FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1987094458> ?p ?o ?g. }

• W1987094458 endingPage "33797" @default.
• W1987094458 startingPage "33788" @default.
• W1987094458 abstract "The DNA damage inducible gene ribonucleotide reductase (RNR3) is regulated by a transcriptional repression mechanism by the recruitment of the Ssn6-Tup1 corepressor complex to its promoter by the sequence-specific DNA-binding protein Crt1. Ssn6-Tup1 is reported to represses transcription by interfering with transcription factors, recruiting histone deacetylases, and positioning nucleosomes at the promoter of its target genes. Two of the three mechanisms involve effects on chromatin structure, and therefore, we have delineated the nucleosomal structure of RNR3 in the repressed and derepressed state using multiple nuclease mapping strategies. A regular array of positioned nucleosomes is detected over the repressed RNR3 promoter that extends into the coding sequence. Treating cells with DNA damaging agents or deletingCRT1, SSN6, or TUP1 derepressesRNR3 transcription, and causes a dramatic disruption of nucleosome positioning over its promoter. Furthermore, derepression ofRNR3 correlated with changes in nuclease sensitivity within the upstream repression sequence (URS) region. Specifically, the loss of a MNase-hypersensitive site, and the appearance of strong DNase I hypersensitivity, was observed over the URS. Interestingly, we find that the binding of Crt1 to the promoter in the absence of Ssn6 or Tup1 is insufficient for nucleosome positioning or regulating chromatin structure at the URS; thus, these two functions are strictly dependent upon Ssn6-Tup1. We propose that RNR3 is regulated by changes in nucleosome positioning and chromatin structure that are mediated by Ssn6, Tup1, and Crt1. The DNA damage inducible gene ribonucleotide reductase (RNR3) is regulated by a transcriptional repression mechanism by the recruitment of the Ssn6-Tup1 corepressor complex to its promoter by the sequence-specific DNA-binding protein Crt1. Ssn6-Tup1 is reported to represses transcription by interfering with transcription factors, recruiting histone deacetylases, and positioning nucleosomes at the promoter of its target genes. Two of the three mechanisms involve effects on chromatin structure, and therefore, we have delineated the nucleosomal structure of RNR3 in the repressed and derepressed state using multiple nuclease mapping strategies. A regular array of positioned nucleosomes is detected over the repressed RNR3 promoter that extends into the coding sequence. Treating cells with DNA damaging agents or deletingCRT1, SSN6, or TUP1 derepressesRNR3 transcription, and causes a dramatic disruption of nucleosome positioning over its promoter. Furthermore, derepression ofRNR3 correlated with changes in nuclease sensitivity within the upstream repression sequence (URS) region. Specifically, the loss of a MNase-hypersensitive site, and the appearance of strong DNase I hypersensitivity, was observed over the URS. Interestingly, we find that the binding of Crt1 to the promoter in the absence of Ssn6 or Tup1 is insufficient for nucleosome positioning or regulating chromatin structure at the URS; thus, these two functions are strictly dependent upon Ssn6-Tup1. We propose that RNR3 is regulated by changes in nucleosome positioning and chromatin structure that are mediated by Ssn6, Tup1, and Crt1. ribonucleotide reductase RNA polymerase II-specific TATA-binding protein-associated factors micrococcal nuclease damage response element upstream repression sequence methylmethane sulfonate yeast extract-peptone medium yeast synthetic drop-out medium polymerase chain reaction Accommodating the large mass of DNA within the limited space of the nucleus necessitates its compaction into chromatin and other higher order structures (1Simpson R.T. Prog. Nucleic Acids Res. Mol. Biol. 1991; 40: 143-184Crossref PubMed Scopus (202) Google Scholar, 2Wolffe A.P. Kurumizaka H. Prog. Nucleic Acids Res. Mol. Biol. 1998; 61: 379-422Crossref PubMed Google Scholar), which inevitably has a pivotal influence on most, if not all, DNA metabolism-related activities such as transcription, DNA replication, recombination, and repair (2Wolffe A.P. Kurumizaka H. Prog. Nucleic Acids Res. Mol. Biol. 1998; 61: 379-422Crossref PubMed Google Scholar, 3Wolffe A.P. Curr. Opin. Genet. Dev. 1994; 4: 245-254Crossref PubMed Scopus (50) Google Scholar, 4Svaren J. Horz W. Curr. Opin. Genet. Dev. 1996; 6: 164-170Crossref PubMed Scopus (59) Google Scholar). It is widely accepted that packaging DNA into nucleosomes imposes a severe limitation on the accessibility of DNA to the transcription apparatus; therefore, the nucleosome plays an important role in the constitutive repression of gene transcription (4Svaren J. Horz W. Curr. Opin. Genet. Dev. 1996; 6: 164-170Crossref PubMed Scopus (59) Google Scholar, 5Kingston R.E. Bunker C.A. Imbalzano A.N. Genes Dev. 1996; 10: 905-920Crossref PubMed Scopus (404) Google Scholar, 6Roth S.Y. Curr. Opin. Genet. Dev. 1995; 5: 168-173Crossref PubMed Scopus (87) Google Scholar, 7Struhl K. Cell. 1999; 98: 1-4Abstract Full Text Full Text PDF PubMed Scopus (372) Google Scholar, 8Workman J.L. Kingston R.E. Annu. Rev. Biochem. 1998; 67: 545-579Crossref PubMed Scopus (975) Google Scholar). Nevertheless, the packaging of DNA into chromatin is not exclusively repressive in nature. In some cases, higher-order chromatin structures facilitate transcription activation by holding distant regulatory elements into juxtaposition with themselves or the core promoter (2Wolffe A.P. Kurumizaka H. Prog. Nucleic Acids Res. Mol. Biol. 1998; 61: 379-422Crossref PubMed Google Scholar, 9Bruin D.D. Zaman Z. Liberarore R.A. Ptashne M. Nature. 2001; 409: 109-113Crossref PubMed Scopus (120) Google Scholar) or by stabilizing the interaction of transcription factors to chromatin (10Syntichaki P. Topalidou I. Thireos G. Nature. 2000; 404: 414-417Crossref PubMed Scopus (169) Google Scholar). It is well recognized that chromatin is not a static structure, but rather a dynamic formation that appears to be dramatically altered or rearranged during gene activation in vivo (7Struhl K. Cell. 1999; 98: 1-4Abstract Full Text Full Text PDF PubMed Scopus (372) Google Scholar, 8Workman J.L. Kingston R.E. Annu. Rev. Biochem. 1998; 67: 545-579Crossref PubMed Scopus (975) Google Scholar, 11Grunstein M. Nature. 1997; 389: 349-352Crossref PubMed Scopus (2419) Google Scholar, 12Mizzen C.A. Allis C.D. Cell Mol. Life Sci. 1998; 54: 6-20Crossref PubMed Scopus (191) Google Scholar, 13Peterson C.L. Workman J.L. Curr. Opin. Genet. Dev. 2000; 10: 187-192Crossref PubMed Scopus (383) Google Scholar). Perhaps the most dramatic changes to chromatin associated with gene expression are the positioning and disruption of nucleosomes within the promoters of genes (1Simpson R.T. Prog. Nucleic Acids Res. Mol. Biol. 1991; 40: 143-184Crossref PubMed Scopus (202) Google Scholar, 5Kingston R.E. Bunker C.A. Imbalzano A.N. Genes Dev. 1996; 10: 905-920Crossref PubMed Scopus (404) Google Scholar, 6Roth S.Y. Curr. Opin. Genet. Dev. 1995; 5: 168-173Crossref PubMed Scopus (87) Google Scholar, 8Workman J.L. Kingston R.E. Annu. Rev. Biochem. 1998; 67: 545-579Crossref PubMed Scopus (975) Google Scholar, 14Edmondson D.G. Roth S.Y. FASEB J. 1996; 10: 1173-1182Crossref PubMed Scopus (54) Google Scholar). The determinants of nucleosome positioning are poorly understood, but the requirement for the global co-repressor Ssn6-Tup1p (6Roth S.Y. Curr. Opin. Genet. Dev. 1995; 5: 168-173Crossref PubMed Scopus (87) Google Scholar, 14Edmondson D.G. Roth S.Y. FASEB J. 1996; 10: 1173-1182Crossref PubMed Scopus (54) Google Scholar, 15Cooper J.P. Roth S.Y. Simpson R.T. Genes Dev. 1994; 8: 1400-1410Crossref PubMed Scopus (166) Google Scholar, 16Smith R.L. Johnson A.D. Trends Biochem. Sci. 2000; 25: 325-330Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar), non-histone chromosomal proteins (17Moreira J.M. Holmberg S. EMBO J. 2000; 19: 6804-6813Crossref PubMed Scopus (56) Google Scholar), SIR proteins (18Guarente L. Nat. Genet. 1999; 23: 281-285Crossref PubMed Scopus (140) Google Scholar), enzymatic activities (13Peterson C.L. Workman J.L. Curr. Opin. Genet. Dev. 2000; 10: 187-192Crossref PubMed Scopus (383) Google Scholar, 19Moreira J.M. Holmberg S. EMBO J. 1999; 18: 2836-2844Crossref PubMed Scopus (78) Google Scholar, 20Goldmark J.P. Fazzio T.G. Estep P.W. Church G.M. Tsukiyama T. Cell. 2000; 103: 423-433Abstract Full Text Full Text PDF PubMed Scopus (252) Google Scholar, 21Cairns B.R. Lorch Y. Li Y. Zhang M. Lacomis L. Erdjument-Bromage H. Tempst P. Du J. Laurent B. Kornberg R.D. Cell. 1996; 87: 1249-1260Abstract Full Text Full Text PDF PubMed Scopus (583) Google Scholar), and DNA sequence (22Mai X. Chou S. Struhl K. Mol. Cell. Biol. 2000; 20: 6668-6676Crossref PubMed Scopus (45) Google Scholar, 23Iyer V. Struhl K. EMBO J. 1995; 14: 2570-2579Crossref PubMed Scopus (348) Google Scholar) have been reported. The mechanism of Ssn6-Tup1 mediated repression is an unresolved topic, and is considered to be controversial (6Roth S.Y. Curr. Opin. Genet. Dev. 1995; 5: 168-173Crossref PubMed Scopus (87) Google Scholar, 14Edmondson D.G. Roth S.Y. FASEB J. 1996; 10: 1173-1182Crossref PubMed Scopus (54) Google Scholar, 16Smith R.L. Johnson A.D. Trends Biochem. Sci. 2000; 25: 325-330Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar). It has even been proposed that Ssn6-Tup1 can positively affect transcription (24Conlan R.S. Gounalaki N. Hatzis P. Tzamarias D. J. Biol. Chem. 1999; 274: 205-210Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). Two generalized models exist for Ssn6-Tup1-mediated repression, one involves its interaction with transcription factors (for review, see Ref. 16Smith R.L. Johnson A.D. Trends Biochem. Sci. 2000; 25: 325-330Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar), and the other its ability to control chromatin structure (6Roth S.Y. Curr. Opin. Genet. Dev. 1995; 5: 168-173Crossref PubMed Scopus (87) Google Scholar,14Edmondson D.G. Roth S.Y. FASEB J. 1996; 10: 1173-1182Crossref PubMed Scopus (54) Google Scholar, 25Ducker C.E. Simpson R.T. EMBO J. 2000; 19: 400-409Crossref PubMed Scopus (71) Google Scholar, 26Watson A.D. Edmondson D.G. Bone J.R. Mukai Y., Yu, Y. Du W. Stillman D.J. Roth S.Y. Genes Dev. 2000; 14: 2737-2744Crossref PubMed Scopus (133) Google Scholar, 27Wu J. Suka N. Carlson M. Grunstein M. Mol. Cell. 2001; 7: 117-126Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar). Studies have shown that the interaction between Ssn6-Tup1 and components of the RNA polymerase II holoenzyme complex is required for repression (28Gromoller A. Lehming N. EMBO J. 2000; 19: 6845-6852Crossref PubMed Scopus (85) Google Scholar, 29Kuchin S. Carlson M. Mol. Cell. Biol. 1998; 18: 1163-1171Crossref PubMed Scopus (111) Google Scholar, 30Papamichos-Chronakis M. Conlan R.S. Gounalaki N. Copf T. Tzamarias D. J. Biol. Chem. 2000; 275: 8397-8403Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar); however, this idea has been challenged recently by others (31Lee M. Chatterjee S. Struhl K. Genetics. 2000; 155: 1535-1542Crossref PubMed Google Scholar). Its interference with transcriptional activators has also been reported (16Smith R.L. Johnson A.D. Trends Biochem. Sci. 2000; 25: 325-330Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar, 32Gavin I.M. Kladde M.P. Simpson R.T. EMBO J. 2000; 19: 5875-5883Crossref PubMed Scopus (26) Google Scholar, 33Komachi K. Redd M.J. Johnson A.D. Genes Dev. 1994; 8: 2857-2867Crossref PubMed Scopus (189) Google Scholar). In regards to controlling chromatin structure, Ssn6-Tup1 has been shown to bind to and recruit histone deacetylases complexes to promoters (26Watson A.D. Edmondson D.G. Bone J.R. Mukai Y., Yu, Y. Du W. Stillman D.J. Roth S.Y. Genes Dev. 2000; 14: 2737-2744Crossref PubMed Scopus (133) Google Scholar, 27Wu J. Suka N. Carlson M. Grunstein M. Mol. Cell. 2001; 7: 117-126Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar,34Bone J.R. Roth S.Y. J. Biol. Chem. 2000; 276: 1808-1813Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar) and to position nucleosomes (6Roth S.Y. Curr. Opin. Genet. Dev. 1995; 5: 168-173Crossref PubMed Scopus (87) Google Scholar, 14Edmondson D.G. Roth S.Y. FASEB J. 1996; 10: 1173-1182Crossref PubMed Scopus (54) Google Scholar, 15Cooper J.P. Roth S.Y. Simpson R.T. Genes Dev. 1994; 8: 1400-1410Crossref PubMed Scopus (166) Google Scholar, 25Ducker C.E. Simpson R.T. EMBO J. 2000; 19: 400-409Crossref PubMed Scopus (71) Google Scholar, 35Simpson R.T. Methods. 1998; 15: 283-294Crossref PubMed Scopus (14) Google Scholar). The role of Ssn6-Tup1 in nucleosome positioning has been examined directly on only a few genes and the recombination enhancer of the mating type loci (15Cooper J.P. Roth S.Y. Simpson R.T. Genes Dev. 1994; 8: 1400-1410Crossref PubMed Scopus (166) Google Scholar,25Ducker C.E. Simpson R.T. EMBO J. 2000; 19: 400-409Crossref PubMed Scopus (71) Google Scholar, 36Gavin I.M. Simpson R.T. EMBO J. 1997; 16: 6263-6271Crossref PubMed Scopus (72) Google Scholar, 37Kastaniotis A.J. Mennella T.A. Konrad C. Torres A.M. Zitomer R.S. Mol. Cell. Biol. 2000; 20: 7088-7098Crossref PubMed Scopus (45) Google Scholar, 38Matallana E. Franco L. Perez-Ortin J.E. Mol. Gen. Genet. 1992; 231: 395-400Crossref PubMed Scopus (51) Google Scholar, 39Patterton H.G. Simpson R.T. Mol. Cell. Biol. 1994; 14: 4002-4010Crossref PubMed Google Scholar, 40Weiss K. Simpson R.T. EMBO J. 1997; 16: 4352-4360Crossref PubMed Scopus (52) Google Scholar, 41Wu L. Winston F. Nucleic Acids Res. 1997; 25: 4230-4234Crossref PubMed Scopus (53) Google Scholar). Moreover, even within this group only three classes of genes have been mapped, namely, mating type-specific genes, an oxygen-regulated gene, and carbon source regulated genes. Each of these classes differ in their requirement for SSN6 versus TUP1 (15Cooper J.P. Roth S.Y. Simpson R.T. Genes Dev. 1994; 8: 1400-1410Crossref PubMed Scopus (166) Google Scholar, 36Gavin I.M. Simpson R.T. EMBO J. 1997; 16: 6263-6271Crossref PubMed Scopus (72) Google Scholar, 37Kastaniotis A.J. Mennella T.A. Konrad C. Torres A.M. Zitomer R.S. Mol. Cell. Biol. 2000; 20: 7088-7098Crossref PubMed Scopus (45) Google Scholar, 40Weiss K. Simpson R.T. EMBO J. 1997; 16: 4352-4360Crossref PubMed Scopus (52) Google Scholar), and thus, it remains to be seen if Ssn6 and Tup1 utilizes any one, or different combinations of, mechanism(s) to repress transcription at different loci. The enzyme ribonucleotide reductase (RNR)1 catalyzes the rate-limiting step in deoxyribonucleotide synthesis; thus, plays an essential role in DNA replication and repair (42Elledge S.J. Zhou Z. Allen J.B. Trends Biochem. Sci. 1992; 17: 119-123Abstract Full Text PDF PubMed Scopus (259) Google Scholar, 43Elledge S.J. Zhou Z. Allen J.B. Navas T.A. Bioessays. 1993; 15: 333-339Crossref PubMed Scopus (210) Google Scholar). InSaccharomyces cerevisiae it is composed of four subunits, which are encoded by four DNA damage-regulated genes (RNR1, RNR2, RNR3, and RNR4) (42Elledge S.J. Zhou Z. Allen J.B. Trends Biochem. Sci. 1992; 17: 119-123Abstract Full Text PDF PubMed Scopus (259) Google Scholar, 43Elledge S.J. Zhou Z. Allen J.B. Navas T.A. Bioessays. 1993; 15: 333-339Crossref PubMed Scopus (210) Google Scholar, 44Huang M. Elledge S.J. Mol. Cell. Biol. 1997; 17: 6105-6113Crossref PubMed Scopus (159) Google Scholar). Activation of the RNR genes in response to replication arrest and DNA damage requires signals relayed through the DNA damage checkpoint pathway (42Elledge S.J. Zhou Z. Allen J.B. Trends Biochem. Sci. 1992; 17: 119-123Abstract Full Text PDF PubMed Scopus (259) Google Scholar, 43Elledge S.J. Zhou Z. Allen J.B. Navas T.A. Bioessays. 1993; 15: 333-339Crossref PubMed Scopus (210) Google Scholar, 45Kiser G.L. Weinert T.A. Mol. Biol. Cell. 1996; 7: 703-718Crossref PubMed Scopus (77) Google Scholar, 46Longhese M.P. Foiani M. Muzi-Falconi M. Lucchini G. Plevani P. EMBO J. 1998; 17: 5525-5528Crossref PubMed Scopus (142) Google Scholar). In addition to the DNA damage checkpoint kinase pathway, specific general transcription factor TFIID subunits, TAFIIs, (47Li B. Reese J.C. EMBO J. 2000; 19: 4091-4100Crossref PubMed Scopus (28) Google Scholar, 48Reese J.C. Zhang Z. Kurpad H. J. Biol. Chem. 2000; 275: 17391-17398Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar), SBF factor, and the Hrr25 kinase (49Ho U. Mason S. Kobayashi R. Hoekstra M. Andrews B. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 581-586Crossref PubMed Scopus (91) Google Scholar) are required for RNR gene expression. The RNR genes are repressed by upstream repression sequences (URS), thedamage responsive elements (DREs) or x-boxes, which serve as binding sites for the sequence-specific DNA-binding protein Crt1p (50Huang M. Zhou Z. Elledge S.J. Cell. 1998; 94: 595-605Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar). The N terminus of Crt1 recruits the general co-repressor complex composed of Ssn6 and Tup1 (47Li B. Reese J.C. EMBO J. 2000; 19: 4091-4100Crossref PubMed Scopus (28) Google Scholar, 50Huang M. Zhou Z. Elledge S.J. Cell. 1998; 94: 595-605Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar) repressing gene expression. The exact role of Ssn6-Tup1, and the contributions of Crt1, in mediating repression of RNR3 is not known. Activation of DNA damage checkpoints results in the phosphorylation of Crt1, reducing its ability to cross-link to the promoter region of RNR3 (50Huang M. Zhou Z. Elledge S.J. Cell. 1998; 94: 595-605Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar). How the phosphorylation of Crt1 reduces its association with the promoter is unclear. Here we describe a comprehensive analysis of the nucleosomal structure of the RNR3 promoter in the repressed and derepressed state. A combination of high-resolution and low-resolution micrococcal nuclease (MNase) and DNase I sensitivity mapping studies clearly demonstrate that in the absence of DNA damage, an array of positioned nucleosomes covers the promoter and extends into the coding sequence. Upon DNA damage, the nucleosome structure at the promoter undergoes extensive remodeling, which is dependent on the checkpoint genesMEC1 and RAD53. DNase I and MNase footprinting revealed changes in nuclease sensitivity within the URS that correlated with the expression of RNR3. Interestingly, we find that the chromatin/DNA structure within the URS is dependent upon Crt1, Ssn6, and Tup1, indicating that Crt1 alone is insufficient for its formation. Our analysis has established that nucleosome positioning and remodeling regulates DNA damage inducible genes, and that the predominant function of Crt1 is to position nucleosomes over the promoter via the Ssn6-Tup1 corepressor complex. The wild type (YSW87), Δcrt1 (YJR352), Δssn6 (YJR221), and Δtup1 (YJR220) strains (47Li B. Reese J.C. EMBO J. 2000; 19: 4091-4100Crossref PubMed Scopus (28) Google Scholar), the mec1-1 andrad53-11 strains (51Sidorova J.M. Breeden L.L. Genes Dev. 1997; 11: 3032-3045Crossref PubMed Scopus (129) Google Scholar), and Y588 (50Huang M. Zhou Z. Elledge S.J. Cell. 1998; 94: 595-605Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar) were described in previous publications. The Δssn6/CRT1-MYC12 strain (YJR485) was constructed by transforming Y588 withAvrII-digested pRS406-ssn6 (15Cooper J.P. Roth S.Y. Simpson R.T. Genes Dev. 1994; 8: 1400-1410Crossref PubMed Scopus (166) Google Scholar). Strains were grown in rich YP media plus 2% dextrose (52Guthrie C. Fink G.R. Guide to Yeast Genetics and Molecular Biology. Academic Press, New York1991Google Scholar) at 30 °C to an OD of ∼0.8–1.0. Methyl methanesulfonate (MMS), obtained from Sigma, was added to the cultures from a freshly prepared 10% stock. Nuclei preparation was carried out essentially as describe in Refs. 40Weiss K. Simpson R.T. EMBO J. 1997; 16: 4352-4360Crossref PubMed Scopus (52) Google Scholar and 53Ryan M.P. Stafford G.A., Yu, L. Cummings K.B. Morse R.H. Methods Enzymol. 1999; 304: 376-399Crossref PubMed Scopus (17) Google Scholar. Briefly, yeast cells from a 1-liter culture grown to an optical density of about 1.0 at 600 nm was harvested and digested with Zymolyase T100 (Seikagaku). Nuclei were purified by differential centrifugation and finally resuspended in digestion buffer (10 mm HEPES, pH 7.5, 0.5 mmMgCl2, 0.05 mm CaCl2) and incubated with 0, 2, and 4 units/ml MNase (Worthington) or 0, 0.05, and 0.1 units/ml DNase I (Worthington) for 10 min at 37 °C. The digestions were terminated by the addition of EDTA and the DNA was purified by RNase A and proteinase K digestion and phenol/chloroform extraction. The DNA pellet was resuspended in 0.1 × TE buffer. For low-resolution mapping of nucleosomes by indirect end labeling, the purified DNA was subjected to a secondary digestion by PstI, then electrophoresed in 1.4% agarose gels in 1 × Tris borate-EDTA buffer, and transferred to Zetabind membrane (CUNO industries). The specific DNA sequences were detected by hybridized with a random primed body-labeled probe directed toward the end of thePstI site. The following primer sets were used to amplify the probes: PstI (+468) 5′-GCTAAGACTGAACGGTGAAGTGGCAG,PstI (+725) 5′-GGAAATCATAGCACATTCTTTCAAAGTATC;EcoRV (+57) 5′-CTCCCGTATCACCCGTTTGTC, EcoRV (+540) 5′-CATGGATACCTAGCGCCACACGCATTAC. For high-resolution mapping, multiple rounds of Taq DNA polymerase-based primer extension was carried out from a 32P-end-labeled primer, and the products were then resolved on a 6% polyacrylamide (19:1), 50% urea gel (40Weiss K. Simpson R.T. EMBO J. 1997; 16: 4352-4360Crossref PubMed Scopus (52) Google Scholar). Images were captured on a PhosphorImager screen. The primers used to perform the primer extension reaction are as follows: RNR3+150 downstream, 5′- CTAAACCGTATGACAAACGGGTGATACGGGAGGT; RNR3–324 upstream, 5′-CGTGGTTGTCGCAGCAACGACACCTAGG; RNR3–586 upstream, 5′-GGCGCTGTGGCCGTGG- CTAGTTTCTTCT. Nuclei were isolated as for the MNase and DNase I mapping studies and resuspended in RE digestion buffer (10 mmTris-HCl, pH 7.4, 50 mm NaCl, 10 mmMgCl2, 0.5 mm spermidine, 0.15 mmspermine, 0.2 mm EDTA, 0.2 mm EGTA, 5 mm β-mercaptoethanol) (54Gregory P.D. Horz W. Methods Enzymol. 1999; 304: 365-376Crossref PubMed Scopus (22) Google Scholar, 55Gregory P.D. Barbaric S. Horz W. Methods Mol. Biol. 1999; 119: 417-425PubMed Google Scholar). MluI orNcoI (New England Biolabs) was added to concentrations of 100 and 400 units/ml, and the digestion was allowed to proceed for 60 min at 37 °C. After purification, the DNA was digested withPstI (MluI-digested samples) or EcoRV (NcoI-digested samples) to completion. The products were resolved on agarose gels and detected by Southern blotting using the indirect end-labeling method. The PstI- andEcoRV-digested samples were hybridized to PCR-generated probes corresponding to the regions of +486 to +725 (PstI probe) and +57 to +540 (EcoRV probe) of RNR3, respectively. Blots were exposed to a PhosphorImager screen (Molecular Dynamics). Data was expressed as percent digested that was calculated by the ratio of the counts in the digested fragment to the total DNA. The chromatin immunoprecipitation assay was performed essentially as described in two previous publications (50Huang M. Zhou Z. Elledge S.J. Cell. 1998; 94: 595-605Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar, 56Hecht A. Grunstein M. Methods Enzymol. 1999; 304: 399-414Crossref PubMed Scopus (151) Google Scholar). Cultures were treated for 2.5 h with 0.03% MMS prior to cross-linking, where indicated. Briefly, a 200-ml culture of yeast grown in YPAD to an A600= 1.0 were treated with formaldehyde (1% v/v) for 15 min at 23 °C, followed by an additional 5 min in 125 mm glycine. Cells were then disrupted by vortexing in the presence of glass beads, and the lysate was sonicated to generate an average DNA size of about 0.4–0.9 kilobases. Immunoprecipitations were performed using 1 μl of raw ascites fluid (Convance) to 400 μl of lysate. Following an overnight incubation at 4 °C with 40 μl of Protein A-Sepharose beads, the beads were washed extensively, and the DNA eluted (56Hecht A. Grunstein M. Methods Enzymol. 1999; 304: 399-414Crossref PubMed Scopus (151) Google Scholar). Following reversal of the formaldehyde-induced cross-links, 1/300 to 1/12000 of input DNA and 0.2 to 2% of immunoprecipitated DNAs were analyzed by semiquantitative PCR analysis with promoter-specific primers spanning the URS of each gene. Only one titration of immunoprecipitated DNA and two titrations of input DNA are shown in the figure to conserve space. The PCR products were detected by illumination of ethidium bromide-stained 2% agarose gels. To understand the contributions of chromatin structure in the transcriptional regulation of RNR3, we analyzed the nucleosomal architecture over its promoter. The first of these experiments utilized MNase to digest nuclei in situ, followed by the detection of the digestion products by indirect end labeling (53Ryan M.P. Stafford G.A., Yu, L. Cummings K.B. Morse R.H. Methods Enzymol. 1999; 304: 376-399Crossref PubMed Scopus (17) Google Scholar). Given that MNase displays sequence preference in the digestion of DNA, naked DNA was digested (deproteined genomic DNA) and analyzed in parallel. The digestion pattern generated from chromatin isolated from untreated cells (−MMS) is consistent with the presence of a well ordered nucleosomal array positioned over the RNR3promoter that extends into the protein coding region (Fig.1 A, lanes 3 and 4). The hallmark of a translationally positioned nucleosomal unit is a 140–150-base pair region that is protected from MNase digestion, compared with naked DNA, flanked by nuclease-hypersensitive sites; such a pattern is clearly seen. In particular, a nucleosome (−1) was detected over the TATA box that protects it from MNase digestion, compared with naked DNA (compare lanes 3 and 4with lanes 8 and 9). The data also shows that the major transcription start site (+1) is located within the internucleosomal linker region. It is noted that within the URS region (DREs), a hypersensitive site was observed in the chromatin sample that was not present in the naked DNA digestion reaction (arrowhead, lane 3). This site is likely to be caused by transcription factor binding to the promoter since the spacing between it and the hypersensitive site generated by nucleosome −1 is not consistent with a nucleosomal pattern (also see below). It is well recognized that the expression of most genes is accompanied by changes in chromatin structure (5Kingston R.E. Bunker C.A. Imbalzano A.N. Genes Dev. 1996; 10: 905-920Crossref PubMed Scopus (404) Google Scholar, 12Mizzen C.A. Allis C.D. Cell Mol. Life Sci. 1998; 54: 6-20Crossref PubMed Scopus (191) Google Scholar, 57Svaren J. Horz W. Trends Biochem. Sci. 1997; 22: 93-97Abstract Full Text PDF PubMed Scopus (157) Google Scholar); therefore, we monitored the changes in nucleosome positioning upon the derepression ofRNR3. The transcription of RNR3 can be stimulated to a high level by inducing DNA damage using MMS or the replication inhibitor hydroxyurea (42Elledge S.J. Zhou Z. Allen J.B. Trends Biochem. Sci. 1992; 17: 119-123Abstract Full Text PDF PubMed Scopus (259) Google Scholar, 43Elledge S.J. Zhou Z. Allen J.B. Navas T.A. Bioessays. 1993; 15: 333-339Crossref PubMed Scopus (210) Google Scholar). Cells were treated with MMS to a final concentration of 0.02% MMS for 2.5 h, and were then processed for nuclease mapping. A representative Northern blot is shown in Fig.1 C. The pattern of MNase-digested chromatin from MMS-treated cells is nearly identical to that of digested naked DNA (comparelanes 6 and 7 to lanes 8 and9), indicating a disruption of the nucleosomal array. Specifically, the regions protected from digestion are fully accessible (filled circles), most notably the region over nucleosome −1 containing the TATA box. In addition, the intensity of the hypersensitive sites flanking each nucleosome is reduced. Activation ofRNR3 also correlates with changes in the digestion pattern over the URS. The MNase-hypersensitive site located within the nucleosome-free URS region (indicated by the arrow inlane 3 of Fig. 1 A) is lost upon gene activation, which is consistent with the predicted changes in Crt1 binding to the DREs (50Huang M. Zhou Z. Elledge S.J. Cell. 1998; 94: 595-605Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar). Additional mapping studies were performed using DNase I, which does not display the same sequence bias of micrococcal nuclease (35Simpson R.T. Methods. 1998; 15: 283-294Crossref PubMed Scopus (14) Google Scholar, 53Ryan M.P. Stafford G.A., Yu, L. Cummings K.B. Morse R.H. Methods Enzymol. 1999; 304: 376-399Crossref PubMed Scopus (17) Google Scholar). Thus, DNase I can reveal changes in chromatin structure not detected by MNase mapping. Since DNase I is capable of digesting within chromosomal DNA at 10-base pair intervals due to the rotational phasing of DNA on the nucleosome, concentrations were chosen that result in the preferential digestion within the linker regions to allow for the detection of nucleosome positioning. In agreement with the MNase mapping data described above, the pattern generated from DNase I-digested chromatin from untreated cells is consistent with the presence of an ordered nucleosomal array (Fig. 1 B, lanes 3 and 4). Therefore, the pattern generated by MNase digestion is indicative of a nucleosomal array and is not an artifact of the sequence preference of this enzyme. An intense DNase I-hypersensitive site is detected between the edge of nucleosome −1 and the first DRE. Also consistent with the MNase mapping, treating cells with MMS results in a randomized digestion pattern in the region encompassing the TATA box and the coding sequences (Fig. 1 B, lanes 6 and 7), indicating extensive nucleosome remodeli" @default.
• W1987094458 created "2016-06-24" @default.
• W1987094458 creator A5040793693 @default.
• W1987094458 creator A5083581319 @default.
• W1987094458 date "2001-09-01" @default.
• W1987094458 modified "2023-09-30" @default.
• W1987094458 title "Ssn6-Tup1 Regulates RNR3 by Positioning Nucleosomes and Affecting the Chromatin Structure at the Upstream Repression Sequence" @default.
• W1987094458 cites W146104672 @default.
• W1987094458 cites W1495746426 @default.
• W1987094458 cites W1502616762 @default.
• W1987094458 cites W1511815964 @default.
• W1987094458 cites W1520448866 @default.
• W1987094458 cites W1520588455 @default.
• W1987094458 cites W1528845830 @default.
• W1987094458 cites W1529844709 @default.
• W1987094458 cites W1564217760 @default.
• W1987094458 cites W1575063338 @default.
• W1987094458 cites W1593303365 @default.
• W1987094458 cites W1607717188 @default.
• W1987094458 cites W1652729057 @default.
• W1987094458 cites W1819499229 @default.
• W1987094458 cites W1832152442 @default.
• W1987094458 cites W1952865218 @default.
• W1987094458 cites W1965429549 @default.
• W1987094458 cites W1965606905 @default.
• W1987094458 cites W1974425687 @default.
• W1987094458 cites W1975620486 @default.
• W1987094458 cites W1980245347 @default.
• W1987094458 cites W1985574339 @default.
• W1987094458 cites W1989315368 @default.
• W1987094458 cites W1994776850 @default.
• W1987094458 cites W1999162249 @default.
• W1987094458 cites W2004702466 @default.
• W1987094458 cites W2006998897 @default.
• W1987094458 cites W2008435997 @default.
• W1987094458 cites W2009300510 @default.
• W1987094458 cites W2017324033 @default.
• W1987094458 cites W2022630003 @default.
• W1987094458 cites W2023594830 @default.
• W1987094458 cites W2026368142 @default.
• W1987094458 cites W2029235165 @default.
• W1987094458 cites W2031073942 @default.
• W1987094458 cites W2035209826 @default.
• W1987094458 cites W2043789254 @default.
• W1987094458 cites W2046690162 @default.
• W1987094458 cites W2051778831 @default.
• W1987094458 cites W2052508230 @default.
• W1987094458 cites W2057319400 @default.
• W1987094458 cites W2059528721 @default.
• W1987094458 cites W2064680930 @default.
• W1987094458 cites W2068584925 @default.
• W1987094458 cites W2069783241 @default.
• W1987094458 cites W2071037207 @default.
• W1987094458 cites W2072839034 @default.
• W1987094458 cites W2079524506 @default.
• W1987094458 cites W2080431573 @default.
• W1987094458 cites W2082576942 @default.
• W1987094458 cites W2082941148 @default.
• W1987094458 cites W2087181226 @default.
• W1987094458 cites W2096580557 @default.
• W1987094458 cites W2104218232 @default.
• W1987094458 cites W2104301808 @default.
• W1987094458 cites W2116501133 @default.
• W1987094458 cites W2120226297 @default.
• W1987094458 cites W2126537212 @default.
• W1987094458 cites W2130543190 @default.
• W1987094458 cites W2132440338 @default.
• W1987094458 cites W2135563174 @default.
• W1987094458 cites W2146323074 @default.
• W1987094458 cites W2146602307 @default.
• W1987094458 cites W2147808841 @default.
• W1987094458 cites W2151278496 @default.
• W1987094458 cites W2151598640 @default.
• W1987094458 cites W2153928500 @default.
• W1987094458 doi "https://doi.org/10.1074/jbc.m104220200" @default.
• W1987094458 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11448965" @default.
• W1987094458 hasPublicationYear "2001" @default.
• W1987094458 type Work @default.
• W1987094458 sameAs 1987094458 @default.
• W1987094458 citedByCount "75" @default.
• W1987094458 countsByYear W19870944582012 @default.
• W1987094458 countsByYear W19870944582013 @default.
• W1987094458 countsByYear W19870944582014 @default.
• W1987094458 countsByYear W19870944582015 @default.
• W1987094458 countsByYear W19870944582017 @default.
• W1987094458 countsByYear W19870944582018 @default.
• W1987094458 countsByYear W19870944582020 @default.
• W1987094458 countsByYear W19870944582021 @default.
• W1987094458 countsByYear W19870944582022 @default.
• W1987094458 countsByYear W19870944582023 @default.
• W1987094458 crossrefType "journal-article" @default.
• W1987094458 hasAuthorship W1987094458A5040793693 @default.
• W1987094458 hasAuthorship W1987094458A5083581319 @default.
• W1987094458 hasBestOaLocation W19870944581 @default.
• W1987094458 hasConcept C104317684 @default.
• W1987094458 hasConcept C150194340 @default.
• W1987094458 hasConcept C185592680 @default.
• W1987094458 hasConcept C186310378 @default.

• next