FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1987183604> ?p ?o ?g. }

• W1987183604 endingPage "4132" @default.
• W1987183604 startingPage "4124" @default.
• W1987183604 abstract "The promoter element G1, critical for α-cell-specific expression of the glucagon gene, contains two AT-rich sequences important for transcriptional activity. Pax-6, a paired homeodomain protein previously shown to be required for normal α-cell development and to interact with the enhancer element G3 of the glucagon gene, binds as a monomer to the distal AT-rich site of G1. However, although the paired domain of Pax-6 is sufficient for interaction with the G3 element, the paired domain and the homeodomain are required for high affinity binding to G1. In addition to monomer formation, Pax-6 interacts with Cdx-2/3, a caudal-related homeodomain protein binding to the proximal AT-rich site, to form a heterodimer on G1. Both proteins are capable of directly interacting in the absence of DNA. In BHK-21 cells, Pax-6 activates glucagon gene transcription both through G3 and G1, and heterodimerization with Cdx-2/3 on G1 leads to more than additive transcriptional activation. In glucagon-producing cells, both G1 and G3 are critical for basal transcription, and the Pax-6 and Cdx-2/3 binding sites are required for activation. We conclude that Pax-6 is not only critical for α-cell development but also for glucagon gene transcription by its independent interaction with the two DNA control elements, G1 and G3. The promoter element G1, critical for α-cell-specific expression of the glucagon gene, contains two AT-rich sequences important for transcriptional activity. Pax-6, a paired homeodomain protein previously shown to be required for normal α-cell development and to interact with the enhancer element G3 of the glucagon gene, binds as a monomer to the distal AT-rich site of G1. However, although the paired domain of Pax-6 is sufficient for interaction with the G3 element, the paired domain and the homeodomain are required for high affinity binding to G1. In addition to monomer formation, Pax-6 interacts with Cdx-2/3, a caudal-related homeodomain protein binding to the proximal AT-rich site, to form a heterodimer on G1. Both proteins are capable of directly interacting in the absence of DNA. In BHK-21 cells, Pax-6 activates glucagon gene transcription both through G3 and G1, and heterodimerization with Cdx-2/3 on G1 leads to more than additive transcriptional activation. In glucagon-producing cells, both G1 and G3 are critical for basal transcription, and the Pax-6 and Cdx-2/3 binding sites are required for activation. We conclude that Pax-6 is not only critical for α-cell development but also for glucagon gene transcription by its independent interaction with the two DNA control elements, G1 and G3. The glucagon gene is expressed in the α-cells of the pancreatic islets, the L cells of the intestine, and specific areas of the brain (1Philippe J. Endocrinol. Rev. 1991; 12: 252-271Crossref PubMed Scopus (71) Google Scholar). The factors controlling glucagon gene expression are still poorly understood. Pancreas-specific expression of the glucagon gene is conferred by the islet-specific enhancer elements G2, G3, and G4 (2Philippe J. Drucker D.J. Knepel W. Jepeal L. Misulovin Z. Habener J.F. Mol. Cell. Biol. 1988; 8: 4877-4888Crossref PubMed Scopus (115) Google Scholar, 3Philippe J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 7224-7227Crossref PubMed Scopus (98) Google Scholar, 4Cordier-Bussat M. Morel C. Philippe J. Mol. Cell. Biol. 1995; 15: 3904-3916Crossref PubMed Scopus (31) Google Scholar, 5Philippe J. Morel C. Cordier-Bussat M. J. Biol. Chem. 1995; 270: 3039-3045Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar), and the α-cell-specific proximal promoter element G1 (2Philippe J. Drucker D.J. Knepel W. Jepeal L. Misulovin Z. Habener J.F. Mol. Cell. Biol. 1988; 8: 4877-4888Crossref PubMed Scopus (115) Google Scholar, 3Philippe J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 7224-7227Crossref PubMed Scopus (98) Google Scholar, 5Philippe J. Morel C. Cordier-Bussat M. J. Biol. Chem. 1995; 270: 3039-3045Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar, 6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar, 7Laser B. Meda P. Constant I. Philippe J. J. Biol. Chem. 1996; 271: 28984-28994Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). G1contains two nearly identical 7-bp 1The abbreviations used are: bp, base pair(s); CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility shift assay; GST, glutathione S-transferase.1The abbreviations used are: bp, base pair(s); CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility shift assay; GST, glutathione S-transferase. AT-rich sequences forming a direct repeat that are candidate binding sites for homeodomain transcription factors. At least three protein complexes (B1, B2, and B3) interact with G1, and the integrity of the AT-rich direct repeat is critical for their binding and for transcriptional activity (2Philippe J. Drucker D.J. Knepel W. Jepeal L. Misulovin Z. Habener J.F. Mol. Cell. Biol. 1988; 8: 4877-4888Crossref PubMed Scopus (115) Google Scholar, 6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar, 7Laser B. Meda P. Constant I. Philippe J. J. Biol. Chem. 1996; 271: 28984-28994Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). We and others have recently characterized the transcription factor that binds to the proximal 7-bp site as Cdx-2/3, which is encoded by acaudal-related gene expressed in the endocrine pancreas and the intestine (7Laser B. Meda P. Constant I. Philippe J. J. Biol. Chem. 1996; 271: 28984-28994Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 8Jin T. Drucker D.J. Mol. Cell. Biol. 1996; 16: 19-28Crossref PubMed Scopus (113) Google Scholar). Cdx-2/3 is able to bind with high affinity to the 7-bp proximal AT-rich site of G1 when isolated but binds intact G1 in glucagon-producing cells preferentially as a multiprotein complex, B3 (6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar, 7Laser B. Meda P. Constant I. Philippe J. J. Biol. Chem. 1996; 271: 28984-28994Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar), when both AT-rich sites are present. We report here that the factor that interacts with Cdx-2/3 to form the B3 complex is Pax-6, a member of the pax family of vertebrate genes that contain conserved paired and homeo boxes encoding DNA-binding domains (9Ton C.C.T. Hirvonen H. Miwa H. Weil M.M. Monaghan P. Jordan T. Van Heyningen V. Hastie N.D. Meijers-Heijboer H. Drechsler M. Royer-Pokora B. Collins F. Swaroop A. Strong L.C. Saunders G.F. Cell. 1991; 67: 1059-1074Abstract Full Text PDF PubMed Scopus (738) Google Scholar). Pax-6 has previously been reported to be expressed in the endocrine pancreas (10Turque N. Plaza S. Radvani F. Carrière C. Saule S. Mol. Endocrinol. 1994; 8: 929-938Crossref PubMed Scopus (111) Google Scholar), to be critical for α-cell development (11St-Onge L. Sosa-Pineda B. Chowdhury K. Mansouri A. Gruss P. Nature. 1997; 387: 406-409Crossref PubMed Scopus (651) Google Scholar, 12Sander M. Neubüser A. Kalamaras J. Ee H.C. Martin G.R. German M.S. Genes Dev. 1997; 11: 1662-1673Crossref PubMed Scopus (452) Google Scholar), and to bind to the enhancer element G3 of the glucagon gene (11St-Onge L. Sosa-Pineda B. Chowdhury K. Mansouri A. Gruss P. Nature. 1997; 387: 406-409Crossref PubMed Scopus (651) Google Scholar). Our results indicate that the paired domain of Pax-6 is sufficient for interaction with the G3 element, whereas both paired domain and homeodomain are important for interaction with the G1 element. Furthermore, Pax-6 binds to the promoter element G1 preferentially as a monomer but also as a heterodimer with Cdx-2/3. When both Pax-6 and Cdx-2/3 are overexpressed in BHK-21 cells, we observe more than additive effects on transcriptional activation of glucagon gene expression, suggesting that Pax-6-Cdx-2/3 interactions have functional consequences on transcription. We conclude that Pax-6 not only is a key regulator of α-cell development but is also critical for glucagon gene expression through its independent interaction with the promoter and enhancer elements, G1 and G3, respectively. The glucagon-producing hamster InRIG9 (13Takaki R. Ono J. Nakmura M. Yokogama M. Kumae S. Hiraoka T. Yamaguchi K. Hamaguchi K. Uchida S. In Vitro Cell. Dev. Biol. 1986; 22: 120-126Crossref PubMed Scopus (81) Google Scholar) and the non-islet Syrian baby hamster kidney (BHK-21) cell lines were grown in RPMI 1640 (Seromed, Basel, Switzerland) supplemented with 5% heat-inactivated fetal calf serum and 5% heat-inactivated newborn calf serum, 2 mmglutamine, 100 units/ml of penicillin, and 100 μg/ml of streptomycin. InR1G9 cells were generously provided by Dr. R. Takaki (Medical College of Oita, Oita, Japan). BHK-21 cells were transfected by the calcium phosphate precipitation technique (14Graham F.L. van des Erb A.J. Virology. 1973; 52: 456-467Crossref PubMed Scopus (6463) Google Scholar) using 10–12 μg of total plasmid DNA/10-cm Petri dish. 1 μg of pSV2A pap, a plasmid containing the human placental alkaline phosphatase gene, driven by the SV40 long terminal repeat was added to monitor transfection efficiency (15Henthorn P. Zervos P. Raducha M. Harris H. Kadesh T. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 6342-6346Crossref PubMed Scopus (133) Google Scholar). Transfection of glucagon-producing InR1G9 cells was done using the DEAE-dextran method as described previously (16Drucker D.J. Philippe J. Jepeal L. Habener J.F. J. Biol. Chem. 1987; 262: 15659-15665Abstract Full Text PDF PubMed Google Scholar). Expression vectors consisted of the hamster Cdx-2/3 cDNA, kindly provided by Dr. M. German (University of California, San Francisco, CA), and the quail pax-6 cDNA (17Carrière C. Plaza S. Martin P. Quatannens B. Bailly M. Stehelin D. Saule S. Mol. Cell. Biol. 1993; 13: 7257-7266Crossref PubMed Scopus (112) Google Scholar), both cloned in pSG5 (Stratagene). Reporter plasmids consisted of 1) wild-type and mutated (at nucleotides −90/−91 or −71/−72) 408-bp fragments (nucleotides −350 to +58) (−350 CAT, G1M1-350 CAT, and G1M11-350 CAT, respectively); 2) a 196-bp fragment (nucleotides −138 to +58) linked to oligonucleotides containing the wild-type or mutated (nucleotides −254 to −258) G3 sequence (nucleotides −274 to −234 relative to the transcriptional start site) (G3–138 CAT and G3M6–138 CAT); 3) a 128-bp fragment (nucleotides −75 to + 58) of the 5′-flanking sequence of the rat glucagon gene linked to the wild-type oligonucleotide G3 (G3–75 CAT) (Refs. 2Philippe J. Drucker D.J. Knepel W. Jepeal L. Misulovin Z. Habener J.F. Mol. Cell. Biol. 1988; 8: 4877-4888Crossref PubMed Scopus (115) Google Scholar, 5Philippe J. Morel C. Cordier-Bussat M. J. Biol. Chem. 1995; 270: 3039-3045Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar, and 6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar; see Fig. 1). These fragments were subcloned into pBLCAT3 (6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). RSVCAT (18Prost E. Moore D.D. Gene (Amst.). 1986; 45: 107-111Crossref PubMed Scopus (117) Google Scholar) served as positive control. Cell extracts were prepared 36–48 h after transfection and analyzed for CAT and alkaline phosphatase activities as described previously (6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). Quantification of acetylated and nonacetylated forms was done with a PhosphorImager (Molecular Dynamics). A minimum of three independent transfections were performed, each of them carried out in duplicate. Protein concentrations were determined with a Bio-Rad protein assay kit. EMSAs were performed as described previously (12Sander M. Neubüser A. Kalamaras J. Ee H.C. Martin G.R. German M.S. Genes Dev. 1997; 11: 1662-1673Crossref PubMed Scopus (452) Google Scholar) using nuclear extracts prepared according to Schreiber et al. (19Schreiber E. Mathias P. Muller M.M. Schaffner W. EMBO J. 1988; 7: 4221-4229Crossref PubMed Scopus (193) Google Scholar) or 0.1 μg of GST fusion proteins. Oligonucleotides containing the wild-type or mutated G1 (G1–56, G1–33, G1–33r3, and G1–33r5; see Fig. 1) or G3 (G3; see Fig. 1) sequences have previously been described (5Philippe J. Morel C. Cordier-Bussat M. J. Biol. Chem. 1995; 270: 3039-3045Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar, 6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). Anti-Cdx-2/3 and anti-Isl-l antibodies were generously provided by Drs. M. German (University of California) and D. Drucker (Toronto University, Toronto, ON, Canada), respectively; anti-Pax-6 antibodies were raised against the paired domain or the homeodomain of the quail protein (serum 11 and 13, respectively, in Ref. 17Carrière C. Plaza S. Martin P. Quatannens B. Bailly M. Stehelin D. Saule S. Mol. Cell. Biol. 1993; 13: 7257-7266Crossref PubMed Scopus (112) Google Scholar). For construction of GST fusion proteins, pax-6paired, homeo, and paired linker homeo boxes were generated from InR1G9 cells by reverse transcription-polymerase chain reaction using the primers Pax-6 PD5′, actggatcc-cagcttggtggtgtctttg; Pax-6 PD3′, actaagcttgctagccaggttgcgaagaac; Pax-6 HD5′, actggatccggctgccagcaacaggaag; and Pax-6 HD3′, actaagcttgtgttgctggcctgtcttc and inserted into theBamHI/HindIII sites of pGEX-4T3 (Amersham Pharmacia Biotech). GST fusion proteins were expressed inEscherichia coli and purified according to the manufacturers' recommendations.l-[35S]Methionine-labeled Cdx-2/3 was generated in vitro using the TNT wheat germ extract system (Promega). For protein-protein interaction, 10 μg of GST or GST fusion proteins were bound to 25 μl of glutathione-Sepharose beads in a total volume of 50 μl of incubation buffer containing 12 mm Hepes, pH 7.9, 4 mm Tris/HCl, pH 7.9, 50 mm NaCl, 10 mm KCl, 1 mm EDTA, 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride for 20 min at room temperature. Beads were washed three times, resuspended in 20 μl of incubation buffer, and incubated with 10 μl of l-[35S]methionine-labeled Cdx-2/3 for 40 min on ice. Beads were then washed five times at room temperature with 200 μl of washing buffer (20 mm Tris/HCl, pH 8, 100 mm NaCl, 1 mm EDTA, 0.5% Nonidet P-40), recovered in SDS-polyacrylamide gel electrophoresis loading buffer, and bound proteins were analyzed by SDS-polyacrylamide gel electrophoresis followed by autoradiography. We previously reported that G1 is a large, 50-bp-long proximal upstream promoter element critical for α-cell-specific expression that binds at least three protein complexes, B1, B2, and B3 (Ref. 6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar and Fig.1). The more distal enhancer element G3 can be separated into an A and a B domain; G3 binds four complexes, C1A and C1B (A domain), which are islet-specific, and C2 and C3 (B domain), representing ubiquitous proteins (Refs. 5Philippe J. Morel C. Cordier-Bussat M. J. Biol. Chem. 1995; 270: 3039-3045Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar and 20Knepel W. Jepeal J.L. Habener J.F. J. Biol. Chem. 1990; 265: 8725-8735Abstract Full Text PDF PubMed Google Scholar and Fig. 1). From our previous studies, we concluded that the protein complexes B1 and C1A interacting with the G1and G3 elements, respectively, were similar or identical inasmuch as they displayed closely related binding affinities for both G1 and G3 and migration characteristics in EMSAs (5Philippe J. Morel C. Cordier-Bussat M. J. Biol. Chem. 1995; 270: 3039-3045Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar, 6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). Recently, Sander et al. (12Sander M. Neubüser A. Kalamaras J. Ee H.C. Martin G.R. German M.S. Genes Dev. 1997; 11: 1662-1673Crossref PubMed Scopus (452) Google Scholar) provided evidence that the paired homeodomain transcription factor Pax-6 interacts with the A domain of G3 and is critical for α-cell development. We thus investigated the nature of C1A and C1B and their relationship with B1. We first performed EMSAs with nuclear extracts from the glucagon-producing hamster cell line InRlG9 and 32P-labeled oligonucleotides containing either G1 (G1–56) or G3 (G3). As shown in Fig. 2 A, three specific complexes are detected with G1–56, B1, B2, and B3; additional complexes are also observed (indicated by asterisks) but have been shown previously to be nonspecific (6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). Two major complexes interact with the G3 oligonucleotide, C1A and C1B(Fig. 2 B); the ubiquitous complexes C2 and C3 are of lower intensity and visible only on longer expositions (5Philippe J. Morel C. Cordier-Bussat M. J. Biol. Chem. 1995; 270: 3039-3045Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar). To more precisely define the relationship between the complexes that bind G1 and G3, we added as competitor cold oligonucleotides containing different portions of the wild-type or mutated element G1 or the wild-type element G3. Like G1–56, G1–33 representing the AT-rich repeat of G1 competed for complexes B1, B2, and B3 formed on G1–56 (Fig. 2 A). Mutant G1–33r5 characterized by a mutation of the 5′ AT-rich site of G1 only competed for B3, whereas the 3′ AT-rich site mutant (G1–33r3) displayed the same competition characteristics as G1–33. Furthermore, oligonucleotide G1–54 containing the 5′ AT-rich site of G1 competed for complexes B2and B3. These results indicate that B1 and B2 interact on overlapping sites within the distal part of G1–33 as previously reported (Ref. 6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar and Fig. 1); however, B2 may interact on a more restricted site compared with B1 inasmuch as G1–54 efficiently competes for B2 but not for B1. Formation of B3, in contrast, involves both the distal and proximal parts of the core element oligonucleotide G1–33. Of note, oligonucleotide G3 competes for both B1 and B3 (Ref. 5Philippe J. Morel C. Cordier-Bussat M. J. Biol. Chem. 1995; 270: 3039-3045Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar and Fig.2 A). We then applied the same competitor oligonucleotides as in Fig. 2 A on the complexes formed with InR1G9 nuclear extracts and the 32P-labeled oligonucleotide G3 (Fig.2 B). Neither formation of the islet-specific complex C1B nor formation of the ubiquitous complexes C2 and C3 are significantly affected by addition of the competing oligonucleotides (Fig. 2 B and data not shown). In contrast, all oligonucleotides competing for complex B1 on G1–56 (G1–56, G1–33, G1–33r3, and G3), do also compete for C1A formed on G3, and oligonucleotides that do not interfere with B1 (G1–33r5 and G1–54) do not affect C1A. These data show that C1A exhibits similar binding characteristics as B1 and suggest that C1A is capable of binding efficiently to the G1element. To assess the nature of complexes B1 and C1A, we added in the EMSA incubation reactions antisera raised against the paired or homeodomain of Pax-6 (Fig.3 A). Anti-paired domain antibodies displaced B1 and B3 (G1–56), as well as C1A and C1B (G3). Complexes B1 and C1A are also supershifted by antibodies raised against the homeodomain of Pax-6. Of note, addition of both anti-Pax-6 antibodies did not completely displace B1. The residual complex was, however, of variable intensity in different nuclear extracts of InR1G9 cells and also detected with nuclear extracts from insulin-producing cell lines. Whereas this complex was specifically competed for by G-56, it was less efficiently displaced by competition with G1–33 comprising the core element of G1, and not at all with unrelated oligonucleotides (data not shown); it thus may represent a protein present in insulin- and glucagon-producing cells that might play a role in glucagon gene expression via its interaction with G1. Incubation of oligonucleotide G3 with extracts from BHK-21 cells transfected with the avian pax-6cDNA results in a complex that migrates similarly to C1A. This complex is supershifted with Pax-6 anti-paired and anti-homeodomain antibodies and absent from nuclear extracts from BHK-21 transfected with the vector alone; our data thus indicate that B1 and C1A represent Pax-6. Complex C1B, which displays binding characteristics that are different compared with B1 and C1A (Ref. 5Philippe J. Morel C. Cordier-Bussat M. J. Biol. Chem. 1995; 270: 3039-3045Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholarand Fig. 2), is supershifted with anti-paired domain but not with anti-homeodomain Pax-6 antibodies (Fig. 3 A) and may thus represent a protein antigenically related to Pax-6 or a Pax-6 isoform with a deletion or modification in the homeodomain. Complex B3 formed on G1–56 has previously been shown by immunological criteria to consist of a protein complex containing Cdx-2/3 (7Laser B. Meda P. Constant I. Philippe J. J. Biol. Chem. 1996; 271: 28984-28994Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar); its competition by oligonucleotide G3 and its interaction with both anti-Pax-6 antibodies now suggest that B3 may represent a Pax-6-Cdx-2/3 heterodimer. To further characterize complexes B1 and B3, we transfected the avian pax-6 or hamster cdx-2/3cDNA in BHK-21 cells, a cell line that does not express Pax-6 nor Cdx-2/3. As shown in Fig. 3 B, incubation of oligonucleotide G1–56 with extracts from BHK-21 cells overexpressing Pax-6 results in a complex that migrates similarly to B1 and that is absent from nuclear extracts from BHK-21 transfected with the vector alone. Of note, a nonspecific complex with similar migration mobility as Pax-6 and Cdx-2/3 can be observed in vector-transfected BHK-21 cells; this complex does not react with anti-Pax-6 or anti-Cdx-2/3 antibodies (data not shown). When extracts from BHK-21 cells overexpressing Cdx-2/3 are incubated with G1–56, a complex with a slightly lower electrophoretic mobility than B1 and corresponding to Cdx-2/3 appears (Fig.3 B) as previously reported (7Laser B. Meda P. Constant I. Philippe J. J. Biol. Chem. 1996; 271: 28984-28994Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). To test our hypothesis that B3 represents a Pax-6-Cdx-2/3 heterodimer, we incubated the labeled oligonucleotide G1–56 with a constant concentration of BHK-21 nuclear extracts overexpressing Pax-6 together with increasing amounts of Cdx-2/3 containing extracts or increasing amounts of Pax-6 containing extracts at two different concentrations of Cdx-2/3 containing extracts; in these conditions, an additional complex is observed that migrates like B3 and supershifted by anti-Pax-6 and anti-Cdx-2/3 antibodies (Fig. 3 B). Of note, the intensity of the reconstituted complex did not increase linearly; relatively high concentrations of either Pax-6 or Cdx-2/3 may be necessary for heterodimer versus homodimer formation in thisin vitro system. In nuclear extracts from glucagon-producing cells, Cdx-2/3 appears to be present in much lower concentration than Pax-6 because it binds only as the heterodimer B3, whereas Pax-6 binds both as a monomer (B1) and a heterodimer (B3). Indeed, when anti-Pax-6 and anti-Cdx-2/3 antibodies were added to InRlG9 nuclear extracts incubated with labeled G1–56, anti-Pax-6 antibodies displace B1 and B3, whereas anti-Cdx-2/3 antibodies displace only B3 (Fig.4). To test whether the residual complex of low intensity after displacement of B1 by anti-Pax-6 antibodies corresponds to a Cdx-2/3 monomer, we added both anti-Pax-6 and anti-Cdx-2/3 antibodies to the reaction. However, no further displacement was seen, indicating that in InR1G9 cells, Cdx-2/3 binds G1 only as the heterodimer B3. By contrast to anti-Pax-6 and anti-Cdx-2/3 antibodies, anti-Isl-1 antisera (21Wang M. Drucker D.J. J. Biol. Chem. 1995; 270: 12646-12652Crossref PubMed Scopus (92) Google Scholar) did not affect any of the complexes binding to G1–56. To analyze the binding characteristics of Pax-6 on the G1and G3 elements, we expressed the Pax-6 paired, homeo, and paired and homeodomains as GST fusion proteins (Fig.5 A). Whereas the Pax-6 homeodomain was unable to bind to G1 or G3, the paired domain interacted with both elements (Fig. 5 B); however, the binding of the paired domain to G1–56 was very weak, and the resulting complex was readily competed for by unlabeled G3 oligonucleotides. In contrast, a fusion protein comprising both domains exhibited a high affinity for G1 and a relatively lower affinity for G3; the complex formed on G3 was highly competed for by unlabeled G1–56. We therefore conclude that although both the paired and homeodomains of Pax-6 are necessary for maximal interaction with the G1 and G3 elements of the glucagon gene, the paired domain alone is sufficient for about half-maximal binding to G3, whereas it displays very low affinity for G1. To investigate the functional role of Pax-6, we performed cotransfection experiments in BHK-21 cells using fragments of the 5′-flanking sequence of the rat glucagon gene linked to the CAT reporter gene and a SV40-driven expression vector containing the quailpax-6 cDNA. Using the first 350 bp of the glucagon gene promoter (−350 CAT) containing both Pax-6 binding sites (G1 and G3), we observed a dose-dependent increase in CAT activity with increasing amounts of expression plasmids containing the pax-6cDNA. The transcriptional activation observed was similar to that obtained with the transcription factor interacting with the proximal AT-rich site of G1, Cdx-2/3 (Figs.6 and7 A). To characterize the relative functional importance of the proximal (G1) and the distal (G3) Pax-6 binding sites, we investigated the effects of Pax-6 overexpression on promoter constructs containing either one or both Pax-6 binding sites (Fig. 7 A); we used the first 138 bp of the glucagon gene promoter either alone (−138 CAT) or linked to oligonucleotides representing wild-type G3(G3-138 CAT) or G3 specifically mutated at the Pax-6 binding site (G3M6–138 CAT). As shown in Fig.7 B, overexpression of Pax-6 resulted in a 98-fold activation of the basal activity obtained with G3-138 CAT, whereas only half of this activation was observed for either −138 CAT or G3M6–138 CAT (37- and 38-fold activation, respectively). These results indicate that both Pax-6 binding sites are necessary for maximal activation of the glucagon gene promoter in BHK-21 cells and that deletion of the G3 site results in a loss of 50% of the activation potential. We then assessed the consequences of deletions or mutations of the proximal G1 binding sites by using either the first 75 bp of the glucagon gene promoter linked to wild-type G3 (G3-75 CAT, deletion of the Pax-6 binding site on G1) or the first 350 bp of the promoter with point mutations at nucleotides −89/−90 resulting in the loss of Pax-6 binding on G1 (G1M1–350 CAT) (Ref. 6Morel C. Cordier-Bussat M. Philippe J. J. Biol. Chem. 1995; 270: 3046-3055Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar and Figs. 1 and 8 A). A 40-fold stimulation of transcription by Pax-6 was observed for G3-75 CAT, which corresponds to half of the activation obtained with G3-138 CAT (Fig.7 B). With G1M1–350 CAT, transcription increased by 25-fold, which also corresponded to half of the activation seen with the respective control, −350 CAT. When point mutations were directed to the Cdx-2/3 binding site (nucleotides −71/72, G1M11–350 CAT), Pax-6 induced a 78-fold activation. Our results thus indicate that in BHK-21 cells, each Pax-6 binding site of the rat glucagon gene 5′-flanking sequence accounts for about half of the full activation observed when both sites are present. Of note, we always obtained significantly lower stimulation by Pax-6 with the wild-type or mutated 350 first bp of the promoter compared with shorter promoters.Figure 7Pax-6 activates glucagon gene expression in BHK-21 cells through both the G1 and G3 control elements. A, schematic representation of constructs containing different fragments of the wild-type or mutated rat glucagon gene 5′-flanking sequence linked to the CAT reporter gene.Cis-acting DNA control elements G1 to G4, a cAMP response element (CRE), and the TATA box are indicated. Specific mutations in G1 and G3 (see Fig. 1 for sequence) are shown by filled circles. A and B correspond to the subdomains of G3, and the imperfect direct repeat elements within G1 are indicated by the letters AT withindotted boxes. Pax-6 monomer and Pax-6-Cdx-2/3 heterodimer binding on G1 and G3 is illustrated.B, 1 μg of expression vector alone or containing thepax-6 cDNA was cotransfected with 10 μg of the indicated glucagon promoter constructs linked to the CAT reporter gene and 1 μg of pSV2A pap to monitor transfection efficiency in BHK-21 cells. Data are presented as in Fig. 6.View Large Image Figure ViewerDownload (PPT)Figure 8Interaction of Pax-6 and Cdx-2/3 on the G1 control element. A, 0.25 μg of expression vector alone or vectors containing either the Pax-6 or Cdx-2/3 cDNAs" @default.
• W1987183604 created "2016-06-24" @default.
• W1987183604 creator A5006568297 @default.
• W1987183604 creator A5010151254 @default.
• W1987183604 creator A5056730622 @default.
• W1987183604 creator A5059064009 @default.
• W1987183604 creator A5089173026 @default.
• W1987183604 date "1999-02-01" @default.
• W1987183604 modified "2023-10-15" @default.
• W1987183604 title "Pax-6 and Cdx-2/3 Interact to Activate Glucagon Gene Expression on the G1 Control Element" @default.
• W1987183604 cites W1501165471 @default.
• W1987183604 cites W1541607559 @default.
• W1987183604 cites W1560372529 @default.
• W1987183604 cites W1573536022 @default.
• W1987183604 cites W1632044028 @default.
• W1987183604 cites W1940249048 @default.
• W1987183604 cites W1964623084 @default.
• W1987183604 cites W1965372133 @default.
• W1987183604 cites W1966926802 @default.
• W1987183604 cites W1973723552 @default.
• W1987183604 cites W1995064346 @default.
• W1987183604 cites W2002326013 @default.
• W1987183604 cites W2005348903 @default.
• W1987183604 cites W2022762164 @default.
• W1987183604 cites W2035621553 @default.
• W1987183604 cites W2036735866 @default.
• W1987183604 cites W2042560173 @default.
• W1987183604 cites W2063398605 @default.
• W1987183604 cites W2082058277 @default.
• W1987183604 cites W2083590123 @default.
• W1987183604 cites W2106004510 @default.
• W1987183604 cites W2126705032 @default.
• W1987183604 cites W2154040587 @default.
• W1987183604 cites W2161691646 @default.
• W1987183604 cites W2350931375 @default.
• W1987183604 doi "https://doi.org/10.1074/jbc.274.7.4124" @default.
• W1987183604 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9933606" @default.
• W1987183604 hasPublicationYear "1999" @default.
• W1987183604 type Work @default.
• W1987183604 sameAs 1987183604 @default.
• W1987183604 citedByCount "111" @default.
• W1987183604 countsByYear W19871836042012 @default.
• W1987183604 countsByYear W19871836042015 @default.
• W1987183604 countsByYear W19871836042016 @default.
• W1987183604 countsByYear W19871836042018 @default.
• W1987183604 countsByYear W19871836042019 @default.
• W1987183604 countsByYear W19871836042021 @default.
• W1987183604 countsByYear W19871836042022 @default.
• W1987183604 countsByYear W19871836042023 @default.
• W1987183604 crossrefType "journal-article" @default.
• W1987183604 hasAuthorship W1987183604A5006568297 @default.
• W1987183604 hasAuthorship W1987183604A5010151254 @default.
• W1987183604 hasAuthorship W1987183604A5056730622 @default.
• W1987183604 hasAuthorship W1987183604A5059064009 @default.
• W1987183604 hasAuthorship W1987183604A5089173026 @default.
• W1987183604 hasBestOaLocation W19871836041 @default.
• W1987183604 hasConcept C104317684 @default.
• W1987183604 hasConcept C134018914 @default.
• W1987183604 hasConcept C150194340 @default.
• W1987183604 hasConcept C17744445 @default.
• W1987183604 hasConcept C185592680 @default.
• W1987183604 hasConcept C199360897 @default.
• W1987183604 hasConcept C199539241 @default.
• W1987183604 hasConcept C200288055 @default.
• W1987183604 hasConcept C2778563252 @default.
• W1987183604 hasConcept C41008148 @default.
• W1987183604 hasConcept C54355233 @default.
• W1987183604 hasConcept C71315377 @default.
• W1987183604 hasConcept C86803240 @default.
• W1987183604 hasConcept C90559484 @default.
• W1987183604 hasConcept C95444343 @default.
• W1987183604 hasConceptScore W1987183604C104317684 @default.
• W1987183604 hasConceptScore W1987183604C134018914 @default.
• W1987183604 hasConceptScore W1987183604C150194340 @default.
• W1987183604 hasConceptScore W1987183604C17744445 @default.
• W1987183604 hasConceptScore W1987183604C185592680 @default.
• W1987183604 hasConceptScore W1987183604C199360897 @default.
• W1987183604 hasConceptScore W1987183604C199539241 @default.
• W1987183604 hasConceptScore W1987183604C200288055 @default.
• W1987183604 hasConceptScore W1987183604C2778563252 @default.
• W1987183604 hasConceptScore W1987183604C41008148 @default.
• W1987183604 hasConceptScore W1987183604C54355233 @default.
• W1987183604 hasConceptScore W1987183604C71315377 @default.
• W1987183604 hasConceptScore W1987183604C86803240 @default.
• W1987183604 hasConceptScore W1987183604C90559484 @default.
• W1987183604 hasConceptScore W1987183604C95444343 @default.
• W1987183604 hasIssue "7" @default.
• W1987183604 hasLocation W19871836041 @default.
• W1987183604 hasOpenAccess W1987183604 @default.
• W1987183604 hasPrimaryLocation W19871836041 @default.
• W1987183604 hasRelatedWork W1966013768 @default.
• W1987183604 hasRelatedWork W2005057264 @default.
• W1987183604 hasRelatedWork W2023948432 @default.
• W1987183604 hasRelatedWork W2041620296 @default.
• W1987183604 hasRelatedWork W2335042048 @default.
• W1987183604 hasRelatedWork W2363156284 @default.
• W1987183604 hasRelatedWork W2371636489 @default.
• W1987183604 hasRelatedWork W2415025170 @default.

• next