FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1987277604> ?p ?o ?g. }

• W1987277604 endingPage "11243" @default.
• W1987277604 startingPage "11236" @default.
• W1987277604 abstract "Osteopontin (OPN) is a highly hydrophilic and negatively charged sialoprotein of ∼298 amino acids that contains a Gly-Arg-Gly-Asp-Ser sequence. It is a secreted protein with diverse regulatory functions, including cell adhesion and migration, tumor growth and metastasis, atherosclerosis, aortic valve calcification, and repair of myocardial injury. Despite the many recognized functions of OPN, very little is known of the transcriptional regulation of OPN. In this regard, we have previously demonstrated that OPN transcription and promoter activity are significantly up-regulated in response to NO in a system of endotoxin-stimulated murine macrophages. However, the specific cis- and trans-regulatory elements that determine the extent of endotoxin- and NO-mediated induction of OPN synthesis are unknown. In this follow-up study, we demonstrate that: 1) OPN gene transcription is regulated by a constitutive transcriptional repressor protein, heterogeneous nuclear ribonucleoprotein A/B (hnRNP A/B); 2) inhibition of in vivo hnRNP DNA binding activity is accompanied by increased S-nitrosylation of hnRNP A/B in the setting of lipopolysaccharide (LPS)-mediated NO synthesis; 3) inhibition of LPS mediated NO synthesis restores hnRNP DNA binding and decreases the extent of S-nitrosylation; and 4) S-nitrosylation of hnRNP at cysteine 104 inhibits in vitro DNA binding activity, which is reversed by dithiothreitol. Our findings suggest that LPS induced S-nitrosylation of hnRNP inhibits its activity as a constitutive repressor of the OPN promoter and results in enhanced OPN expression. Osteopontin (OPN) is a highly hydrophilic and negatively charged sialoprotein of ∼298 amino acids that contains a Gly-Arg-Gly-Asp-Ser sequence. It is a secreted protein with diverse regulatory functions, including cell adhesion and migration, tumor growth and metastasis, atherosclerosis, aortic valve calcification, and repair of myocardial injury. Despite the many recognized functions of OPN, very little is known of the transcriptional regulation of OPN. In this regard, we have previously demonstrated that OPN transcription and promoter activity are significantly up-regulated in response to NO in a system of endotoxin-stimulated murine macrophages. However, the specific cis- and trans-regulatory elements that determine the extent of endotoxin- and NO-mediated induction of OPN synthesis are unknown. In this follow-up study, we demonstrate that: 1) OPN gene transcription is regulated by a constitutive transcriptional repressor protein, heterogeneous nuclear ribonucleoprotein A/B (hnRNP A/B); 2) inhibition of in vivo hnRNP DNA binding activity is accompanied by increased S-nitrosylation of hnRNP A/B in the setting of lipopolysaccharide (LPS)-mediated NO synthesis; 3) inhibition of LPS mediated NO synthesis restores hnRNP DNA binding and decreases the extent of S-nitrosylation; and 4) S-nitrosylation of hnRNP at cysteine 104 inhibits in vitro DNA binding activity, which is reversed by dithiothreitol. Our findings suggest that LPS induced S-nitrosylation of hnRNP inhibits its activity as a constitutive repressor of the OPN promoter and results in enhanced OPN expression. Osteopontin (OPN) 1The abbreviations used are: OPN, osteopontin; LPS, lipopolysaccharide; hnRNP, heterogeneous nuclear ribonucleoprotein; l-NAME, NG-nitro-l-arginine methyl ester; SNAP, S-nitroso-N-acetyl-penicillamine; nt, nucleotide(s); ChIP, chromatin immunoprecipitation; DTT, dithiothreitol; HPLC, high pressure liquid chromatography; GSNO, S-nitroso-glutathione; iNOS, inducible nitric-oxide synthase. 1The abbreviations used are: OPN, osteopontin; LPS, lipopolysaccharide; hnRNP, heterogeneous nuclear ribonucleoprotein; l-NAME, NG-nitro-l-arginine methyl ester; SNAP, S-nitroso-N-acetyl-penicillamine; nt, nucleotide(s); ChIP, chromatin immunoprecipitation; DTT, dithiothreitol; HPLC, high pressure liquid chromatography; GSNO, S-nitroso-glutathione; iNOS, inducible nitric-oxide synthase. is a highly hydrophilic and negatively charged sialoprotein of ∼298 amino acids that contains a Gly-Arg-Gly-Asp-Ser sequence. It is a secreted protein with diverse regulatory functions, including cell adhesion and migration, tumor growth and metastasis, atherosclerosis, aortic valve calcification, and repair of myocardial injury. Despite the many recognized functions of OPN, very little is known of the transcriptional regulation of OPN. Studies indicate that the OPN promoter contains various motifs including a purine-rich sequence, an Ets-like sequence, glucocorticoid and vitamin D response elements, and interferon-inducible elements (1Hijiya N. Setoguchi M. Matsuura K. Higuchi Y. Akizuki S. Yamamoto S. Biochem. J. 1994; 303: 255-262Crossref PubMed Scopus (106) Google Scholar, 2Guo X. Zhang Y.P. Mitchell D.A. Denhardt D.T. Chambers A.F. Mol. Cell. Biol. 1995; 15: 476-487Crossref PubMed Google Scholar). In this regard, we have previously demonstrated that OPN transcription and promoter activity are significantly up-regulated in response to NO in a system of endotoxin-stimulated murine macrophages (3Guo H. Cai C.Q. Schroeder R.A. Kuo P.C. J. Immunol. 2001; 166: 1079-1086Crossref PubMed Scopus (104) Google Scholar). However, the specific cis- and trans-regulatory elements that determine the extent of endotoxin- and NO-mediated induction of OPN synthesis are unknown.In RAW 264.7 and ANA-1 murine macrophages, we have demonstrated that LPS and/or pro-inflammatory cytokine induced NO synthesis is a potent mediator of OPN promoter activation, gene transcription, and protein expression (3Guo H. Cai C.Q. Schroeder R.A. Kuo P.C. J. Immunol. 2001; 166: 1079-1086Crossref PubMed Scopus (104) Google Scholar). In this study, we demonstrate that: 1) OPN gene transcription is regulated by a constitutive transcriptional repressor protein, heterogeneous nuclear ribonucleoprotein A/B (hnRNP A/B); 2) in vivo hnRNP DNA binding activity is significantly inhibited in the setting of LPS-mediated NO synthesis; and 3) S-nitrosylation of hnRNP A/B at a cysteine residue in the DNA-binding region inhibits in vitro DNA binding activity. Our findings suggest that LPS-induced S-nitrosylation of hnRNP inhibits its activity as a constitutive repressor of the OPN promoter. These data represent a novel function for hnRNP proteins, which are better known as participants in telomere biogenesis, splicing, and mRNA transport.MATERIALS AND METHODSCell Culture and Induction of NO Synthesis in RAW 264.7 Macrophages—RAW 264.7 macrophages were maintained in Dulbecco's modified Eagle's medium with 10% heat-inactivated fetal calf serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. LPS (100 ng/ml) was added in the absence of fetal calf serum (10%) to induce NO synthesis. In selected instances, the competitive substrate inhibitor of NO synthase, NG-nitro-l-arginine methyl ester (l-NAME, 250 ng/ml) or the NO donor, S-nitroso-N-acetyl-penicillamine (SNAP, 100 μm), or a combination of these compounds was added. After incubation for 12 h at 37 °C in 5% CO2, the supernatants and cells were harvested for assays.Western Blot Analysis—RAW 264.7 cells were lysed in buffer (0.8% NaCl, 0.02 KCl, 1% SDS, 10% Triton X-100, 0.5% sodium deoxycholic acid, 0.144% Na2HPO4 and 0.024% KH2PO4, pH 7.4) and centrifuged at 12,000 × g for 10 min at 4 °C. The protein concentration was determined by absorbance at 650 nm using protein assay reagent (Bio-Rad). The cell lysates (35 μg/lane) were separated by 12% SDS-PAGE, and the products were electrotransferred to polyvinylidene difluoride membrane (Amersham Biosciences). The membrane was blocked with 5% skim milk, phosphate-buffered saline, 0.05% Tween for 1 h at room temperature. After being washed three times, blocked membranes were incubated with rat polyclonal antibody directed against mouse hnRNP A/B (a gift from Dr. Jonathan Dean, Imperial College of Science, Technology and Medicine, London, UK) or rabbit polyclonal antibody directed against S-nitroso-cysteine (Calbiochem) for 1 h at room temperature, washed three times in phosphate-buffered saline plus 0.05% Tween, and incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. After an additional three washes, bound peroxidase activity was detected by the ECL detection system (Amersham Biosciences).Southwestern (DNA Protein) Blotting—Approximately 70 mg of total cell protein was electrophoresed in a sodium dodecyl sulfate-12% polyacrylamide gel, transferred to nitrocellulose, and renatured by using guanidine hydrochloride as described previously (18Smidt M.P. Russchen B. Snippe L. Wijnholds J. Ab G. Nucleic Acids Res. 1995; 23: 2389-2395Crossref PubMed Scopus (36) Google Scholar). The probes were labeled with [α-32P]dCTP, using a random primer kit (Roche Applied Science).Plasmid Constructs—5′-Deletion fragments of the OPN promoter subcloned into pXP2 plasmid encoding luciferase were gifts from Dr. Denhardt (Rutgers University). The lengths of the osteopontin promoter fragments tested were OPN –69 (–69 to +79), OPN –258 (–258 to +79), OPN –472 (–472 to +79), OPN –600 (–600 to +79), OPN –777 (–777 to +79), and OPN –1467 (–1467 to +79). Further deletion constructs from –258 to –69 were constructed by PCR with the following primers, and then the fragments were cloned into pGL3-basic luciferase reporter plasmid (Promega): OPN-69 (–69 to +79), OPN-107 (–107 to +79), OPN-174 (–174 to +79), OPN-209 (–209 to +79), and OPN-258 (–258 to +79). Additional constructs were made with deletion of nt –174 to nt –209, OPN-full (del –174 to –209); nt –195 to nt –209, OPN-full (del –195 to –209); nt –183 to nt –196, OPN-full (del –183 to –196); and nt –174 to nt –184, OPN-full (del –174 to –184) from the full-length OPN promoter. Expression plasmids for heterogeneous nuclear ribonucleoprotein A/B proteins (hnRNP A/B isoform p37 and p40) were provided by Dr. Jonathan Dean (Imperial College of Science, Technology and Medicine, London, UK). The deletion and point mutants of the full-length OPN promoter were constructed by two-step PCR. In OPN-Point, the hnRNP-binding site AGTTATG identified by gel shift was mutated to CTGCCGT. In OPN-Deletion, the hnRNP site was simply deleted. The mutations were confirmed by DNA sequencing. The mutated PCR fragments were cloned into pGL3-basic luciferase reporter plasmid (Promega) and labeled OPN-Deletion and OPN-Point, respectively.Transient Transfection and Activity Assay—DNA transfections of RAW 264.7 macrophages were carried out in 12-well plates using LipofectAMINE. Briefly, 1 × 106 cells were plated on a 12-well plate and allowed to grow for 24 h before the transfection. 2 μg of plasmid DNA and 2 μg of protamine sulfate diluted OPTI-DMEM and 24 μg of LipofectAMINE diluted in OPTI-DMEM were combined and incubated at room temperature for 20 min. The cells with transfection reagents were incubated for 4 h at 37 °C in a CO2 incubator. Transfection medium was then replaced with Eagle's minimal essential media containing 10% fetal bovine serum. At least 24 h later, the medium was changed, and LPS was added. To control transfection efficiency between groups, 0.1 μg of pRL-TK was added to each well. Twenty-four hours after transfection, the cells were harvested in 0.4 ml of reporter lysis buffer (Promega), and dual luciferase reporter assays were performed by following the protocol provided by the manufacturer. 40 μl of lysate was used for measurement in a luminometer (Turner Designs TD-20/20). Co-transfection studies were carried out by using 1 μg of expression plasmids for hnRNP A/B isoform p37 and p40 with 1 μg of OPN reporter plasmids. The three OPN reporter plasmids are OPN, OPN-Deletion, and OPN-Point. In selected instances, antisense or sense oligonucleotides to hnRNP were co-transfected with various OPN promoter constructs. The sense and antisense oligonucleotides (nt 954–974) were designed according to GenBank™ sequence NM 010448 to block the expression of hnRNP A/B (sense, 5′-GAGGAAATCGCAATCGAGG-3′; antisense, 5′-CCTCGATTGCGATTTCCTC-3′).Chromatin Immunoprecipitation (ChIP) Assay—Chromatin from macrophages was fixed and immunoprecipitated using the ChIP assay kit (Upstate Biotechnology, Inc.) as recommended by the manufacturer. The purified chromatin was immunoprecipitated using 10 μg of anti-hnRNP A/B or 5 μl of rabbit nonimmune serum. The input fraction corresponded to 0.1 and 0.05% of the chromatin solution before immunoprecipitation. After DNA purification, the presence of the selected DNA sequence was assessed by PCR. The PCR product was 338 bp in length. The PCR program was: 94 °C× 4 min; followed by 94 °C× 45 s, 55 °C× 45 s, and 72 °C×45 s for a total of 28 cycles; and then 72 °C× 7 min. PCR products were resolved in 10% acrylamide gels. The average size of the sonicated DNA fragments subjected to immunoprecipitation was 500 bp as determined by ethidium bromide gel electrophoresis. The ChIP assay utilized PCR primers GTCTGAGAGAATCAAATTGT and AAAAACCTCATGACACATCA.Nuclear Extract Preparation—Monolayers of RAW 264.7 cells were washed with phosphate-buffered saline and harvested by scraping into cold phosphate-buffered saline. The cell pellet obtained by centrifugation was resuspended in buffer containing 10 mm HEPES, pH 7.9, 10 mm KCl, 0.1 mm EDTA, 0.1 mm EGTA, 1.0 mm DTT and 0.5 mm phenylmethylsulfonyl fluoride; then 10% Nonidet P-40 was added and vortexed briefly; and the nuclei were pelleted by centrifugation. The nuclear proteins were extracted with buffer containing 20 mm HEPES, pH 7.9, 0.4 mm NaCl, 1.0 mm EDTA, 1.0 mm EGTA, 1.0 mm DTT, and 1.0 mm phenylmethylsulfonyl fluoride. Insoluble material was removed by centrifugation at 14000 rpm, and the supernatant containing the nuclear proteins was stored at –80 °C until use.Gel Shift Assays—Gel shift assays were performed using nuclear cell extract fraction, as previously described. In competitive binding assays, unlabeled oligonucleotides were added at 200 m excess. In noncompetitive assays, unlabeled SP1 consensus oligonucleotides (Promega) were used. Supershift assays were performed by the addition of 1 μl of rat polyclonal antibody directed against mouse hnRNP A/B (a gift from Dr. Jonathan Dean, Imperial College of Science, Technology and Medicine, London, UK). The oligonucleotide (nt –174 to nt –202) used in gel shift were as follows: 5′-GAAAAGGGTAGTTATGACATCGTTCATC-3′. Probe was prepared by end labeling the wild-type 29-bp double-stranded oligonucleotides with [32P]ATP (2500 Ci/mmol) using T4 polynucleotide kinase, followed by G-50 column purification. The reactions were resolved on a 6% nondenaturing acrylamide gel in 1× TBE buffer. All of the oligonucleotides used in the gel shift are HPLC grade. 20-bp oligonucleotides used as competitors were synthesized to contain mutations in relation to the wild-type sequence.Purification of Transcription Factor—The transcription factor was isolated by reacting the biotinylated DNA-protein complex with streptavidin paramagnetic particles (Dynal Biotech Inc.). Nuclear proteins were isolated from RAW 264.7 cells, as previously described. Protein concentration of the nuclear extract was determined using the Bio-Rad protein assay system. The nuclear protein was incubated for 15 min at 25 °C with reverse phase HPLC-purified biotinylated 29-mer oligonucleotide containing the identified binding site (5′-GAAAAGGGTAGTTATGACATCGTTCATC-3′) bound to Dynabeads M280 streptavidin in protein binding buffer (50 mm Tris-HCl, pH 7.5, 2.5 mm EDTA, 20% (v/v) glycerol, 5 mm MgCl2, 250 mm NaCl, 0.25 mg/ml poly(dI-dC), and 2.5 mm DTT). The magnetic beads were then washed three times with protein binding buffer in 100 mm NaCl containing excess nonbinding poly(dI-dC) competitor DNA. Serial elutions were then performed using elution buffer (20 mm Tris-HCl, pH 8.0, 1 mm EDTA, 10% (v/v) glycerol, 0.01% Triton X-100, 1 m NaCl, and 1 mm DTT). The fractions were typically stored at –80 °C prior to subsequent use.Protein Sequencing—The protein was separated by SDS-PAGE and stained with silver. The individual protein band samples were excised and digested overnight with trypsin. The resulting digest was then injected onto a Microbore high performance liquid chromatography (Beckman 32 K Gold) system, and the fractions were collected. The 10 best fractions were selected for matrix-assisted laser desorption/ionization mass analysis of the intact protein (ABI/Perseptive Voyager DE-Pro); subsequently, the best fractions were selected for Edman sequencing (ABI Procise 470). The resulting data were manually interpreted and searched using Sequest against the NCBI nonredundant data base.UV Cross-linking—DNA-protein cross-linking of the isolated nuclear protein complex was performed as previously described (4Guo H. Cai C.Q. Kuo P.C. J. Biol. Chem. 2001; 277: 2054-5060Google Scholar). Radiolabeled probe was prepared by annealing 1 pmol of an oligonucleotide encompassing the identified binding site GAAAAGGGTAGTTATGACATCGTTCATC with 100 pmol of a complementary oligonucleotide.Statistical Analysis—The data are expressed as the means ± S.E. Analysis was performed using Student's t test. p values less than 0.05 were considered significant.RESULTSTransient Transfection Analysis of OPN Promoter Deletion Constructs—To localize a potential NO-sensitive cis-acting element in the OPN promoter, deletion constructs were transiently transfected in unstimulated control, LPS-treated, and LPS + l-NAME-treated RAW 264.7 cells (Fig. 1). Serial deletion constructs demonstrated a significant 9-fold increase in luciferase activity between nt –69 and nt –258 in the context of LPS stimulation. Inhibition of NO synthesis in the LPS + l-NAME group completely ablated this increase in luciferase activity. Sequences upstream of nt –258 did not contribute to LPS-associated OPN promoter activity (data not shown). Using further serial deletion constructs, this area of increased LPS- and NO-induced OPN promoter activity was further localized to the length of the promoter from nt –174 to nt –209 (Fig. 1A). Again, inhibition of NO synthesis in the LPS + l-NAME group ablated this increased promoter activity. Finally, deletions of segments nt –174 to –209, nt –195 to –209, nt –183 to –196, and nt –174 to –184 from the full-length 1467-nt OPN promoter (OPN-full) were analyzed (Fig. 1B). In the setting of transfection of the full-length wild-type OPN promoter, LPS treatment induced a 10–20-fold increase in OPN promoter activity; this was ablated when l-NAME was added with LPS. In contrast, deletion of nt –174 to –209 or deletion of nt –183 to –196 resulted in dramatic increases in OPN promoter activity in control and LPS + l-NAME groups such that the level of OPN activity was not different from that of the LPS group. In these experiments, SNAP (100 μm) was also added as an exogenous source of NO. In this instance, luciferase activity with SNAP treatment alone paralleled that of LPS treatment. These results suggest that an NO-sensitive constitutive repressor may reside in the nt –183 to –196 region of the OPN promoter.Gel Shift Analysis—To determine whether a trans-activating factor may reside in the nt –183 to –196 region of the OPN promoter, gel shift analysis was performed using a labeled 29-nt fragment (nt –174 to –202) containing the area of interest (Fig. 2). Nuclear protein was isolated from control, LPS-treated, and LPS + l-NAME-treated cells. In control, LPS + l-NAME, and l-NAME cells, nuclear protein was bound to the labeled probe. In the presence of 40-fold excess unlabeled full-length probe, this binding was extinguished. The full-length probe was then truncated into three segments: nt –195 to –202, nt –174 to –183, and nt –183 to –196, and expressed as tandem triple repeats. When these were added as excess unlabeled competitors, nuclear binding was ablated in the presence of the unlabeled segment of OPN promoter from nt –183 to –196. These data suggest that nuclear protein is bound to the OPN promoter in the region of nt –183 to –196 in unstimulated control cells. In the presence of LPS and NO, binding is no longer present, and OPN promoter activity is increased, indicating that this protein may function as a constitutive repressor.Fig. 2Mutational analysis of NO-sensitive binding site in OPN promoter. Gel shift competition studies were performed using nuclear extract prepared from unstimulated control RAW 264.7 macrophages and those stimulated with LPS (100 nm) and/or l-NAME (100 μm). Gel shift assays using a labeled 29-nt fragment (nt –174 to –202) containing the area of interest were performed for the identification of the a potential NO-sensitive transcription factor. In competitive binding assays, unlabeled mutant oligonucleotides were added at 200 m excess. Sequences of mutant competitor oligonucleotides are listed in Table I. The mutated sequences are expressed as tandem triple repeats and were used as excess unlabeled competitors. The blot is representative of three experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The binding region was then further characterized by serial mutations of the OPN promoter between nt –183 and –196 (Table I). These mutated sequences were then expressed as tandem triple repeats and used as excess unlabeled competitors in gel shift assays. Mutant sequences 2 and 4 effectively competed for binding to the repressor protein, suggesting that the core binding sequence is AGTTATG. The sequence specificity for binding was confirmed with in vitro DNA footprinting (data not shown).Table ISequences of mutated competitor DNA for gel shift analysisWild typeGGT AGT TAT GAC AMutant 1AAG AGT TAT GAC AMutant 2GGT CAG TAT GAC AMutant 3GGT AGT TAT GCA CMutant 4GGT AGT TGC TAC A Open table in a new tab Isolation and Characterization of Repressor Protein—Bound repressor protein complex previously resolved by gel shift analysis was UV cross-linked to a radiolabeled DNA probe containing nt –183 to –196. Subtracting the molecular mass of the DNA probe indicates that the molecular mass of the repressor transcription factor protein is ∼40 kDa. Utilizing the biotin-streptavidin DNA affinity technique with the identified DNA-binding sequence, the repressor transcription factor was then purified and isolated from nuclear extract isolated from unstimulated control RAW 264.7 macrophages. A representative Western blot of purified extract is depicted in Fig. 3. One major band was identified. A Southwestern blot was performed using nuclear extract and radiolabeled tandem double repeat DNA probe (nt –183 to –196) containing the described binding sequence; this demonstrated binding to Band 1. Band 1 was therefore excised and subjected to protein sequencing. Analysis of two separate tryptic digests of Band 1 yielded identical matches with hnRNP A/B (GenBank™ accession number NM 010448).Fig. 3Isolation of NO-sensitive transcription factor. Western blot of crude nuclear extract and purified nuclear extract from unstimulated control RAW 264.7 macrophages was performed on 6% SDS-PAGE. Crude nuclear protein and nuclear protein purified utilizing the biotin-streptavidin DNA affinity technique with the identified putative DNA-binding sequence were electrophoresed on 8% SDS-PAGE and stained with Coomassie Brilliant Blue. The Southwestern blot was performed using radiolabeled tandem double repeat DNA probe (nt –183 to –196) containing the described binding sequence and the purified nuclear protein fraction. The blots are representative of four experiments. MW, molecular mass.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Confirmation of hnRNP A/B DNA Binding and Function—To confirm specificity of hnRNP A/B binding to the OPN promoter, supershift and ChIP assays were performed in unstimulated control, LPS-treated, and LPS + l-NAME-treated cells. Rat polyclonal antibody directed against mouse hnRNP A/B was a gift from Dr. Jonathan Dean (Imperial College of Science, Technology and Medicine, London, UK). Gel shift assays were repeated in the presence of hnRNP A/B antibody with the previously described DNA probe. Again, a band corresponding to binding of a nuclear protein was found in control and LPS + l-NAME cells. This band was supershifted in control and LPS + l-NAME cells by the addition of the hnRNP A/B antibody (Fig. 4A). No shift was noted with preimmune sera. ChIP assays were then performed to confirm the in vivo binding of hnRNP A/B to this portion of the OPN promoter (Fig. 4B). LPS- and SNAP-treated cells did not exhibit hnRNP A/B binding, whereas control and LPS + l-NAME cells demonstrated DNA binding. These data suggest that hnRNP A/B binds to this segment of the OPN promoter in unstimulated control cells. Conversely, the presence of NO, endogenously synthesized or exogenously delivered, inhibits hnRNP A/B binding.Fig. 4Gel shift and ChIP assay confirmation of hnRNP A/B binding to OPN promoter. A, supershift analysis of hnRNP A/B binding. Gel shift competition studies were performed using nuclear extract prepared from unstimulated control RAW 264.7 macrophages and those stimulated with LPS (100 nm) and/or l-NAME (100 μm). Gel shift assays using a labeled 29-nt fragment (nt –174 to –202) containing the area of interest were performed for the identification of the a potential NO-sensitive transcription factor. In selected instances, polyclonal antibody to hnRNP A/B was preincubated with the nuclear proteins. The blot is representative of three experiments. B, ChIP analysis of hnRNP A/B binding. Chromatin from was fixed and immunoprecipitated using the ChIP assay kit as recommended by the manufacturer (Upstate Biotechnology, Inc.). The purified chromatin was immunoprecipitated using 10 μg of anti-hnRNP A/B or 5 μl of rabbit nonimmune serum. The input fraction corresponded to 0.1 and 0.05% of the chromatin solution before immunoprecipitation. After DNA purification, the presence of the selected DNA sequence was assessed by PCR. The blot is representative of three experiments. ab, antibody.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The full-length OPN, OPN-Point, and OPN-Deletion promoter constructs were then transfected into RAW 264.7 cells. In OPN-Point, the hnRNP-binding site AGTTATG was mutated to CTGCCGT in the full-length OPN promoter. In OPN-Deletion, the hnRNP site was simply deleted. These mutations were confirmed by DNA sequencing. The cells were again subjected to LPS or LPS + l-NAME treatment. In selected instances, antisense and sense oligonucleotides to hnRNP A/B were also added (Fig. 5A). When compared with the full-length OPN promoter, OPN-Point and OPN-Deletion constructs demonstrated significantly greater levels of luciferase activity in control and LPS + l-NAME settings. These levels were not different from that seen with LPS stimulation. In addition, when antisense oligonucleotides to hnRNP A/B were added with the wild-type full-length OPN promoter, promoter activity was also significantly augmented in control and LPS + l-NAME treatment settings. Co-transfection assays were then performed with the full-length OPN promoter and the expression vector for hnRNP A/B p37. In control and LPS + l-NAME cells, co-expression of hnRNP A/B p37 further depressed OPN promoter activity (Fig. 5B). In the setting of SNAP or LPS treatment, OPN promoter activity was quite elevated in comparison with that of control cells (Fig. 5C). This level of luciferase activity was not altered by co-expression of hnRNP A/B. These data suggest that hnRNP A/B functions as a constitutive repressor of OPN promoter activity, and in the presence of LPS-mediated NO production, hnRNP binding is no longer present, and OPN promoter activity increases.Fig. 5Transient transfection analysis of hnRNP A/B interactions with the OPN promoter. A, the full-length OPN, OPN-Point and OPN-Deletion promoter constructs were transfected into RAW 264.7 cells. In OPN-Point, the hnRNP-binding site AGTTATG was mutated to CTGCCGT in the full-length OPN promoter. In OPN-Deletion, the hnRNP site was simply deleted. These mutations were confirmed by DNA sequencing. The cells were again subjected to LPS or LPS + l-NAME treatment. In selected instances, antisense and sense oligonucleotides to hnRNP A/B were also added. The histograms are representations of luciferase activity normalized to β-galactosidase activity from co-transfected pCMV.SPORT-β-gal-induced activity. The values are expressed as the means ± S.E. of three experiments. *, p < 0.01 versus control and LPS + l-NAME. B, co-transfection of hnRNP A/B p37 expression vector in control and LPS + l-NAME-treated cells. The full-length OPN promoter reporter construct was co-transfected with an hnRNP A/B expression vector. The cells were unstimulated controls or subjected to LPS + l-NAME treatment. The values are expressed as the means ± S.E. of three experiments. *, p < 0.01 versus OPN-1467). C, co-transfection of hnRNP A/B p37 expression vector in SNAP- and LPS-treated cells. The full-length OPN promoter reporter construct was co-transfected with an hnRNP A/B expression vector. The cells were subjected to LPS or SNAP treatment. The values are expressed as the means ± S.E. of three experiments.View Large Image Figure ViewerDownload Hi-res image" @default.
• W1987277604 created "2016-06-24" @default.
• W1987277604 creator A5008662619 @default.
• W1987277604 creator A5012915140 @default.
• W1987277604 creator A5016777555 @default.
• W1987277604 creator A5020189467 @default.
• W1987277604 creator A5042563957 @default.
• W1987277604 creator A5083956940 @default.
• W1987277604 date "2004-03-01" @default.
• W1987277604 modified "2023-10-12" @default.
• W1987277604 title "S-Nitrosylation of Heterogeneous Nuclear Ribonucleoprotein A/B Regulates Osteopontin Transcription in Endotoxin-stimulated Murine Macrophages" @default.
• W1987277604 cites W1519147845 @default.
• W1987277604 cites W1569476889 @default.
• W1987277604 cites W1594802667 @default.
• W1987277604 cites W1618037986 @default.
• W1987277604 cites W1784982965 @default.
• W1987277604 cites W1834041853 @default.
• W1987277604 cites W1917679240 @default.
• W1987277604 cites W1939982746 @default.
• W1987277604 cites W1965699162 @default.
• W1987277604 cites W1973085104 @default.
• W1987277604 cites W1989823228 @default.
• W1987277604 cites W1995462541 @default.
• W1987277604 cites W1998431428 @default.
• W1987277604 cites W2000371296 @default.
• W1987277604 cites W2006646400 @default.
• W1987277604 cites W2041246826 @default.
• W1987277604 cites W2061303270 @default.
• W1987277604 cites W2061876552 @default.
• W1987277604 cites W2072683636 @default.
• W1987277604 cites W2075157322 @default.
• W1987277604 cites W2080489609 @default.
• W1987277604 cites W2086786219 @default.
• W1987277604 cites W2092716548 @default.
• W1987277604 cites W2112115500 @default.
• W1987277604 cites W2113276205 @default.
• W1987277604 cites W2118312129 @default.
• W1987277604 cites W2125018684 @default.
• W1987277604 cites W2127350329 @default.
• W1987277604 cites W2130033818 @default.
• W1987277604 cites W2134760535 @default.
• W1987277604 cites W2144109738 @default.
• W1987277604 cites W2147830182 @default.
• W1987277604 cites W2160449667 @default.
• W1987277604 cites W2163981817 @default.
• W1987277604 cites W2165169748 @default.
• W1987277604 cites W2346692519 @default.
• W1987277604 cites W36502835 @default.
• W1987277604 doi "https://doi.org/10.1074/jbc.m313385200" @default.
• W1987277604 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/5336185" @default.
• W1987277604 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/28235901" @default.
• W1987277604 hasPublicationYear "2004" @default.
• W1987277604 type Work @default.
• W1987277604 sameAs 1987277604 @default.
• W1987277604 citedByCount "52" @default.
• W1987277604 countsByYear W19872776042012 @default.
• W1987277604 countsByYear W19872776042013 @default.
• W1987277604 countsByYear W19872776042015 @default.
• W1987277604 countsByYear W19872776042017 @default.
• W1987277604 countsByYear W19872776042018 @default.
• W1987277604 countsByYear W19872776042019 @default.
• W1987277604 countsByYear W19872776042020 @default.
• W1987277604 countsByYear W19872776042021 @default.
• W1987277604 countsByYear W19872776042023 @default.
• W1987277604 crossrefType "journal-article" @default.
• W1987277604 hasAuthorship W1987277604A5008662619 @default.
• W1987277604 hasAuthorship W1987277604A5012915140 @default.
• W1987277604 hasAuthorship W1987277604A5016777555 @default.
• W1987277604 hasAuthorship W1987277604A5020189467 @default.
• W1987277604 hasAuthorship W1987277604A5042563957 @default.
• W1987277604 hasAuthorship W1987277604A5083956940 @default.
• W1987277604 hasBestOaLocation W19872776041 @default.
• W1987277604 hasConcept C104317684 @default.
• W1987277604 hasConcept C138885662 @default.
• W1987277604 hasConcept C153911025 @default.
• W1987277604 hasConcept C178790620 @default.
• W1987277604 hasConcept C179926584 @default.
• W1987277604 hasConcept C185592680 @default.
• W1987277604 hasConcept C203014093 @default.
• W1987277604 hasConcept C2780804394 @default.
• W1987277604 hasConcept C2909472194 @default.
• W1987277604 hasConcept C41895202 @default.
• W1987277604 hasConcept C45068187 @default.
• W1987277604 hasConcept C519581460 @default.
• W1987277604 hasConcept C55493867 @default.
• W1987277604 hasConcept C67705224 @default.
• W1987277604 hasConcept C75934600 @default.
• W1987277604 hasConcept C86803240 @default.
• W1987277604 hasConcept C95444343 @default.
• W1987277604 hasConceptScore W1987277604C104317684 @default.
• W1987277604 hasConceptScore W1987277604C138885662 @default.
• W1987277604 hasConceptScore W1987277604C153911025 @default.
• W1987277604 hasConceptScore W1987277604C178790620 @default.
• W1987277604 hasConceptScore W1987277604C179926584 @default.
• W1987277604 hasConceptScore W1987277604C185592680 @default.
• W1987277604 hasConceptScore W1987277604C203014093 @default.
• W1987277604 hasConceptScore W1987277604C2780804394 @default.
• W1987277604 hasConceptScore W1987277604C2909472194 @default.

• next