FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1987756568> ?p ?o ?g. }

• W1987756568 endingPage "32584" @default.
• W1987756568 startingPage "32575" @default.
• W1987756568 abstract "Six pRNAs (p for packaging) of bacterial virus phi29 form a hexamer complex that is an essential component of the viral DNA translocating motor. Dimers, the building block of pRNA hexamer, assemble in the order of dimer → tetramer → hexamer. The two-dimensional structure of the pRNA monomer has been investigated extensively; however, the three-dimensional structure concerning the distance constraints of the three stems and loops are unknown. In this report, we probed the three-dimensional structure of pRNA monomer and dimer by photo affinity cross-linking with azidophenacyl. Bases 75–81 of the left stem were found to be oriented toward the head loop and proximate to bases 26–31 in a parallel orientation. Chemical modification interference indicates the involvement of bases 45–71 and 82–91 in dimer formation. Dimer was formed via hand-in-hand contact, a novel RNA dimerization that in some aspects is similar to the kissing loops of the human immunodeficiency virus. The covalently linked dimers were found to be biologically active. Both the native dimer and the covalently linked dimer were found by cryo-atomic force microscopy to be similar in global conformation and size. Six pRNAs (p for packaging) of bacterial virus phi29 form a hexamer complex that is an essential component of the viral DNA translocating motor. Dimers, the building block of pRNA hexamer, assemble in the order of dimer → tetramer → hexamer. The two-dimensional structure of the pRNA monomer has been investigated extensively; however, the three-dimensional structure concerning the distance constraints of the three stems and loops are unknown. In this report, we probed the three-dimensional structure of pRNA monomer and dimer by photo affinity cross-linking with azidophenacyl. Bases 75–81 of the left stem were found to be oriented toward the head loop and proximate to bases 26–31 in a parallel orientation. Chemical modification interference indicates the involvement of bases 45–71 and 82–91 in dimer formation. Dimer was formed via hand-in-hand contact, a novel RNA dimerization that in some aspects is similar to the kissing loops of the human immunodeficiency virus. The covalently linked dimers were found to be biologically active. Both the native dimer and the covalently linked dimer were found by cryo-atomic force microscopy to be similar in global conformation and size. packaging RNA atomic force microscopy polymerase chain reaction dimethyl sulfate diethyl pyrocarbonate (1-cyclohexyl-3-(2-morpholinoethyl)carbodiimide metho-p-toluene sulfonate) circularly permuted pRNA azidophenacyl polyacrylamide gel electrophoresis Interactions between RNA molecules play diverse roles in different biological systems. Dimerization of retrovirus RNAs via kissing loops is believed to govern essential steps in the retroviral life cycle, including translation, reverse transcription, RNA encapsidation, and virion assembly (1Greatorex J.S. Laisse V. Dokhelar M.C. Lever A.M.L. Nucleic Acids Res. 1996; 24: 2919-2923Crossref PubMed Scopus (21) Google Scholar, 2Skripkin E. Paillart J.C. Marquet R. Ehresmann B. Ehresmann C. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4945-4949Crossref PubMed Scopus (368) Google Scholar). During the early events of pre-mRNA splicing, there are several types of interactions through a network of RNA-RNA, RNA-protein, and protein-protein contacts (3Berglund J.A. Abovich N. Rosbash M. Genes Dev. 1998; 12: 858-867Crossref PubMed Scopus (187) Google Scholar, 4Verma M. Kurl R.N. Blass C. Davidson E.A. Cancer Biochem. Biophys. 1997; 15: 211-220PubMed Google Scholar, 5Valcarcel J. Gaur R.K. Singh R. Green M.R. Science. 1996; 273: 1706-1709Crossref PubMed Scopus (225) Google Scholar, 6Sontheimer E.J. Steitz J.A. Science. 1993; 262: 1989-1996Crossref PubMed Scopus (292) Google Scholar). In addition, RNA-RNA interactions are also involved in the cleavage of tRNA by RNase P (7Guerrier-Takada C. Gardiner K. Marsh T. Pace N. Altman S. Cell. 1983; 35: 849-857Abstract Full Text PDF PubMed Scopus (1984) Google Scholar, 8Oh B.K. Pace N.R. Nucleic Acids Res. 1994; 22: 4087-4094Crossref PubMed Scopus (122) Google Scholar, 9Baer M.F. Reilly R.M. McCorkle G.M. Hai T.Y. Altman S. RajBhandary U.L. J. Biol. Chem. 1988; 263: 2344-2351Abstract Full Text PDF PubMed Google Scholar), and in genetic regulations in bacteria (10Henkin T.M. Annu. Rev. Genet. 1996; 30: 35-57Crossref PubMed Scopus (86) Google Scholar, 11Lease R.A. Cusick M.E. Belfort M. Proc. Natl. Acad. Sci. U. S. A. 1999; 95: 12456-12461Crossref Scopus (233) Google Scholar), eukaryotes (12Moss E.G. Lee R.C. Ambros V. Cell. 1997; 88: 637-646Abstract Full Text Full Text PDF PubMed Scopus (676) Google Scholar), plants (13Jorgensen R.A. Atkinson R.G. Forster R.L. Lucas W.J. Science. 1998; 279: 1486-1487Crossref PubMed Scopus (188) Google Scholar), mammals (14Panning B. Jaenisch R. Cell. 1998; 93: 305-308Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar), and plasmids (15Eguchi Y. Tomizawa J. Cell. 1990; 60: 199-209Abstract Full Text PDF PubMed Scopus (109) Google Scholar). An intermediate step in morphogenesis of phi29, a bacterial virus that infects Bacillus subtilis, is the formation of a DNA-filled capsid generated through the translocation of genomic dsDNA into an empty capsid shell (procapsid or prohead), a process called DNA packaging (for reviews, see Ref. 16Guo P. Trottier M. Semin. Virol. 1994; 5: 27-37Crossref Scopus (34) Google Scholar). Translocation of double-stranded DNA into the procapsid requires a pair of noncapsid proteins and a virus-encoded RNA (17Guo P. Erickson S. Anderson D. Science. 1987; 236: 690-694Crossref PubMed Scopus (280) Google Scholar, 18Guo P. Bailey S. Bodley J.W. Anderson D. Nucleic Acids Res. 1987; 15: 7081-7090Crossref PubMed Scopus (75) Google Scholar), called pRNA1 (p for packaging). The 120-base pRNA participates in the DNA packaging reaction but is not a part of the mature phi29 virion. The pRNA binds to the connector (the unique site where DNA goes through) of procapsids in the presence of Mg2+ (19Garver K. Guo P. RNA (N. Y.). 1997; 3: 1068-1079PubMed Google Scholar). The pRNA also appears to be directly involved in the DNA translocation process and leaves the procapsid after DNA packaging is completed (20Chen C. Guo P. J. Virol. 1997; 71: 3864-3871Crossref PubMed Google Scholar). To elucidate the role of the pRNA in this DNA translocating motor, it is crucial to know how many copies of the pRNA are involved in each DNA packaging event. We have developed three approaches to determine the stoichiometry of the pRNA. These three approaches have led to the conclusion that six pRNAs are required for the function of each motor. The first determination of pRNA stoichiometry involved the use of binomial distribution (21Trottier M. Guo P. J. Virol. 1997; 71: 487-494Crossref PubMed Google Scholar, 22Chen C. Trottier M. Guo P. Nucleic Acids Symp. Ser. 1997; 36: 190-193Google Scholar). pRNAs with mutations in the 5′/3′ paired region (the DNA translocation domain) retained procapsid binding capacity but failed to package DNA. When mutant pRNA and wild-type pRNA were mixed at various ratios in in vitroassembly assays, the probability of procapsids that possess a certain amount of mutant and a certain amount of wild-type pRNA was determined by the expansion of a binomial (p + q)Z, where Z is the total number of pRNA per procapsid, andp and q represent the percent of mutant and wild-type pRNA, respectively, used in reaction mixtures. For example, if we assume that Z is 3, the probability of all combinations of mutant and wild-type pRNAs on a given procapsid can be predicted by the expansion of the binomial: (p +q)3 = p 3 + 3p 2 q + 3pq 2 +q 3 = 100%. The yield of virions from empirical data was plotted and compared with a series of predicted curves to find a best fit. Our results showed that approximately five to six pRNAs were needed for each procapsid to package DNA, explaining the high inhibition efficiency of mutant pRNA (23Trottier M. Zhang C.L. Guo P. J. Virol. 1996; 70: 55-61Crossref PubMed Google Scholar). The second approach for stoichiometry determination utilized serial dilution factor of pRNA versus the yield of virions assembled in vitro (21Trottier M. Guo P. J. Virol. 1997; 71: 487-494Crossref PubMed Google Scholar). The larger the stoichiometry of the component, the more dramatic the influence of the dilution factor on the reaction. A slope of one indicates that one copy of the component is involved in the assembly of one virion. A slope larger than one would indicate multiple-copy involvement. Our result of log plots dilution factor versus virions assembled support the conclusion that the stoichiometry of pRNA in DNA packaging is between five and six. The stoichiometry of pRNA was also investigated by the mixing together of inactive mutant pRNAs, each having interactive complementary loops, in DNA packaging reactions to determine the common multiples (24Guo P. Zhang C. Chen C. Trottier M. Garver K. Mol. Cell. 1998; 2: 149-155Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar, 25Zhang F. Lemieux S. Wu X. St.-Arnaud S. McMurray C.T. Major F. Anderson D. Mol. Cell. 1998; 2: 141-147Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). Since infectious virions could be produced by mixing two inactive pRNAs with interlocking loops, we showed that the stoichiometry of the pRNA is a multiple of two (24Guo P. Zhang C. Chen C. Trottier M. Garver K. Mol. Cell. 1998; 2: 149-155Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar, 25Zhang F. Lemieux S. Wu X. St.-Arnaud S. McMurray C.T. Major F. Anderson D. Mol. Cell. 1998; 2: 141-147Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). Likewise, since infectious virions could also be produced by mixing together another set of three inactive pRNAs with interlocking loops, we showed that the stoichiometry of the pRNA is also a multiple of three. Therefore, we confirmed that the stoichiometry of pRNA in DNA packaging is the common multiple of 2 and 3, that is, 6 or 12. Together with the results from binomial distribution and serial dilution analyses (23Trottier M. Zhang C.L. Guo P. J. Virol. 1996; 70: 55-61Crossref PubMed Google Scholar,71Wichitwechkarn J. Bailey S. Wodley J.W. Anderson D. Nucleic Acids Res. 1989; 17: 3459-3468Crossref PubMed Scopus (47) Google Scholar), we confirmed that the stoichiometry of pRNA was six. The requirement of six pRNAs in phi29 DNA packaging is supported by the finding that a pRNA dimer is the building block in the assembly of pRNA hexamers (26Chen C. Sheng S. Shao Z. Guo P. J. Biol. Chem. 2000; 275: 17510-17516Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). We found that the sequence in the assembly of hexamers is dimer → tetramer → hexamer. The low resolution three-dimensional structure of pRNA monomers and dimers has been shown by cryo-atomic force microscopy (26Chen C. Sheng S. Shao Z. Guo P. J. Biol. Chem. 2000; 275: 17510-17516Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 27Trottier M. Mat-Arip Y. Zhang C. Chen C. Sheng S. Shao Z. Guo P. RNA (N. Y.). 2000; 6: 1257-1266Crossref PubMed Scopus (48) Google Scholar). Monomers exhibit a “check mark” shape, while the dimer displays an elongated shape, with a size approximately twice as long as the monomer (27Trottier M. Mat-Arip Y. Zhang C. Chen C. Sheng S. Shao Z. Guo P. RNA (N. Y.). 2000; 6: 1257-1266Crossref PubMed Scopus (48) Google Scholar). The finding that phi29 RNA forms hexamers as part of an ATP-driven DNA translocation machinery (24Guo P. Zhang C. Chen C. Trottier M. Garver K. Mol. Cell. 1998; 2: 149-155Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar, 25Zhang F. Lemieux S. Wu X. St.-Arnaud S. McMurray C.T. Major F. Anderson D. Mol. Cell. 1998; 2: 141-147Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar, 28Guo P. Peterson C. Anderson D. J. Mol. Biol. 1987; 197: 229-236Crossref PubMed Scopus (226) Google Scholar) has suggested commonalties between viral DNA packaging and other universal DNA/RNA-tracking/riding processes, including DNA replication (29Young M.C. Schultz D.E. Ring D. von Hippel P.H. J. Mol. Biol. 1994; 235: 1447-1458Crossref PubMed Scopus (76) Google Scholar) and RNA transcription (24Guo P. Zhang C. Chen C. Trottier M. Garver K. Mol. Cell. 1998; 2: 149-155Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar,30Doering C. Ermentrout B. Oster G. Biophys. J. 1995; 69: 2256-2267Abstract Full Text PDF PubMed Scopus (76) Google Scholar). The DNA/RNA-tracking/riding enzymes include helicases (31Young M. Kuhl S. von Hippel P. J. Mol. Biol. 1994; 235: 1436-1446Crossref PubMed Scopus (58) Google Scholar, 32West S.C. Cell. 1996; 86: 177-180Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 33Egelman E.H. Structure (Lond.). 1996; 4: 759-762Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 34San Martin M.C. Gruss C. Carazo J.M. J. Mol. Biol. 1997; 268: 15-20Crossref PubMed Scopus (88) Google Scholar), enhancers (35Herendeen D.R. Kassavetis G.A. Geiduschek E.P. Science. 1992; 256: 1298-1303Crossref PubMed Scopus (108) Google Scholar), Escherichia coli transcription terminator Rho (36Geiselmann J. Wang Y. Seifried S.E. von Hippel P.H. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7754-7758Crossref PubMed Scopus (100) Google Scholar), yeast PCNA, and DNA polymerase III holoenzyme (37Geiduschek E.P. Chem. Biol. 1997; 2: 123-125Abstract Full Text PDF Scopus (11) Google Scholar), each of which also forms a hexameric complex or shape. Viral DNA packaging, cellular DNA replication, and RNA transcription are all involved in the relative movement of two components, one of which is nucleic acid. It would be intriguing to show how the phi29 pRNA may play a role that is similar to that of protein enzymes. It is speculated that transportation of macromolecules by RNA complex, assembled via intermolecular lop/loop interaction, exists in the life cycle of eukaryotic cell differentiation (38Ferrandon D. Koch I. Westhof E. Nusslein-Volhard C. EMBO J. 1997; 16: 1751-1758Crossref PubMed Scopus (184) Google Scholar). We have determined the pathways and conditions for the assembly of functional pRNA hexamers, where dimers serve as the building blocks (26Chen C. Sheng S. Shao Z. Guo P. J. Biol. Chem. 2000; 275: 17510-17516Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). In this study, the three-dimensional structure of the monomer and the dimer was probed by chemical modification interference, site-specific photoaffinity cross-linking, and cryo-AFM. This paper provides a first report of pRNA three-dimensional structural constraints. pRNAs were prepared as described before (39Zhang C.L. Lee C.-S. Guo P. Virology. 1994; 201: 77-85Crossref PubMed Scopus (94) Google Scholar, 40Zhang C.L. Trottier M. Guo P.X. Virology. 1995; 207: 442-451Crossref PubMed Scopus (53) Google Scholar, 41Chen C. Zhang C. Guo P. RNA (N. Y.). 1999; 5: 805-818Crossref PubMed Scopus (103) Google Scholar). Briefly, plasmid DNA was used as a template for polymerase chain reaction (PCR) to prepare DNA templates forin vitro transcription reaction. The primers used to produce DNA template, as well as reverse transcriptase primer extension, are listed in Table I. The PCR products were purified using Qiaex II (Qiagen, Inc.) and made ready for transcription with a T7 Ribomax transcription kit (Promega, Inc.). Preparation of covalently linked dimer has been described previously (26Chen C. Sheng S. Shao Z. Guo P. J. Biol. Chem. 2000; 275: 17510-17516Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar).Table IOligonucleotidesDesignationSequenceSizeLocation (residues)5′ T7–755′TAATACGACTCACTATAGTTGATTGGTTGTCAAT3′3475–913′ P715′GTATGTGGGCTGAACTCAATCAGGG3′2571–475′ SP6–785′ATTTAGGTGACACTATAGATTGGTTGTCAATCAT3′3478–943′ P775′AACAAAGTATGTGGGCT3′1777–615′ T7–1085′TAATACGACTCACTATAGCTACTTTCCTAAAGGAA3′35108–43′ P1075′GGCACTTTTGCCACGATTGA3′20107–87P75′TAATACGACTCACTATAGCAATGGT3′251–10P115′TTAGCAAAGTAGCGTGCACTTTTG3′24120–965′ G235′TAATACGACTCACTATAGGTCATGTGTATGTTGGG3′3523–393′ C97b′5′GCCATGATTGACACGCAATC3′2097–78P103–825′ACTTTTGCCATGATTGACGGACA3′23103–81 Open table in a new tab After synthesis, pRNAs were treated with RNase-free DNase I and then subjected to 8 m urea, 8% polyacrylamide gel electrophoresis. Bands of correct size visualized by UV shadow were excised from the gel, and the RNA was eluted overnight at 37 °C in 0.5 m ammonium acetate, 0.1% SDS, 0.1 mm EDTA. After elution, the pRNAs were ethanol-precipitated, washed with 70% ethanol, and resuspended in nuclease-free H2O. Secondary structure predictions for the pRNA were made using the method of Zuker (42Zuker M. Science. 1989; 244: 48-52Crossref PubMed Scopus (1712) Google Scholar). Two pRNAs 5′/3′ B-a′ and 23/97 A-b′ (Fig. 1) were used to produce dimer (41Chen C. Zhang C. Guo P. RNA (N. Y.). 1999; 5: 805-818Crossref PubMed Scopus (103) Google Scholar). However, only pRNA 5′/3′ B-a′ was modified by chemicals. In addition, primers used in reverse transcriptase primer extension were specific to pRNA 5′/3′ B-a′ only. This strategy was to avoid ambiguity primer extension results. Purified pRNA (15 pmol) was incubated in buffer D (50 mm sodium cacodylate, pH 7.0, 10 mmMgCl2, 100 mm NaCl) in a final volume of 50 µl. One µl of DMS (diluted 1:3 in 100% ethanol) was added to the reaction. Unmodified control RNA was prepared by including 1 µl of 100% ethanol in the reaction instead of DMS. The reactions were incubated for 3 min at 37 °C. Reactions were stopped by the addition of 6.5 µl of DMS stop buffer (1.0 m Tris acetate, pH 7.5, 1.0 m 2-mercaptoethanol, 1.5 m sodium acetate, 0.1 mm EDTA) and then incubated on ice for 10 min (43Moazed U. Stern S. Noller H.F. J. Mol. Biol. 1986; 187: 399-416Crossref PubMed Scopus (444) Google Scholar). Reaction volumes were brought up to 200 µl with DEPC-treated water and extracted once with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) and once with an equal volume of chloroform:isoamyl alcohol (24:1), followed by ethanol precipitation at −20 °C for several hours. Alternatively, the reactions were ethanol-precipitated directly after termination of the reaction. Pelleted RNA was resuspended in 8 µl of DEPC-treated water. Purified pRNA (15 pmol) in buffer C (50 mmsodium borate, pH 8.0, 20 mm magnesium acetate, 100 mm NaCl) at a final volume of 25 µl was mixed with 25 µl of CMCT (12 mg/ml in buffer C). For unmodified control RNAs, 25 µl of buffer C was added instead of CMCT. Reactions were incubated for 30 min at 37 °C and phenol-extracted and/or ethanol-precipitated as described for DMS modification. 1.5 µl of DMS or 25 µl of CMCT at a concentration of 37 mg/ml was used to modify pRNA 5′/3′ B-a′. The modified pRNA was subjected to electrophoresis in 8m urea, 8% polyacrylamide gel in TBE (89 mmTris borate, 2 mm EDTA, pH 8.0) buffer (39Zhang C.L. Lee C.-S. Guo P. Virology. 1994; 201: 77-85Crossref PubMed Scopus (94) Google Scholar, 41Chen C. Zhang C. Guo P. RNA (N. Y.). 1999; 5: 805-818Crossref PubMed Scopus (103) Google Scholar). The band was excised using UV shadow and passively eluted overnight at 37 °C in the elution buffer, followed by ethanol precipitation. The modified pRNA was washed with 70% ethanol, and the pellet was resuspended in DEPC-treated water. An equal molar ratio of the modified pRNA was mixed with pRNA 23/97 A-b′ in TBM (89 mm Tris borate, 5 mmMgCl2, pH 7.6) buffer. The mixture was then run on 8% TBM polyacrylamide gel at 100 volts at 4 °C. Gel was stained with ethidium bromide for visualization. Top and bottom bands were excised and passively eluted at 4 °C in the elution buffer, precipitated by ethanol, and resuspended in DEPC-treated water. The top and bottom bands were dialyzed against TE (10 mm Tris-HCl, 1 mm EDTA, pH 8.0) for 1 h before being used in primer extension. Guanosine 5′-phosphorothioate-containing cp-pRNAs were prepared by in vitro transcription of DNA templates with T7 RNA polymerase in the presence of 40 mm Tris-HCl, pH 7.5, 12 mm MgCl2, 2 mm spermidine, 10 mm NaCl, 1 mm ATP, 1 mm CTP, 1 mm UTP, 0.2 mm GTP, [α-32P]GTP, 8 mm guanosine 5′-phosphorothioate, at 37 °C for 4 h. Transcripts were purified by electrophoresis through 8% polyacrylamide, 8 m urea gels, viewed by autoradiography, and passively eluted into 10 mm Tris-HCl, pH 8, 0.3m sodium acetate, 1 mm EDTA, and 0.1% SDS. Transcripts were ethanol-precipitated and dried in vacuo. Transcripts containing the 5′-terminal phosphate of 5′-guanosine monophosphorothioate were coupled to an azidophenacyl group (44Burgin A.B. Pace N.R. EMBO J. 1990; 9: 4111-4118Crossref PubMed Scopus (156) Google Scholar). For cross-linking, the conjugated cp-pRNA was incubated in TMS (50 mm Tris-HCl, pH 7.8, 10 mmMgCl2, 100 mm NaCl) and then exposed to UV light (Phillips, UVB 20W-TL01, 311 nm) for 10–20 min at 0 °C. Under these conditions, no photoagent-independent cross-links were detected. The efficiency of intramolecular cross-links (TableII) was measured as a fraction of the total input azido-pRNA using densitometric readings of individual intramolecular cross-linked bands.Table IIAnalysis of crosslinked pRNA speciespRNA2-aIndividual cross-linked species are designated numerically beginning with the species migrating most slowly in the gel (for example, cross-linked species detected using cp-pRNA 75/71 are denoted apa75–1 and apa75–2).Photo-agent attachment siteActivityDNA packaging2-dConcentration of cross-linked cp-pRNA species was identical to that of its uncross-linked control.Cross-linked nucleotides2-eND, not determined.Efficiency of cross-link2-bEfficiency indicates percent conversion to cross-linked species.Procapsid binding2-cRelative procapsid binding indexes are displayed with a “+” indicating that the procapsid binding activity of the cp-RNAs was close to or equal to wild-type pRNA.pfu/mlWild-type pRNA+5.5 × 106Cp-pRNA 75/71G75+4.5 × 106apa75–1‖16.9+2.3 × 104NDapa75–218.4+1.6 × 104A26, U27, G28, U29, G30Cp-pRNA 78/77G78+3.1 × 106apa78–1‖13.7+7.5 × 104NDapa78–216.2+8.1 × 104U31Cp-pRNA 108/107G108+6.3 × 106apa108–1‖10.7+2.0 × 103NDapa108–28.2+1.1 × 103C10, G112-a Individual cross-linked species are designated numerically beginning with the species migrating most slowly in the gel (for example, cross-linked species detected using cp-pRNA 75/71 are denoted apa75–1 and apa75–2).2-b Efficiency indicates percent conversion to cross-linked species.2-c Relative procapsid binding indexes are displayed with a “+” indicating that the procapsid binding activity of the cp-RNAs was close to or equal to wild-type pRNA.2-d Concentration of cross-linked cp-pRNA species was identical to that of its uncross-linked control.2-e ND, not determined. Open table in a new tab To separate intermolecular from intramolecular (monomeric) cross-links, linear 5–20% sucrose gradients were prepared in TB (50 mm Tris-HCl, pH 7.6, 89 mm boric acid) buffer. Purified cross-linked species were loaded onto the top of the gradient and spun at 50,000 rpm for 15 h at 4 °C in a SW55 rotor. As sedimentation markers, both pRNA dimers and monomers were run on identical gradients. After sedimentation, fractions were collected at 12 drops each and subjected to scintillation counting. The purification of procapsids (18Guo P. Bailey S. Bodley J.W. Anderson D. Nucleic Acids Res. 1987; 15: 7081-7090Crossref PubMed Scopus (75) Google Scholar, 45Guo P. Rajogopal B. Anderson D. Erickson S. Lee C.-S. Virology. 1991; 185: 395-400Crossref PubMed Scopus (42) Google Scholar, 46Guo P. Erickson S. Xu W. Olson N. Baker T.S. Anderson D. Virology. 1991; 183: 366-373Crossref PubMed Scopus (101) Google Scholar), gp16, DNA-gp3 (47Salas M. Annu. Rev. Biochem. 1991; 60: 39-71Crossref PubMed Scopus (343) Google Scholar); the preparation of neck and tail proteins (48Lee C.S. Guo P. Virology. 1994; 202: 1039-1042Crossref PubMed Scopus (54) Google Scholar, 49Lee C.S. Guo P. J. Virol. 1995; 69: 5018-5023Crossref PubMed Google Scholar); and the assembly of infectious phi29 virionin vitro (48Lee C.S. Guo P. Virology. 1994; 202: 1039-1042Crossref PubMed Scopus (54) Google Scholar, 49Lee C.S. Guo P. J. Virol. 1995; 69: 5018-5023Crossref PubMed Google Scholar, 50Guo P. Grimes S. Anderson D. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 3505-3509Crossref PubMed Scopus (136) Google Scholar) have been described previously. RNA (1.5 pmol) was mixed with 0.1 pmol of γ-32P-end-labeled primer and heated to 90 °C for 2 min. The mixtures were cooled to 30 °C in a water bath (∼1 h). RNA/primer mixtures were mixed with 0.5–1 unit of avian myeloblastosis virus reverse transcriptase (Promega), 1 µl of dNTPs (10 mm each), and 2 µl of 5× RT buffer (250 mm Tris-HCl, pH 7.9, 30 mm MgCl2, 10 mm spermidine, 50 mm NaCl) in a final volume of 10 µl. Reactions were incubated at 55 °C for 30 min and stopped by the addition of an equal volume of 2× loading buffer (98% formamide, 10 mm EDTA, 0.01% bromphenol blue, 0.01% xylene cyanol). Samples were heated to 90 °C for 2 min and placed on ice before electrophoresis. Samples were subjected to sequencing-type polyacrylamide gel electrophoresis, and dideoxy sequencing lanes were run adjacent to experimental chemical modification reactions to facilitate mapping of individual bases. For cross-linked products, individual 5′-32P-labeled oligonucleotide primers targeting various regions of the cp-pRNAs were hybridized to varying amounts of purified intramolecular cross-link species (75 °C, 2 min, then slowly cooled over 10 min to 37 °C). Oligonucleotides were extended by avian myeloblastosis virus reverse transcriptase at 45 °C for 20 min. The procedure for cryo-AFM pRNA image analysis has been reported previously (26Chen C. Sheng S. Shao Z. Guo P. J. Biol. Chem. 2000; 275: 17510-17516Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 27Trottier M. Mat-Arip Y. Zhang C. Chen C. Sheng S. Shao Z. Guo P. RNA (N. Y.). 2000; 6: 1257-1266Crossref PubMed Scopus (48) Google Scholar). The oligomeric pRNAs were purified from native PAGE gel. Briefly, to prepare the sample for cryo-AFM imaging, a piece of mica was freshly cleaved and soaked with spermidine. Excess spermidine was removed by repeated rinses with deionized water. A pRNA sample (10 µg/ml) was applied to mica preincubated with TBM buffer. After 30 s, the unbound pRNA was removed by rinsing with the same buffer. Before the sample was transferred to cryo-AFM for imaging, it was quickly rinsed with deionized water (<1 s), and the solution was removed with dry nitrogen within seconds (51Han W. Mou J. Sheng J. Yang J. Shao Z. Biochemistry. 1995; 34: 8215-8220Crossref PubMed Scopus (87) Google Scholar). All cryo-AFM images were collected at 80 K, as described elsewhere (52Zhang Y. Sheng S. Shao Z. Biophys. J. 1996; 71: 2168-2176Abstract Full Text PDF PubMed Scopus (79) Google Scholar). Scan lines were removed by an offline matching of the basal line. Calibration of the scanner was performed with mica and 1-µm dot matrix. Circular permutation allows the introduction of new 5′/3′ termini of pRNA while maintaining the correct folding of RNA molecule (40Zhang C.L. Trottier M. Guo P.X. Virology. 1995; 207: 442-451Crossref PubMed Scopus (53) Google Scholar, 53Pan T. Gutell R.R. Uhlenbeck O.C. Science. 1991; 254: 1361-1364Crossref PubMed Scopus (93) Google Scholar, 54Nolan J.M. Burke D.H. Pace N.R. Science. 1993; 261: 762-765Crossref PubMed Scopus (102) Google Scholar). Two tandem pRNA coding sequences separated by a three-base sequence were cloned into a plasmid (40Zhang C.L. Trottier M. Guo P.X. Virology. 1995; 207: 442-451Crossref PubMed Scopus (53) Google Scholar, 55Zhang C.L. Tellinghuisen T. Guo P. RNA (N. Y.). 1997; 3: 315-322PubMed Google Scholar). PCR primer pairs complementary to various locations within the tandem pRNA coding sequences were designed to synthesize PCR fragments for transcription of cp-pRNA. We have shown that nonessential bases or their adjacent bases can be used as new termini for constructing active cp-pRNA. The circular permutation system greatly facilitates the construction of mutant pRNA via PCR and the labeling of any specific internal base by radioactive or photoaffinity agents (Fig.1). We performed photo-affinity cross-linking by attaching a photosensitive agent to the 5′-end of the pRNA. The locations of the new end points in cp-pRNAs used in this analysis were selected primarily due to their ability to maintain wild-type activity as well as for their strategic positions in the secondary structure (40Zhang C.L. Trottier M. Guo P.X. Virology. 1995; 207: 442-451Crossref PubMed Scopus (53) Google Scholar, 55Zhang C.L. Tellinghuisen T. Guo P. RNA (N. Y.). 1997; 3: 315-322PubMed Google Scholar, 56Garver K. Guo P. J. Biol. Chem. 2000; 275: 2817-2824Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). One of the sites is located within the terminal helix necessary for DNA packaging, while two of the other sites chosen are located within interior sequences involved in procapsid binding. It was expected that data from these constructs would provide structural information regarding the two functional domains and their position relative to one another within the pRNA. It has been reported that cp-pRNAs form the native structure, while the 5′ and 3′-ends are relocated (40Zhang C.L. Trottier M. Guo P.X. Virology. 1995; 207: 442-451Crossref PubMed Scopus (53) Google Scholar). Nevertheless, it was important that the cp-pRNAs studied here reflect the native pRNA structure accurately. Previous analysis of the three cp-pRNAs chosen for this study has revealed that these cp-pRNAs possess both wild-type procapsid binding and DNA packaging activity (40Zhang C.L. Trottier M. Guo P." @default.
• W1987756568 created "2016-06-24" @default.
• W1987756568 creator A5069765017 @default.
• W1987756568 creator A5071704827 @default.
• W1987756568 creator A5072811820 @default.
• W1987756568 creator A5077781145 @default.
• W1987756568 creator A5078994341 @default.
• W1987756568 creator A5079142449 @default.
• W1987756568 date "2001-08-01" @default.
• W1987756568 modified "2023-09-28" @default.
• W1987756568 title "Three-dimensional Interaction of Phi29 pRNA Dimer Probed by Chemical Modification Interference, Cryo-AFM, and Cross-linking" @default.
• W1987756568 cites W1005666322 @default.
• W1987756568 cites W1500182662 @default.
• W1987756568 cites W1548161051 @default.
• W1987756568 cites W1551902334 @default.
• W1987756568 cites W1555193743 @default.
• W1987756568 cites W1664901425 @default.
• W1987756568 cites W1727214066 @default.
• W1987756568 cites W1819107170 @default.
• W1987756568 cites W1836938177 @default.
• W1987756568 cites W1966384509 @default.
• W1987756568 cites W1976037077 @default.
• W1987756568 cites W1976626323 @default.
• W1987756568 cites W1980272310 @default.
• W1987756568 cites W1980779739 @default.
• W1987756568 cites W1984113668 @default.
• W1987756568 cites W1984262288 @default.
• W1987756568 cites W1984724155 @default.
• W1987756568 cites W1985735063 @default.
• W1987756568 cites W1987866787 @default.
• W1987756568 cites W1988118424 @default.
• W1987756568 cites W1993411667 @default.
• W1987756568 cites W1996642589 @default.
• W1987756568 cites W2000270965 @default.
• W1987756568 cites W2006213828 @default.
• W1987756568 cites W2007342042 @default.
• W1987756568 cites W2008557779 @default.
• W1987756568 cites W2011636799 @default.
• W1987756568 cites W2017021579 @default.
• W1987756568 cites W2017024770 @default.
• W1987756568 cites W2017313617 @default.
• W1987756568 cites W2017370325 @default.
• W1987756568 cites W2020790990 @default.
• W1987756568 cites W2020865862 @default.
• W1987756568 cites W2021333801 @default.
• W1987756568 cites W2022346667 @default.
• W1987756568 cites W2029286417 @default.
• W1987756568 cites W2031214064 @default.
• W1987756568 cites W2031784445 @default.
• W1987756568 cites W2037964831 @default.
• W1987756568 cites W2038277626 @default.
• W1987756568 cites W2038652232 @default.
• W1987756568 cites W2040069810 @default.
• W1987756568 cites W2042747303 @default.
• W1987756568 cites W2049455910 @default.
• W1987756568 cites W2052343947 @default.
• W1987756568 cites W2056043967 @default.
• W1987756568 cites W2059178379 @default.
• W1987756568 cites W2059329364 @default.
• W1987756568 cites W2060247217 @default.
• W1987756568 cites W2060769308 @default.
• W1987756568 cites W2063702812 @default.
• W1987756568 cites W2072421613 @default.
• W1987756568 cites W2072422539 @default.
• W1987756568 cites W2076670861 @default.
• W1987756568 cites W2079361294 @default.
• W1987756568 cites W2101073519 @default.
• W1987756568 cites W2107564642 @default.
• W1987756568 cites W2110997966 @default.
• W1987756568 cites W2111440720 @default.
• W1987756568 cites W2112717830 @default.
• W1987756568 cites W2116362436 @default.
• W1987756568 cites W2117293088 @default.
• W1987756568 cites W2132392842 @default.
• W1987756568 cites W2133448502 @default.
• W1987756568 cites W2140909392 @default.
• W1987756568 cites W2156247049 @default.
• W1987756568 cites W2166760368 @default.
• W1987756568 cites W4292199659 @default.
• W1987756568 doi "https://doi.org/10.1074/jbc.m100045200" @default.
• W1987756568 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11371551" @default.
• W1987756568 hasPublicationYear "2001" @default.
• W1987756568 type Work @default.
• W1987756568 sameAs 1987756568 @default.
• W1987756568 citedByCount "32" @default.
• W1987756568 countsByYear W19877565682012 @default.
• W1987756568 countsByYear W19877565682013 @default.
• W1987756568 countsByYear W19877565682015 @default.
• W1987756568 countsByYear W19877565682016 @default.
• W1987756568 countsByYear W19877565682017 @default.
• W1987756568 countsByYear W19877565682020 @default.
• W1987756568 crossrefType "journal-article" @default.
• W1987756568 hasAuthorship W1987756568A5069765017 @default.
• W1987756568 hasAuthorship W1987756568A5071704827 @default.
• W1987756568 hasAuthorship W1987756568A5072811820 @default.
• W1987756568 hasAuthorship W1987756568A5077781145 @default.
• W1987756568 hasAuthorship W1987756568A5078994341 @default.
• W1987756568 hasAuthorship W1987756568A5079142449 @default.

• next