Curr. Opin. Neurobiol. 1994; 4: 313-323Crossref PubMed Scopus (66) Google Scholar, 7Gurnett C.A. Campbell K.P. J. Biol. Chem. 1996; 271: 27975-27978Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). The α subunits of K+, Na+, and Ca2+ channels show overall structural similarity in that the α subunit of K+channels consists of a single domain, which is predicted to contain six membrane-spanning (S1–S6)1regions, whereas the structural unit of Na+ and Ca2+ channels consists of four such homologous domains (1Catterall W.A. Annu. Rev. Biochem. 1995; 64: 493-531Crossref PubMed Scopus (777) Google Scholar). Because the K+ channel genes encode only one domain, it is proposed that homo- and heterotetrameric co-assembly of single-domain K+ channel subunits is required to constitute the four-domain channel complexes (8Castellano A. Chiara M.D. Mellstrom B. Molina A. Monje F. Naranjo J.R. Lopez-Barneo J. J. Neurosci. 1997; 17: 4652-4661Crossref PubMed Google Scholar, 9Blaine J.T. Ribera A.B. J. Neurosci. 1998; 18: 9585-9593Crossref PubMed Google Scholar, 10Sobko A. Paretz A. Shirihai O. Etkin S. Cherepanova V. Dagan D. Attali B. J. Neurosci. 1998; 18: 10398-10408Crossref PubMed Google Scholar). The different pore-forming α subunits are encoded by distinct gene families (68Ertel E.A. Campbell K.P. Harpold M.M. Hofmann F. Mori Y. Perez-Reyes E. Schwartz A. Snutch T.P Tanabe T. Birnbaumer L. Tsien R.W. Catterall W.A. Neuron. 2000; 25: 533-535Abstract Full Text Full Text PDF PubMed Scopus (801) Google Scholar). Ten genes encoding the voltage-gated Ca2+channels have been identified; seven (denoted Cav 1.1–1.4 and Cav 2.1–2.3) encode the high voltage-activated channels (5Jones S.W. J. Bioenerg. Biomembr. 1998; 30: 299-312Crossref PubMed Scopus (115) Google Scholar, 11Snutch T.P. Reiner P.B. Curr. Opin. Neurobiol. 1992; 2: 247-253Crossref PubMed Scopus (251) Google Scholar, 12Birnbaumer L. Campbell K.P. Catterall W.A. Harpold M.M. Hofmann F. Horne W.A. Mori Y. Schwartz A. Snutch T.P. Tanabe T. Neuron. 1994; 13: 505-506Abstract Full Text PDF PubMed Scopus (317) Google Scholar, 13Lory P. Ophoff R.A. Nahmias J. Hum. Genet. 1997; 100: 149-150Crossref PubMed Scopus (26) Google Scholar, 14Vajna R. Schramm M. Pereverzev A. Arhhold S. Grabsch H. Klockner U. Perez-Reyes E. Schneider T. Eur. J. Biochem. 1998; 257: 274-285Crossref PubMed Scopus (58) Google Scholar, 15Pereon Y. Dettbarn C. Westlund K.N. Zhang J.T. Palade P. Eur. J. Physiol. 1998; 436: 309-314Crossref PubMed Scopus (21) Google Scholar, 16Fisher S.E. Ciccodicola A. Tanaka K. Kurci A. Desicato S. D'urso M. Craig I.W. Genomics. 1997; 45: 340-347Crossref PubMed Scopus (34) Google Scholar, 17Mikami A. Imoto K. Tanabe T. Niidome T. Mori Y. Takeshima H. Narumiya S. Numa S. Nature. 1989; 340: 230-233Crossref PubMed Scopus (767) Google Scholar), and three (Cav 3.1–3.3) encode the low voltage-activated channels (18Perez-Reyes E. J. Bioenerg. Biomembr. 1998; 30: 313-318Crossref PubMed Scopus (84) Google Scholar, 19Lee J.H. Daud A.N. Cribbs L.L. Lacerda A.E. Pereverzev A. Klockner U. Schneider T. Perez-Reyes E. J. Neurosci. 1999; 19: 1912-1921Crossref PubMed Google Scholar, 20Perez-Reyes E. Cribbs L.L. Daud A. Lacerdam A.E. Barclay J. Williamson M.P. Fox M. Rees M. Lee J.H. Nature. 1998; 391: 896-900Crossref PubMed Scopus (639) Google Scholar, 21Cribbs L.L. Lee J.H. Yang J. Satin J. Zhang Y. Daud A. Barclay J. Willamson M.P. Fox M. Perez-Reyes E. Circ. Res. 1998; 83: 103-109Crossref PubMed Scopus (518) Google Scholar). Genes encoding different α1 subunits of the voltage-gated Ca2+channels exhibit distinct channel properties, which are determined by subtle changes in amino acid composition and appear to be expressed in a tissue- and cell-specific manner (22Westenbroek R.E. Sakurai T. Elliott E.M. Hell J.W. Starr T.V.B. Snutch T.P. Catterall W.A. J. Neurosci. 1995; 15: 6403-6418Crossref PubMed Google Scholar, 23Snutch T.P. Tomlinson W.J. Leonard J.P. Gilbert M.M. Neuron. 1991; 7: 45-57Abstract Full Text PDF PubMed Scopus (295) Google Scholar, 24Hell J.W. Westenbroek R.E. Elliott E.M. Catterall W.A. Ann. N. Y. Acad. Sci. 1994; 747: 282-293Crossref PubMed Scopus (30) Google Scholar, 25Sakurai T. Hell J.W. Woppmann A. Miljanich G.P. Catterall W.A. J. Biol. Chem. 1995; 270: 21234-21242Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 26Talley E.M. Cribbs L.L. Lee J.H. Daud A. Rerez-Reyes E. Bayliss D.A. J. Neurosci. 1999; 19: 1895-1911Crossref PubMed Google Scholar, 27Reuter H. Curr. Opin. Neourobiol. 1996; 6: 331-337Crossref PubMed Scopus (121) Google Scholar, 28Zhou Z. January C.T. Biophys. J. 1998; 74: 1830-1839Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). Alternative splicing, posttranslational modifications, and modulation by auxiliary subunits can generate further diversity in Ca2+ channel heterogeneity, although the four-domain structure is maintained (29Diebold R.J. Koch W.J. Ellinor P.T. Wang J.J. Muthuchammy M. Wieczorek D.F. Schwartz A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1497-1501Crossref PubMed Scopus (91) Google Scholar, 30Soldatov N.M. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4628-4632Crossref PubMed Scopus (97) Google Scholar, 31Soldatov N.M. Bouron A. Reuter H. J. Biol. Chem. 1995; 270: 10540-10543Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 32Soldatov N.M. Zuhlke R.D. Bouron A. Reuter H. J. Biol. Chem. 1997; 272: 3560-3566Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 33Soldatov N.M. Oz M. O'Brien K.A. Abernethy D.R. Morad M. J. Biol. Chem. 1998; 273: 957-963Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 34Soldatov N.M. Raudsepp T. Chowdhary B.P. Hum. Hered. 1998; 48: 241-244Crossref PubMed Scopus (7) Google Scholar, 35Klockner U. Mikala G. Eisfeld J. Iles D.E. Strobeck M. Mershon J.L. Schwartz A. Varadi G. Am. J. Physiol. 1997; 272: H1372-H1381PubMed Google Scholar, 36Welling A. Ludwig A. Zimmer S. Klugbauer N. Flockerzi V. Hofmann F. Circ. Res. 1997; 81: 526-532Crossref PubMed Scopus (193) Google Scholar). For example, alternative splicing of mutually exclusive exons encoding the S3 segment of domain IV of the α1 subunit of Cav1.2 channels serves as a developmentally regulated switch in cardiac tissue coinciding with major changes in excitation (29Diebold R.J. Koch W.J. Ellinor P.T. Wang J.J. Muthuchammy M. Wieczorek D.F. Schwartz A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1497-1501Crossref PubMed Scopus (91) Google Scholar). Variability in the carboxyl-terminal region of the α1 subunit of Cav1.2 channels generated by alternative splicing influences the kinetics as well as Ca2+ and voltage dependence of the L-type Ca2+channels (32Soldatov N.M. Zuhlke R.D. Bouron A. Reuter H. J. Biol. Chem. 1997; 272: 3560-3566Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 33Soldatov N.M. Oz M. O'Brien K.A. Abernethy D.R. Morad M. J. Biol. Chem. 1998; 273: 957-963Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). Moreover, dihydropyridine sensitivity of cardiac and vascular α1 subunits of Cav1.2 Ca2+channels may be attributed to tissue-specific expression of an alternatively spliced S6 segment of domain I of the Cav 1.2 gene (36Welling A. Ludwig A. Zimmer S. Klugbauer N. Flockerzi V. Hofmann F. Circ. Res. 1997; 81: 526-532Crossref PubMed Scopus (193) Google Scholar). Changes in amino acid composition in the extramembrane regions of the α1 subunit appear to have given rise to specialized physiological roles for the different classes of α1subunits of the Ca2+ channel family (37Varadi G. Mori Y. Mikala G. Schwartz A. Trends Pharmacol. Sci. 1995; 16: 43-49Abstract Full Text PDF PubMed Scopus (208) Google Scholar, 38De Waard M. Gurnett C.A. Campbell K.P. Ion Channels. 1996; 4: 41-87Crossref PubMed Scopus (142) Google Scholar, 39Mori Y. Mikala G. Varadi G. Kobayashi T. Wakamori M. Koch S. Schwartz A. Jpn. J. Pharmacol. 1996; 72: 83-109Crossref PubMed Scopus (94) Google Scholar, 40Catterall W.A. Cell. 1991; 64: 871-874Abstract Full Text PDF PubMed Scopus (148) Google Scholar, 41Fabiato A. Am. J. Physiol. 1983; 245: C1-C14Crossref PubMed Google Scholar). For example, the structure of the intracellular loop connecting domains II and III appears to be a critical determinant of the mode of signal transmission in the Cav1.1 and Cav1.2 α1subunits (42Tanabe T. Beam K.G. Powell J.A. Numa S. Nature. 1988; 336: 134-139Crossref PubMed Scopus (582) Google Scholar, 43Tanabe T. Mikami A. Numa S. Beam K.G. Nature. 1990; 344: 451-453Crossref PubMed Scopus (193) Google Scholar, 44Tanabe T. Beam K.G. Adams B.A. Niidome T. Numa S. Nature. 1990; 346: 567-569Crossref PubMed Scopus (492) Google Scholar), because this structure of the skeletal (Cav1.1) but not cardiac (Cav1.2) α1 subunits can directly interact with the Ca2+ release channel of the sarcoplasmic reticulum to determine the contractile characteristics of skeletal muscle (45Lu X. Xu L. Meissner G. J. Biol. Chem. 1994; 269: 6511-6516Abstract Full Text PDF PubMed Google Scholar, 46Nakai J. Tanabe T. Konno T. Adams B. Beam K.G. J. Biol. Chem. 1998; 273: 24983-24986Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 47Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 29958-29964Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar). Furthermore, loop II–III of Cav2.1 (P/Q-type) and Cav2.2 (N-type) Ca2+ channels associates with syntaxin and synaptosomal associated protein 25 to regulate excitation-secretion coupling (50Sheng Z.H. Rettig J. Takahashi M. Caterrall W.A. Neuron. 1994; 13: 1303-1360Abstract Full Text PDF PubMed Scopus (370) Google Scholar, 51Sheng Z.H. Rettig J. Cook T. Catterall W.A. Nature. 1996; 379: 451-454Crossref PubMed Scopus (311) Google Scholar, 52Sheng Z.H. Yokoyama C.T. Cattreall W.A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5405-5410Crossref PubMed Scopus (163) Google Scholar, 53Rettig J. Sheng Z.H. Kim D.K. Hodson C.D. Snutch T.P. Catterall W.A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7363-7368Crossref PubMed Scopus (262) Google Scholar, 54Bahls F.H. Lartius R. Trudeau L.E. Doyle R.T. Fang Y. Witcher D. Campbell K. Haydon P.G. J. Neorobiol. 1998; 35: 198-208Crossref PubMed Scopus (0) Google Scholar, 55Sheng Z.H. Westenbroek R.E. Catterall W.A. J. Bioenerg. Biomemb. 1998; 30: 335-345Crossref PubMed Scopus (122) Google Scholar, 56Mochida S. Yokoyama C.T. Kim D.K. Itoh K. Catterall W.A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14523-14528Crossref PubMed Scopus (72) Google Scholar). Because the α1 subunit of Cav1.2 Ca2+ channels is expressed in tissues such as the myocardium and brain, which are composed of a heterogeneous population of cells, it has been postulated that alternatively spliced variants may be expressed to serve functions in a cell type-specific manner. In view of the functional importance of the loop II–III structure, we examined whether alternative splicing will result in the generation and expression of structural variants in this critical region. We report here the identification of two splice variants of Cav1.2 Ca2+ channels that generate truncated forms of the α1 subunits, which were predicted to constitute domains I and II with unique carboxyl-terminal tails. The expression of these variants in cardiac and neuronal tissue suggests that further diversity in Ca2+ channel function and regulation may be generated through alternative structural units. Total RNA was isolated using the TriPure reagent (Roche Molecular Biochemicals) according to method described by Chomczynski (48Chomczynski P. Biotechniques. 1993; 15: 532-537PubMed Google Scholar). Adult rabbit heart, brain, and skeletal muscle were frozen in liquid nitrogen, and total RNA was extracted in phenol thiocyanate. Total RNA (1.0 μg) was reverse transcribed with either a gene-specific primer, based on the sequence of the α1 subunit of the Cav 1.2 gene from rabbit myocardium described by Mikami et al. (Ref. 17Mikami A. Imoto K. Tanabe T. Niidome T. Mori Y. Takeshima H. Narumiya S. Numa S. Nature. 1989; 340: 230-233Crossref PubMed Scopus (767) Google Scholar; primer JW6, GGTGAAGATCGTGTCGTTGAC, nt 2990–2970) or random hexamers and SuperScript reverse transcriptase. The first-strand cDNA synthesis with the gene-specific primer results in exclusive reverse transcription of the Cav 1.2 transcripts from rabbit myocardium, thus yielding increased sensitivity of the PCR amplification by increasing the representation of the rare messages. To amplify the Cav1.2 subunit loop II–III, the specific primers JW5 (GTGGACAACCTGGCTGATGCTGAG, nt 2538–2561) and JW6 were used. The PCR was performed under the following conditions: 94 °C for 45 s, 50 °C for 30 s, and 72 °C for 30 s, repeated 30 times. There were two negative controls used, one with water to control for contamination of the master mix and a second control reaction that contained all reaction components except reverse transcriptase (i.e. RNA but no first-strand cDNA) to control for contamination from genomic DNA and partially processed mRNA. The PCR reaction was run in an MJ Research thermocycler. The products were analyzed by 1% gel electrophoresis, gel purified, and cloned into the pCRII vector (Invitrogen). Twenty bacterial colonies were selected and screened by restriction mapping. Amplification of the loop II–III variant fragments encompassing the predicted stop codon at nucleotide 2995 of the Cav 1.2 gene used upstream and downstream primers anchored in transmembrane sequences encoding domains II and III of cardiac α1 subunit. The sense primer loop5′ (TCCTACTGAATGTGTTGG, nt 2509–2529) and antisense primer loop3′ (CAGGATG TTGAAGTAGTTC, nt 3199–3179) also incorporated BamHI and EcoRI restriction sites, respectively, to facilitate directional cloning of the PCR products into pTZ18 (United States Biochemical, Cleveland, OH). Similar to RT-PCR performed with JW5 and JW6 primers, synthesis of the first-strand cDNA was primed with a gene-specific antisense loop3′ oligonucleotide. The following cycling condition were used: 94 °C for 45 s, 52 °C for 35 s, and 72 °C for 35 s, repeated 32 times. The final elongation was performed at 72 °C for 10 min. The RT-PCR products were analyzed on a 1% agarose gel, gel purified, and subcloned into the pTZ18 vector. Sixty bacterial colonies were selected and screened by restriction mapping and direct sequencing. Recombinant clones of loop II–III RT-PCR amplicons subcloned into either pCRII or pTZ18 were selected and inoculated overnight at 37 °C in LB broth containing 75 μg/ml ampicillin. Plasmid DNA was isolated using an alkaline miniprep (49Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). The recombinant constructs were screened by restriction enzyme digestion and agarose gel electrophoresis to identify loop II–III deletion variants. The various inserts were then purified with a Qiagen miniprep plasmid preparation method to obtain high-purity templates suitable for cycle sequencing with the Applied Biosystems Prism dye terminator cycle-sequencing method (PerkinElmer Life Sciences), and the sequences were analyzed using SeqAidII tools (University of Kansas). Total RNA (1.0 μg) prepared as described above was reverse transcribed with antisense primer 5′-CAGGATGTTGAAGTAGTTC-3′ (nt 3199–3179) and SuperScript at 50 °C for 45 min. PCR amplification was carried out at standard conditions with sense primer 5′-TGGAAACTGACAATGCTTCGAGCC-3′ (nt 180–203) and 3′ antisense splice-specific primers 5′-ATCCTCTTCTCCTTGGCCTCCTC-3′ and 5′-GAGGCGGAACCTGTGGTTTCC-3′, with first denaturation at 94 °C for 2 min followed by 94 °C for 45 s, 70 °C for 35 s, 72 °C 2 min 30 s, which was repeated 32 times, and the final elongating at 72 °C for 10 min. The PCR amplicons were electrophoresed on a 0.9% agarose gel, TA cloned into pCRII vector (Invitrogen), and cycle sequenced (PerkinElmer Life Sciences). The RNase protection assay used two cRNA probes, RH-1 and RH-2, representing deletion variants of loop II–III lacking exon 19 and exons 17 and 18. The32P-radiolabeled deletion variant probes were generated by in vitro transcription using MAXIscript reagents (Ambion) with [α-32P]UTP (PerkinElmer Life Sciences); 104 cpm of the respective RNA probe was hybridized with 15 μg of mRNA in a Hybspeed hybridization at 68 °C for 10 min followed by RNase digestion (RNase A/T1, 1:100) at 37 °C for 45 min. Reactions were inactivated by addition of inactivation-precipitation mix (Ambion) and ethanol precipitated. Pellets were resuspended in 10 μl of gel loading buffer and analyzed on 5% polyacrylamide-8m urea-1× Tris borate-EDTA vertical gel and subjected to autoradiography. The protected fragments appearing on the autoradiograms were quantified on a Kodak Science image analysis station. To assess relative expression of Cav 1.2 loop II–III variants, the intensities of protected fragments were size normalized and expressed as a ratio. Century RNA markers (Ambion) were used as molecular size standards. Affinity-purified antibodies directed against peptide sequences (KYTTKINMDDLQPSENEDKS) of the intracellular loop II–II of the Cav 1.2α1 subunit were generously provided by Dr. William Catterall. Polyclonal antibodies directed against the carboxyl-terminal sequences of RH-1 and RH-2 variants were raised in New Zealand White rabbits. The only unique amino acid sequence (TTGSASSVTVSSTTRSSPT) of the common 19-amino acid carboxyl terminus of RH-1 and RH-2 was found to be nonantigenic and gave no immune response. On the other hand, two peptide sequences, KRMRRSLRCLSAPALGHS and GHSPSCTLRRRPC, were selected to raise antibody 1929 selective for the RH-2 variant. The peptides were conjugated to keyhole limpet hemocyanin carrier protein via the carboxyl-terminal carboxyl group and used in six consecutive immunizations per each of the New Zealand White rabbits (Genosys). The antisera was collected in four bleeds per animal. The Na+/K+-ATPase antibodies were provided by Dr Kathleen Sweadner. Membrane fractions from rat myocardium were isolated by differential and sucrose density gradient centrifugation and characterized for the enrichment of markers for the sarcolemma (∼20-fold enrichment in Na+/K+-ATPase and adenylate cyclase activities) and heavy sarcoplasmic reticulum (∼10-fold enrichment in ryanodine receptors) as described (67Feher J.J. Davis M.D. J. Mol. Cell. Cardiol. 1991; 23: 249-258Abstract Full Text PDF PubMed Scopus (43) Google Scholar). Membrane proteins were subjected to SDS-polyacrylamide gel electrophoresis followed by transfer to nitrocellulose membranes, which were probed with affinity-purified antipeptide antibodies. The second intracellular loop connecting domains II and III of the α1 subunit of voltage-gated Ca2+ channels is believed to reside at the cytoplasmic phase of the membrane and determines the mode of signal transduction in excitation-contraction coupling in muscle cells (42Tanabe T. Beam K.G. Powell J.A. Numa S. Nature. 1988; 336: 134-139Crossref PubMed Scopus (582) Google Scholar, 43Tanabe T. Mikami A. Numa S. Beam K.G. Nature. 1990; 344: 451-453Crossref PubMed Scopus (193) Google Scholar, 44Tanabe T. Beam K.G. Adams B.A. Niidome T. Numa S. Nature. 1990; 346: 567-569Crossref PubMed Scopus (492) Google Scholar, 45Lu X. Xu L. Meissner G. J. Biol. Chem. 1994; 269: 6511-6516Abstract Full Text PDF PubMed Google Scholar, 46Nakai J. Tanabe T. Konno T. Adams B. Beam K.G. J. Biol. Chem. 1998; 273: 24983-24986Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 47Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 29958-29964Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar) and excitation-secretion coupling in nerve cells (50Sheng Z.H. Rettig J. Takahashi M. Caterrall W.A. Neuron. 1994; 13: 1303-1360Abstract Full Text PDF PubMed Scopus (370) Google Scholar, 51Sheng Z.H. Rettig J. Cook T. Catterall W.A. Nature. 1996; 379: 451-454Crossref PubMed Scopus (311) Google Scholar, 52Sheng Z.H. Yokoyama C.T. Cattreall W.A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5405-5410Crossref PubMed Scopus (163) Google Scholar, 53Rettig J. Sheng Z.H. Kim D.K. Hodson C.D. Snutch T.P. Catterall W.A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7363-7368Crossref PubMed Scopus (262) Google Scholar, 54Bahls F.H. Lartius R. Trudeau L.E. Doyle R.T. Fang Y. Witcher D. Campbell K. Haydon P.G. J. Neorobiol. 1998; 35: 198-208Crossref PubMed Scopus (0) Google Scholar, 55Sheng Z.H. Westenbroek R.E. Catterall W.A. J. Bioenerg. Biomemb. 1998; 30: 335-345Crossref PubMed Scopus (122) Google Scholar, 56Mochida S. Yokoyama C.T. Kim D.K. Itoh K. Catterall W.A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14523-14528Crossref PubMed Scopus (72) Google Scholar). Given the structural and functional importance of this region, we determined whether diversity in Ca2+channel structure can be created through alternative splicing in this region of the α1 subunit gene. The intracellular loop connecting domains II and III of Cav1.2 α1subunits was amplified from rabbit myocardium by RT-PCR using primers based on the cDNA sequence reported by Mikami et al.(17Mikami A. Imoto K. Tanabe T. Niidome T. Mori Y. Takeshima H. Narumiya S. Numa S. Nature. 1989; 340: 230-233Crossref PubMed Scopus (767) Google Scholar). The first-strand cDNA synthesis was primed either with the Cav1.2 subunit-specific oligonucleotide JW6 (nt 2990–2970) or random hexamers. The purpose of priming with the gene-specific oligonucleotide was to increase representation of the rare messages of the Cav1.2 transcript family. The PCR amplification of loop II–III was then carried out with JW5 (nt 2538–2561) and JW6 (nt 2990–2970) primers and analyzed by 1% agarose electrophoresis (Fig.1 A). The PCR with the JW6 primer yielded a major 452-nt product as well as smaller diffuse fragments (Fig. 1A, lane 1), whereas PCR of the first-strand cDNA primed with random hexamers yielded a single fragment of 452 nt (Fig. 1A, lane 3). Fig.1 A, lane 2, represents a PCR-negative control. Subcloning and direct sequencing of the PCR products shown in lane 1 revealed that the 452-nt product matched perfectly the sequence of the intracellular loop linking domains II and III of the rabbit heart α1 Cav 1.2subunit gene, whereas that of the smaller diffuse fragment matched the 452-nt loop II–III sequence except for a deletion of 133 nt (from 2812 to 2945). Open reading frame analysis of the 320-nt amplicon containing the 133-nt deletion indicated that the deletion was predicted to shift the translational reading frame of full-length α1 Cav 1.2 and to introduce a premature chain termination at nt 2995 (data not shown). To obtain longer cDNAs encompassing the entire loop II–III and the predicted stop codon, RT-PCR was performed with another set of primers nested in the transmembrane segment S6 of domain II and S3 segment of domain III (loop 5′, nt 2509–2529; and loop 3′, nt 3199–3179, respectively). Primers were designed to contain BamHI and EcoRI restriction enzyme sites to facilitate subcloning and analysis of the PCR amplicons. Fig. 1B depicts RT-PCR of rabbit heart, where the first-strand cDNA was performed with the gene-specific antisense oligonucleotide loop 3′, and PCR amplification was carried out with loop 5′ and loop 3′ primers. Similar to RT-PCR analysis carried out with the JW5 and JW6 primers, amplification with the loop 5′ and loop 3′ primers produced two products, an amplicon of ∼700 nt and a lower band of ∼560 bp (Fig. 1B, lane 1). Moreover, the size difference between the top and bottom products was ∼ 140 nt, analogous to the RT-PCR performed with the JW5 and JW6 primers. After subcloning of the amplified products, three representative amplicons were characterized by restriction mapping and direct sequencing (Fig. 1C). Lane 1 shows the presence of a 690-nt product, representing the expected amplification product of α1 Cav 1.2 with the loop 5′ and loop 3′ primers, and lanes 2 and 3 represent two clones isolated and characterized from the lower RT-PCR amplification band. The nucleotide sequence analysis and alignment shown in Fig. 2 Aindicated that the 690-nt product represented the nucleotide sequence of the expected amplified fragment encompassing the wild-type intracellular loop II–III of Cav1.2 (Rab-H), whereas the smaller products denoted two distinct variants of this sequence. Variant 1, denoted RH-1, and variant 2, denoted RH-2, appear to be derived from the full-length loop II–III sequence spanned by the loop 5′ and loop 3′ primers, as a consequence of internal deletions of 133 and 130 nt, respectively. The RH-1 variant contained deletion of nt 2812–2945, and it represents a deletion variant already characterized in the RT-PCR analysis carried out with the JW5 and JW6 primers. The RH-2 variant displayed deletions of nt 2681–2811, and it represents a novel variant cloned from the smaller amplification product of loop II–III. Analysis of the open reading frame of the deletion variants RH-1 and RH-2 in relation to the wild-type sequence confirmed that both deletions shifted the open reading frame, thus introducing a common termination codon (TGA) at nucleotide 2995. The amino acid sequence alignment of the variants indicated that both variants introduce novel amino acid sequences past their respective deletions depicting novel carboxyl terminal sequences of the truncated polypeptides (Fig.2 B). Because both variants use the same stop codon, the terminal 19 amino acids were identical in the two variants. An independent isolation of the RH-1 and RH-2 cDNAs was obtained with RT-PCR of RNA from the whole heart and cardiac left ventricle but not skeletal muscle.Figure 2Ch" @default.
• W1986644498 created "2016-06-24" @default.
• W1986644498 creator A5005668372 @default.
• W1986644498 creator A5031414231 @default.
• W1986644498 creator A5059349351 @default.
• W1986644498 creator A5061861053 @default.
• W1986644498 creator A5075225017 @default.
• W1986644498 date "2001-01-01" @default.
• W1986644498 modified "2023-09-30" @default.
• W1986644498 title "Alternative Splicing in Intracellular Loop Connecting Domains II and III of the α1 Subunit of Cav1.2 Ca2+ Channels Predicts Two-domain Polypeptides with Unique C-terminal Tails" @default.
• W1986644498 cites W117472882 @default.
• W1986644498 cites W1488825640 @default.
• W1986644498 cites W1607596217 @default.
• W1986644498 cites W1616459298 @default.
• W1986644498 cites W1686393656 @default.
• W1986644498 cites W1755201723 @default.
• W1986644498 cites W1803792965 @default.
• W1986644498 cites W1845250825 @default.
• W1986644498 cites W184718354 @default.
• W1986644498 cites W1940205808 @default.
• W1986644498 cites W1964437432 @default.
• W1986644498 cites W1982619593 @default.
• W1986644498 cites W1986124660 @default.
• W1986644498 cites W1988691994 @default.
• W1986644498 cites W1993117363 @default.
• W1986644498 cites W1994389894 @default.
• W1986644498 cites W1995275700 @default.
• W1986644498 cites W1995550177 @default.
• W1986644498 cites W1997393290 @default.
• W1986644498 cites W1997695515 @default.
• W1986644498 cites W2000060432 @default.
• W1986644498 cites W2001032837 @default.
• W1986644498 cites W2002378144 @default.
• W1986644498 cites W2007622582 @default.
• W1986644498 cites W2007656041 @default.
• W1986644498 cites W2019365444 @default.
• W1986644498 cites W2023351025 @default.
• W1986644498 cites W2023746713 @default.
• W1986644498 cites W2024371355 @default.
• W1986644498 cites W2024770437 @default.
• W1986644498 cites W2025197615 @default.
• W1986644498 cites W2025354712 @default.
• W1986644498 cites W2035585669 @default.
• W1986644498 cites W2036937904 @default.
• W1986644498 cites W2039905947 @default.
• W1986644498 cites W2042048113 @default.
• W1986644498 cites W2043159868 @default.
• W1986644498 cites W2051789222 @default.
• W1986644498 cites W2055015857 @default.
• W1986644498 cites W2055984902 @default.
• W1986644498 cites W2070555996 @default.
• W1986644498 cites W2070566940 @default.
• W1986644498 cites W2073150077 @default.
• W1986644498 cites W2078360969 @default.
• W1986644498 cites W2081024670 @default.
• W1986644498 cites W2081841708 @default.
• W1986644498 cites W2086887716 @default.
• W1986644498 cites W2087651417 @default.
• W1986644498 cites W2096046580 @default.
• W1986644498 cites W2098023801 @default.
• W1986644498 cites W2106138867 @default.
• W1986644498 cites W2107503430 @default.
• W1986644498 cites W2112749067 @default.
• W1986644498 cites W2113978902 @default.
• W1986644498 cites W2117496744 @default.
• W1986644498 cites W2121866513 @default.
• W1986644498 cites W2134902160 @default.
• W1986644498 cites W2158003732 @default.
• W1986644498 cites W2163615816 @default.
• W1986644498 cites W2172530119 @default.
• W1986644498 cites W2226437153 @default.
• W1986644498 cites W2912991414 @default.
• W1986644498 cites W3025655743 @default.
• W1986644498 cites W4244422961 @default.
• W1986644498 cites W4295700106 @default.
• W1986644498 cites W4296759753 @default.
• W1986644498 doi "https://doi.org/10.1074/jbc.m006868200" @default.
• W1986644498 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11010971" @default.
• W1986644498 hasPublicationYear "2001" @default.
• W1986644498 type Work @default.
• W1986644498 sameAs 1986644498 @default.
• W1986644498 citedByCount "34" @default.
• W1986644498 countsByYear W19866444982012 @default.
• W1986644498 countsByYear W19866444982013 @default.
• W1986644498 countsByYear W19866444982014 @default.
• W1986644498 countsByYear W19866444982015 @default.
• W1986644498 countsByYear W19866444982016 @default.
• W1986644498 countsByYear W19866444982018 @default.
• W1986644498 countsByYear W19866444982021 @default.
• W1986644498 countsByYear W19866444982022 @default.
• W1986644498 crossrefType "journal-article" @default.
• W1986644498 hasAuthorship W1986644498A5005668372 @default.
• W1986644498 hasAuthorship W1986644498A5031414231 @default.
• W1986644498 hasAuthorship W1986644498A5059349351 @default.
• W1986644498 hasAuthorship W1986644498A5061861053 @default.
• W1986644498 hasAuthorship W1986644498A5075225017 @default.
• W1986644498 hasBestOaLocation W19866444981 @default.
• W1986644498 hasConcept C104292427 @default.

• next