SemOpenAlex |

SemOpenAlex

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1988406918> ?p ?o ?g. }

Showing items 1 to 100 of ±129 with 100 items per page.

W1988406918 endingPage "10750" @default.
W1988406918 startingPage "10746" @default.
W1988406918 abstract "Calcium mobilization from intracellular storage organelles is a key component of the second messenger system inducing cell activation. Calcium transport ATPases associated with intracellular calcium storage organelles play a major role in controlling this process by accumulating calcium from the cytosol into intracellular calcium pools. In this study the modulation of the expression of the sarco-endoplasmic reticulum calcium transport ATPase (SERCA) isoenzymes has been studied in lymphocytes undergoing phorbol myristate acetate and ionomycin-induced activation. In several T lymphocyte cell lines a combined treatment by the two drugs resulted in an approximately 90% decrease of the expression of the calcium pump isoform recognized by the PLIM430 isoform-specific antibody, whereas the expression of the SERCA 2b isoform was increased approximately 2-fold. Phorbol ester or ionomycin applied separately was ineffective. In Jurkat T cells the down-modulation of expression of the SERCA isoform recognized by the PLIM430 antibody appeared concomitantly with the induction of interleukin-2 expression and could be inhibited by the immunosuppressant drug cyclosporine-A. These data indicate that T cell activation induces a selective and cyclosporine-A-sensitive modulation of the expression of the SERCA calcium pump isoforms. This reflects a profound reorganization of the calcium homeostasis of T cells undergoing activation and may open new avenues in the understanding of the plasticity of the calcium homeostasis of differentiating cells and in the pharmacological modulation of lymphocyte function. Calcium mobilization from intracellular storage organelles is a key component of the second messenger system inducing cell activation. Calcium transport ATPases associated with intracellular calcium storage organelles play a major role in controlling this process by accumulating calcium from the cytosol into intracellular calcium pools. In this study the modulation of the expression of the sarco-endoplasmic reticulum calcium transport ATPase (SERCA) isoenzymes has been studied in lymphocytes undergoing phorbol myristate acetate and ionomycin-induced activation. In several T lymphocyte cell lines a combined treatment by the two drugs resulted in an approximately 90% decrease of the expression of the calcium pump isoform recognized by the PLIM430 isoform-specific antibody, whereas the expression of the SERCA 2b isoform was increased approximately 2-fold. Phorbol ester or ionomycin applied separately was ineffective. In Jurkat T cells the down-modulation of expression of the SERCA isoform recognized by the PLIM430 antibody appeared concomitantly with the induction of interleukin-2 expression and could be inhibited by the immunosuppressant drug cyclosporine-A. These data indicate that T cell activation induces a selective and cyclosporine-A-sensitive modulation of the expression of the SERCA calcium pump isoforms. This reflects a profound reorganization of the calcium homeostasis of T cells undergoing activation and may open new avenues in the understanding of the plasticity of the calcium homeostasis of differentiating cells and in the pharmacological modulation of lymphocyte function. Calcium as a second messenger is a key component of the cellular signaling network controlling lymphocyte function (Refs. 1Weiss A. Imboden J.B. Advances Immunol. 1987; 41: 1-38Crossref PubMed Scopus (225) Google Scholar, 2Premack B.A. Gardner P. Am. J. Physiol. 1992; 263: C1119-C1140Crossref PubMed Google Scholar, 3Crabtree G.R. Clipstone N.A. Annu. Rev. Biochem. 1994; 63: 1045-1083Crossref PubMed Scopus (627) Google Scholar and references therein). Activation of the T cell receptor complex and associated coreceptors by antigen presenting cells leads to the formation of two second messengers, diacylglycerol and inositol 1,4,5-trisphosphate (IP3). 1The abbreviations used are: IP3,d-myo-inositol 1,4,5-trisphosphate; SERCA, sarco-endoplasmic reticulum calcium transport ATPase; PMA, phorbol 12-myristate 13-acetate; PLIM430, monoclonal antibody directed against the platelet internal membrane calcium transport ATPase isoform; SERCAPLIM430, the SERCA isoform recognized by the PLIM430 antibody; IID8, monoclonal antibody directed against SERCA 2 enzymes; IL-2, interleukin-2; ELISA, enzyme-labeled immunosorbent assay; PCR, polymerase chain reaction. 1The abbreviations used are: IP3,d-myo-inositol 1,4,5-trisphosphate; SERCA, sarco-endoplasmic reticulum calcium transport ATPase; PMA, phorbol 12-myristate 13-acetate; PLIM430, monoclonal antibody directed against the platelet internal membrane calcium transport ATPase isoform; SERCAPLIM430, the SERCA isoform recognized by the PLIM430 antibody; IID8, monoclonal antibody directed against SERCA 2 enzymes; IL-2, interleukin-2; ELISA, enzyme-labeled immunosorbent assay; PCR, polymerase chain reaction. The formation of diacylglycerol results in the activation of various cellular protein kinase C isoenzymes, and the binding of IP3 to its receptor induces the release of calcium into the cytosol from intracellular calcium storage organelles (1Weiss A. Imboden J.B. Advances Immunol. 1987; 41: 1-38Crossref PubMed Scopus (225) Google Scholar, 2Premack B.A. Gardner P. Am. J. Physiol. 1992; 263: C1119-C1140Crossref PubMed Google Scholar, 3Crabtree G.R. Clipstone N.A. Annu. Rev. Biochem. 1994; 63: 1045-1083Crossref PubMed Scopus (627) Google Scholar). Calcium mobilization from the endoplasmic reticulum also provokes a calcium influx across the plasma membrane (4Tsien R.Y. Pozzan T. Rink T.J. Nature. 1982; 295: 68-71Crossref PubMed Scopus (774) Google Scholar, 5Berridge M.J. Nature. 1993; 361: 315-325Crossref PubMed Scopus (6164) Google Scholar, 6Berridge M.J. Biochem. J. 1995; 312: 1-11Crossref PubMed Scopus (1046) Google Scholar, 7Putney J.W. Cell Calcium. 1990; 11: 611-624Crossref PubMed Scopus (1261) Google Scholar, 8Pozzan T. Rizzuto R. Volpe P. Meldolesi J Physiol. Rev. 1994; 74: 595-636Crossref PubMed Scopus (30) Google Scholar). These events lead to the activation of several inducible transcription factors such as NFκB, NFAT, or AP-1 (9Rothenberg E.V. Ward S.B. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9358-9365Crossref PubMed Scopus (169) Google Scholar). The induction of the transcription of activation-associated genes, e.g. the gene coding for IL-2 (9Rothenberg E.V. Ward S.B. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9358-9365Crossref PubMed Scopus (169) Google Scholar, 10Chen D. Rothenberg E.V. Mol. Cell. Biol. 1993; 13: 228-237Crossref PubMed Scopus (88) Google Scholar), or the α chain of the IL-2 receptor (11Leonard W.J. Krönke M. Peffer N.J. Depper J.M. Greene W.C. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 6281-6285Crossref PubMed Scopus (133) Google Scholar) leads to a profound reorganization of the structure and function of the cell, resulting in an activated phenotype. Endoplasmic reticulum associated calcium pumps (SERCA enzymes) accumulate calcium ions from the cytosol by ATP-dependent active transport into endoplasmic reticulum-associated calcium storage organelles (8Pozzan T. Rizzuto R. Volpe P. Meldolesi J Physiol. Rev. 1994; 74: 595-636Crossref PubMed Scopus (30) Google Scholar). Because the increase of cytosolic calcium concentration, as well as the depletion of intracellular calcium pools, generate several activatory signals (5Berridge M.J. Nature. 1993; 361: 315-325Crossref PubMed Scopus (6164) Google Scholar, 6Berridge M.J. Biochem. J. 1995; 312: 1-11Crossref PubMed Scopus (1046) Google Scholar, 7Putney J.W. Cell Calcium. 1990; 11: 611-624Crossref PubMed Scopus (1261) Google Scholar, 8Pozzan T. Rizzuto R. Volpe P. Meldolesi J Physiol. Rev. 1994; 74: 595-636Crossref PubMed Scopus (30) Google Scholar), SERCA activity, by refilling intracellular calcium pools, represents an important control mechanism of cell activation. The expression of SERCA isoenzymes is tissue-specific and developmentally regulated (12Korczak B. Zarain-Herzberg A. Brandl C.J. Ingles J. Green N.M. MacLennan D.H. J. Biol. Chem. 1988; 263: 4813-4819Abstract Full Text PDF PubMed Google Scholar, 13Lytton J. MacLennan D.H. J. Biol. Chem. 1988; 263: 15024-15031Abstract Full Text PDF PubMed Google Scholar, 14Wu K.D. Lee W.L. Wey J. Bungard D. Lytton J. Am. J. Physiol. 1995; 260: 775-784Crossref Google Scholar, 15Dode L. Wuytack F. Kools P.F. Baba-Aissa F. Raeymaekers L. Brik F. Van de Ven W.J.M. Casteels R. Biochem. J. 1996; 318: 689-699Crossref PubMed Scopus (49) Google Scholar, 16Lacabaratz C. Corvazier E. Kovàcs T. Bobe R. Wuytack F. Papp B. Enouf J. Biochem. J. 1996; 318: 359-360Crossref PubMed Scopus (10) Google Scholar). Previously, we have shown that in human cell lines of hemopoietic origin, isoform-specific anti-SERCA monoclonal antibodies can detect two distinct enzyme species that are coexpressed in the same cells (17Papp B. Enyedi A. Kovàcs T. Sarkadi B. Wuytack F. Thastrup O. Gàrdos G. Bredoux R. Levy-Toledano S. Enouf J. J. Biol. Chem. 1991; 266: 14593-14596Abstract Full Text PDF PubMed Google Scholar, 18Papp B. Enyedi A. Pàszty K. Kovàcs T. Sarkadi B. Gàrdos G. Magnier C. Wuytack F. Enouf J. Biochem. J. 1992; 288: 297-302Crossref PubMed Scopus (89) Google Scholar). The IID8 antibody recognizes the SERCA 2b isoform at 100 kDa, whereas the PLIM430 antibody, obtained by immunizing with purified platelet internal membrane preparations (19Hack N. Wilkinson J.M. Crawford N. Biochem. J. 1988; 250: 355-361Crossref PubMed Scopus (26) Google Scholar), reacts with a distinct, 97-kDa pump species, temporarily designed as SERCAPLIM430 (17Papp B. Enyedi A. Kovàcs T. Sarkadi B. Wuytack F. Thastrup O. Gàrdos G. Bredoux R. Levy-Toledano S. Enouf J. J. Biol. Chem. 1991; 266: 14593-14596Abstract Full Text PDF PubMed Google Scholar, 18Papp B. Enyedi A. Pàszty K. Kovàcs T. Sarkadi B. Gàrdos G. Magnier C. Wuytack F. Enouf J. Biochem. J. 1992; 288: 297-302Crossref PubMed Scopus (89) Google Scholar). The biochemical characteristics and the intracellular localization of these two pump species are different (17Papp B. Enyedi A. Kovàcs T. Sarkadi B. Wuytack F. Thastrup O. Gàrdos G. Bredoux R. Levy-Toledano S. Enouf J. J. Biol. Chem. 1991; 266: 14593-14596Abstract Full Text PDF PubMed Google Scholar, 18Papp B. Enyedi A. Pàszty K. Kovàcs T. Sarkadi B. Gàrdos G. Magnier C. Wuytack F. Enouf J. Biochem. J. 1992; 288: 297-302Crossref PubMed Scopus (89) Google Scholar, 19Hack N. Wilkinson J.M. Crawford N. Biochem. J. 1988; 250: 355-361Crossref PubMed Scopus (26) Google Scholar, 20Papp B. Pàszty K. Kovàcs T. Sarkadi B. Gàrdos G. Enouf J. Enyedi A. Cell Calcium. 1993; 14: 531-538Crossref PubMed Scopus (47) Google Scholar, 21Engelender S. Wolosker H. de Meis L. J. Biol. Chem. 1995; 270: 21050-21055Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar), suggesting that they play functionally distinct roles within the same cell. To better elucidate the functional specialization of the coexpressed calcium pump isoforms, in the present work we investigated the modulation of the expression of these enzymes during in vitro lymphocyte activation, a process where significant changes of cell function, structure, and signaling occur. Ionomycin and the IID8 anti-SERCA 2 monoclonal antibody were purchased from BioMol (Plymouth Meeting, PA). PMA and avidin-horseradish peroxidase conjugate were from Sigma. Cyclosporine-A was purchased from Calbiochem. Biotin-conjugated anti-recombinant human IL-2 receptor α chain antibody and the IL-2 immunoassay kit (Quantikine ELISA) were from R & D Systems Europe Ltd. and were used according to the manufacturer's instructions. Peroxidase-conjugated as well as fluorescein-conjugated anti-mouse IgG antibody was purchased from Jackson ImmunoResearch Laboratories (West Grove, PA). The Jurkat-derived JurE6–1 clone (22Weiss A. Wiscocil R. Stobo J.D. J. Immunol. 1984; 133: 123-128PubMed Google Scholar), as well as the Molt-4 and the CCRF-CEM cell lines were obtained from ATCC (Rockville, MD). Cells were grown in RPMI 1640 medium with Glutamax-I supplemented with 10% heat-inactivated fetal calf serum and 2 mm glutamine (Life Technologies, Inc.) in a humidified cell culture incubator at 37 °C in an atmosphere of 95% air and 5% CO2. Glutamax-I and glutamine were used in combination to compensate for the increased metabolic requirements of the cells due to the experimentally induced increase of calcium permeability. Exponentially growing cells were harvested by centrifugation, resuspended in fresh complete medium at a density of 2 × 105 cells/ml and placed in 9-cm-diameter Petri dishes. Cells were then placed for 1 h in the cell culture incubator before stimulation. Drugs were then added from concentrated stock solutions in Me2So. The concentration of Me2So did not exceed 0.1%, was included in control experiments, and did not interfere with the assays. Cyclosporine-A was added 1 h prior to PMA or ionomycin treatment. Following the treatments for the time periods indicated on the figures, cell counts and viabilities were determined by the trypan blue exclusion method, and the cells were harvested by centrifugation. The supernatant was saved for IL-2 determination, and the cells were resuspended in ice-cold phosphate-buffered saline, spun down in microcentrifuge tubes, and immediately frozen as a pellet on dry ice. The cell pellets were thawed at a density of 107 cells/ml in a lysis buffer containing 62.5 mm Tris, pH 6.8, 2% SDS, 10% glycerol, 5 mm EDTA, 100 mmdithiothreitol, 2 m urea, and 0.02% bromphenol blue (23Heim R. Iwata T. Zvaritch E. Adamo H.P. Rutishauser B. Strehler E.E. Guerini D. Carafoli E. J. Biol. Chem. 1992; 267: 24476-24484Abstract Full Text PDF PubMed Google Scholar). Cells were homogenized by aspiration (15–20 strokes) using a 2-ml Hamilton syringe. Samples containing the lysates of 2 × 105 cells (20 μl) were run on 7.5% alkaline Läemmli-type polyacrylamide gels and transferred onto nitrocellulose membranes. Saturation of nitrocellulose and immunostaining was performed in a buffer containing 10 mm Tris, pH 7.4, 150 mm NaCl, 5% dry milk, and 0.1% Tween 20 as described previously (24Kovàcs T. Corvazier E. Papp B. Magnier C. Bredoux R. Enyedi A. Sarkadi B. Enouf J. J. Biol. Chem. 1994; 269: 6177-6184Abstract Full Text PDF PubMed Google Scholar). Luminescent signal was generated and detected using the Enhanced Chemiluminescence system (ECL) of Amersham. Luminograms were scanned and quantitated using an LKB Ultroscan XL Laser Densitometer. In control experiments we determined that the conditions used for immunostaining and detection gave signals proportional to the amount of SERCA protein loaded on the gels, and thus these conditions were suitable for the quantitative detection of SERCA protein in whole cell lysates. Immunofluorescent staining was performed on acetone-fixed cells as described previously (25Harlow E. Lane D. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1988: 359-420Google Scholar). SERCAPLIM430 and SERCA 2b mRNA levels were estimated using a semiquantitative reverse transcriptase-PCR method described previously (48Bobe R. Bredoux R. Wuytack F. Quarck R. Kovàcs T. Papp B. Corvazier E. Magnier C. Enouf J. J. Biol. Chem. 1994; 269: 1417-1424Abstract Full Text PDF PubMed Google Scholar). Briefly, total RNA from cells treated for 4 days with PMA plus ionomycin or vehicle control was reverse transcribed and amplified using the Perkin-Elmer GeneAmp RNA PCR kit and TaqDNA polymerase according to the manufacturers instructions by 30 cycles (each cycle consisting of 30 s at 94 °C, 2 min at 55 °C, and 2 min at 72 °C). The primers used to amplify SERCA 2b were TCATCTTCCAGATCACACCGCT and GTCAAGACCAGAACATATC, which cover the region from base pairs 2861 to 3132 of the human sequence (48Bobe R. Bredoux R. Wuytack F. Quarck R. Kovàcs T. Papp B. Corvazier E. Magnier C. Enouf J. J. Biol. Chem. 1994; 269: 1417-1424Abstract Full Text PDF PubMed Google Scholar). SERCAPLIM430 was amplified using the primers GAGTCACGCTTCCCCACCACC and TCAACTTCTGGCTCATTTCTT, which cover the region located between base pairs 2674 and 3000 (15Dode L. Wuytack F. Kools P.F. Baba-Aissa F. Raeymaekers L. Brik F. Van de Ven W.J.M. Casteels R. Biochem. J. 1996; 318: 689-699Crossref PubMed Scopus (49) Google Scholar). Data presented in this paper represent the results of at least four independent experiments. JurE6–1 cells were treated for 4 days with 0.5 μm ionomycin, 10 nm PMA, or a combination of the two drugs. Whole cell lysates were electrophoresed and immunoblotted using the SERCA isoform-specific discriminating antibodies IID8 and PLIM430. IL-2 secretion by the cells was quantitated by ELISA. In accordance with previous studies (17Papp B. Enyedi A. Kovàcs T. Sarkadi B. Wuytack F. Thastrup O. Gàrdos G. Bredoux R. Levy-Toledano S. Enouf J. J. Biol. Chem. 1991; 266: 14593-14596Abstract Full Text PDF PubMed Google Scholar, 18Papp B. Enyedi A. Pàszty K. Kovàcs T. Sarkadi B. Gàrdos G. Magnier C. Wuytack F. Enouf J. Biochem. J. 1992; 288: 297-302Crossref PubMed Scopus (89) Google Scholar), IID8 selectively recognized the SERCA 2b isoform at 100 kDa, whereas PLIM430 stained the 97-kDa pump isoform, SERCAPLIM430. As shown on Fig. 1, untreated cells expressed similar amounts of the two pump isoforms (Fig. 1 A, lanes 1 and 5), whereas a combined treatment with the two drugs resulted in an approximately 90% decrease of the expression of SERCAPLIM430 (Fig. 1, A, lane 2, andB) and an approximately 2-fold increase of the expression of SERCA 2b (Fig. 1, A, lane 6, and B). Ionomycin or PMA, when applied alone, did not modify significantly the expression of either calcium pump isoform in this system (Fig. 1,A, lanes 3, 4, 7, and8, and B). The differential modulation of the expression of the two pump species was also manifest on the mRNA level. As shown on Fig. 1 C, treatment of JurE6–1 cells by PMA plus ionomycin resulted in an approximately 2-fold decrease of SERCAPLIM430 mRNA (lane 3, untreated;lane 4, treated), whereas in the same cells SERCA 2b mRNA was increased approximately 2-fold (lanes 1 and2). Supernatants of JurE6–1 cells treated as above were collected, and their IL-2 content was quantitated by ELISA. In accordance with previous data (22Weiss A. Wiscocil R. Stobo J.D. J. Immunol. 1984; 133: 123-128PubMed Google Scholar, 26Truneh A. Albert F. Golstein P. Schmitt-Verhulst A-M. Nature. 1985; 313: 318-320Crossref PubMed Scopus (609) Google Scholar, 27Altman A. Mally M.I. Isakov N. Immunology. 1992; 76: 465-471PubMed Google Scholar, 28Mattila P.S. Ullman K.S. Fiering S. Emmel E.A. McCutcheon M. Crabtree G.R. Herzenberg L.A. EMBO J. 1990; 9: 4425-4433Crossref PubMed Scopus (292) Google Scholar, 29Lugo J.P. Krishnan S.N. Sailor R.D. Rothenberg E.V. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 1862-1866Crossref PubMed Scopus (43) Google Scholar, 30Luo C. Burgeon E. Carew J.A. McCaffrey P.G. Badalian T.M. Lane W.S. Hogan P.G. Rao A. Mol. Cell. Biol. 1996; 16: 3955-3966Crossref PubMed Scopus (172) Google Scholar), a combined treatment by PMA together with ionomycin resulted in a marked induction of IL-2 synthesis by the cells (1.2 ng/105 cells at day 4). In accordance with data in the literature (22Weiss A. Wiscocil R. Stobo J.D. J. Immunol. 1984; 133: 123-128PubMed Google Scholar, 26Truneh A. Albert F. Golstein P. Schmitt-Verhulst A-M. Nature. 1985; 313: 318-320Crossref PubMed Scopus (609) Google Scholar, 29Lugo J.P. Krishnan S.N. Sailor R.D. Rothenberg E.V. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 1862-1866Crossref PubMed Scopus (43) Google Scholar, 30Luo C. Burgeon E. Carew J.A. McCaffrey P.G. Badalian T.M. Lane W.S. Hogan P.G. Rao A. Mol. Cell. Biol. 1996; 16: 3955-3966Crossref PubMed Scopus (172) Google Scholar), PMA or ionomycin, when applied alone, did not induce detectable IL-2 synthesis (i.e. less than 3 pg/105 cells). JurE6–1 cells were treated for various time periods with PMA together with ionomycin, and SERCA expression was determined by immunoblotting. As shown on Fig. 2(A and B), SERCAPLIM430 expression started to decline at hour 9 after treatment. The induction of SERCA 2b expression followed a somewhat slower time course, being manifest starting at day 2 (Fig. 2, A and C). The state of activation of the cells was monitored in parallel by immunostaining for the α chain of the IL-2 receptor and by measuring IL-2 secretion, two established markers of T lymphocyte activation. SERCAPLIM430 down-regulation and the induction of IL-2 synthesis (Fig. 2 E) followed a similar time course, whereas the expression of the α chain of the IL-2 receptor expression appeared somewhat delayed (Fig. 2, A and D). In accordance with previous data (31Tsutsumi A. Kubo M. Fujii H. Freire-Moar J. Turck C.W. Ransom J.T. J. Immunol. 1993; 150: 1746-1754PubMed Google Scholar), PMA plus ionomycin treatment resulted in growth arrest of Jurkat cells with maintained viability. SERCAPLIM430down-regulation by PMA together with ionomycin was also manifested at the single cell level. In untreated cells a granular staining was seen for both SERCA isoforms in the cytoplasmic space, corresponding to the endoplasmic reticulum (Fig. 3, A andC). Although the fluorescence signal for SERCA 2b was not detectably modified by a treatment with PMA plus ionomycin (Fig.3 B), a marked decrease of staining for SERCAPLIM430 could be seen in PMA plus ionomycin-treated cells (Fig. 3 D). JurE6–1 cells were preincubated with various concentrations of cyclosporine-A for 1 h and then treated for 4 days with PMA and ionomycin. As shown on Fig. 4, cyclosporine-A in the submicromolar range abolished in a concentration-dependent manner the modulation of the expression of SERCAPLIM430 (Fig.4 A) and of SERCA 2b (Fig. 4 B) as well as IL-2 synthesis (Fig. 4 C) induced by PMA plus ionomycin. Cyclosporine-A applied alone had no effect on SERCA expression (not shown). Second messenger mediated calcium mobilization and protein kinase C activation are key events in lymphocyte signaling. In this work these signals were induced simultaneously by the combined treatment of cells by ionomycin and PMA. This technique is widely employed in the literature to obtain T cell activation and induces IL-2 synthesis and the expression of the α chain of the IL-2 receptor (22Weiss A. Wiscocil R. Stobo J.D. J. Immunol. 1984; 133: 123-128PubMed Google Scholar, 26Truneh A. Albert F. Golstein P. Schmitt-Verhulst A-M. Nature. 1985; 313: 318-320Crossref PubMed Scopus (609) Google Scholar, 27Altman A. Mally M.I. Isakov N. Immunology. 1992; 76: 465-471PubMed Google Scholar, 28Mattila P.S. Ullman K.S. Fiering S. Emmel E.A. McCutcheon M. Crabtree G.R. Herzenberg L.A. EMBO J. 1990; 9: 4425-4433Crossref PubMed Scopus (292) Google Scholar, 29Lugo J.P. Krishnan S.N. Sailor R.D. Rothenberg E.V. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 1862-1866Crossref PubMed Scopus (43) Google Scholar, 30Luo C. Burgeon E. Carew J.A. McCaffrey P.G. Badalian T.M. Lane W.S. Hogan P.G. Rao A. Mol. Cell. Biol. 1996; 16: 3955-3966Crossref PubMed Scopus (172) Google Scholar, 32Venkataraman L. Burakoff S.J. Sen R. J. Exp. Med. 1995; 181: 1091-1099Crossref PubMed Scopus (91) Google Scholar,33Wesselborg S. Fruman D.A. Sagoo J.K. Bierer B.E. Burakoff S.J. J. Biol. Chem. 1996; 271: 1274-1277Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). As shown in the present work, such a treatment results in the isoform-specific modulation of the expression of the SERCA enzymes expressed in Jurkat T lymphoblastoid cells. The SERCAPLIM430 calcium pump isoform is almost completely down-modulated, whereas the expression of SERCA 2b is increased 2-fold in the same cells. This results in a more than 15-fold overall increase in the relative ratio of the expression of SERCA 2b versusSERCAPLIM430. Similar results were obtained with Molt-4 and CCRF-CEM T lymphocytes as well (not shown). The modulation of SERCAPLIM430 expression in Jurkat cells occurred in parallel with the induction of IL-2 secretion and preceded the induction of the expression of the α chain of the IL-2 receptor. Similarly to the induction of IL-2 expression (22Weiss A. Wiscocil R. Stobo J.D. J. Immunol. 1984; 133: 123-128PubMed Google Scholar, 26Truneh A. Albert F. Golstein P. Schmitt-Verhulst A-M. Nature. 1985; 313: 318-320Crossref PubMed Scopus (609) Google Scholar), the effect on SERCA expression was strictly dependent on the simultaneous presence of both drugs, because PMA or ionomycin, when applied alone, was without effect either on SERCA expression or on IL-2 expression. Cyclosporine-A is a major, clinically used immunosuppressant that forms trimeric complexes with cyclophyllins and the calcium-calmodulin-dependent serin-threonin phosphatase, calcineurin. The formation of such a ternary complex leads to the inhibition of calcineurin enzyme activity and impaired signal transduction to the nucleus by NFAT (33Wesselborg S. Fruman D.A. Sagoo J.K. Bierer B.E. Burakoff S.J. J. Biol. Chem. 1996; 271: 1274-1277Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar, 34Timmerman L.A. Clipstone N.A. Ho S.N. Northrop J.P. Crabtree G.R. Nature. 1996; 383: 837-840Crossref PubMed Scopus (473) Google Scholar, 35Shibasaki F. Price E.R. Milan D. McKeon F. Nature. 1996; 382: 370-373Crossref PubMed Scopus (434) Google Scholar, 36Loh C. Shaw K, T.-Y. Carew J. Viola J.P.B. Luo C. Perrino B.A. Rao A. J. Biol. Chem. 1996; 271: 10884-10891Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar, 37Holloway M.P. Bram R.J. J. Biol. Chem. 1996; 271: 8549-8552Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). In this work the PMA plus ionomycin-induced IL-2 secretion and the modulation of SERCA 2b and SERCAPLIM430 expression were abolished by cyclosporine-A in the submicromolar range. This suggests that calcineurin-dependent signaling, a key component in T cell activation, is involved in the control of the expression of SERCA enzymes in lymphocytes. It has been shown earlier that lymphocyte activation produces modifications of the calcium storage and release characteristics of the cell (38Clementi E. Martino G. Grimaldi L.M. Brambilla E. Meldolesi J. Eur. J. Immunol. 1994; 24: 1365-1371Crossref PubMed Scopus (33) Google Scholar) and that SERCA enzyme activity is involved in the control of cell proliferation and of lymphocyte activation (39Breittmayer J-P. Ticchioni M. Ferrua B. Bernard A. Aussel C. Cell. Immunol. 1993; 149: 248-257Crossref PubMed Scopus (19) Google Scholar, 40Papp B. Byrn R.A. J. Biol. Chem. 1995; 270: 10278-10283Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 41Cheng G. Liu B.-F. Yu Y. Diglio C. Kuo T.H. Arch. Biochem. Biophys. 1996; 329: 65-72Crossref PubMed Scopus (28) Google Scholar, 42Waldron R.T. Short A.D. Gill D.L. J. Biol. Chem. 1995; 270: 11955-11961Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). However, the role and the modulation of the expression of the various SERCA isoforms, coexpressed in the cell, have not been previously investigated. The data presented in this work indicate that striking differences exist in the regulation of expression of the SERCA isoforms during lymphocyte activation. This phenomenon probably reflects that various SERCA isoforms play functionally distinct roles and are associated with functionally distinct subcompartments of the endoplasmic reticulum. SERCAPLIM430 is believed to be a variant of SERCA 3, the expression of which is restricted to cells of hemopoietic origin (15Dode L. Wuytack F. Kools P.F. Baba-Aissa F. Raeymaekers L. Brik F. Van de Ven W.J.M. Casteels R. Biochem. J. 1996; 318: 689-699Crossref PubMed Scopus (49) Google Scholar, 16Lacabaratz C. Corvazier E. Kovàcs T. Bobe R. Wuytack F. Papp B. Enouf J. Biochem. J. 1996; 318: 359-360Crossref PubMed Scopus (10) Google Scholar, 17Papp B. Enyedi A. Kovàcs T. Sarkadi B. Wuytack F. Thastrup O. Gàrdos G. Bredoux R. Levy-Toledano S. Enouf J. J. Biol. Chem. 1991; 266: 14593-14596Abstract Full Text PDF PubMed Google Scholar, 18Papp B. Enyedi A. Pàszty K. Kovàcs T. Sarkadi B. Gàrdos G. Magnier C. Wuytack F. Enouf J. Biochem. J. 1992; 288: 297-302Crossref PubMed Scopus (89) Google Scholar). This enzyme, at least in platelets, is specifically associated with the IP3 mobilizable calcium pool (20Papp B. Pàszty K. Kovàcs T. Sarkadi B. Gàrdos G. Enouf J. Enyedi A. Cell Calcium. 1993; 14: 531-538Crossref PubMed Scopus (47) Google Scholar, 21Engelender S. Wolosker H. de Meis L. J. Biol. Chem. 1995; 270: 21050-21055Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar,43Cavallini L. Coassin M. Alexandre A. Biochem. J. 1995; 310: 449-452Crossref PubMed Scopus (78) Google Scholar). Lymphocyte activation as well as apoptosis are strictly dependent on the mobilization of the IP3-sensitive calcium pool (1Weiss A. Imboden J.B. Advances Immunol. 1987; 41: 1-38Crossref PubMed Scopus (225) Google Scholar,8Pozzan T. Rizzuto R. Volpe P. Meldolesi J Physiol. Rev. 1994; 74: 595-636Crossref PubMed Scopus (30) Google Scholar, 44Jayaraman T. Ondriasova E. Ondrias K. Harnick D.J. Marks A.R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6007-6011Crossref PubMed Scopus (132) Google Scholar, 45Khan A.A. Soloski M.J. Sharp A.H. Schilling G. Sabatini D.M. Li S.-H. Ross C.A. Snyder S.H. Science. 1996; 273: 503-507Crossref PubMed Scopus (241) Google Scholar, 46Jiang S. Chow S.C. Nicotera P. Orrenius S. Exp. Cell Res. 1994; 212: 84-92Crossref PubMed Scopus (243) Google Scholar). The down-modulation of SERCAPLIM430 during activation may lead to decreased filling of this pool. Because the depletion of the IP3-sensitive calcium pool viaIP3 induced calcium release (2Premack B.A. Gardner P. Am. J. Physiol. 1992; 263: C1119-C1140Crossref PubMed Google Scholar, 6Berridge M.J. Biochem. J. 1995; 312: 1-11Crossref PubMed Scopus (1046) Google Scholar, 7Putney J.W. Cell Calcium. 1990; 11: 611-624Crossref PubMed Scopus (1261) Google Scholar) or by direct inhibition of SERCA activity by drugs such as thapsigargin (39Breittmayer J-P. Ticchioni M. Ferrua B. Bernard A. Aussel C. Cell. Immunol. 1993; 149: 248-257Crossref PubMed Scopus (19) Google Scholar, 40Papp B. Byrn R.A. J. Biol. Chem. 1995; 270: 10278-10283Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar) is known to result in the generation of activatory signals, SERCAPLIM430 down-modulation may contribute to the maintenance of the activated state or may alter the apoptotic potential of the cell. The observation, shown in this paper, that SERCAPLIM430 and SERCA 2b mRNA levels are differentially modulated by PMA plus ionomycin suggests that transcriptional regulation may be involved in the control of SERCA expression during lymphocyte activation. Indeed, simultaneous calcium mobilization and protein kinase C activation sets in motion a complex intracellular signaling network including calmodulin-dependent protein kinases and calcineurin (49Enslen H. Soderling T.R. J. Biol. Chem. 1994; 269: 20872-20877Abstract Full Text PDF PubMed Google Scholar), as well as the Jun-N-terminal kinase pathway (47Su B. Jacinto E. Hibi M. Kallunki T. Karin M. Ben-Neirah Y. Cell. 1994; 77: 727-736Abstract Full Text PDF PubMed Scopus (849) Google Scholar). This leads to the modulation of the activity of several transcription factors such as NFκB, NFAT or AP-1 (9Rothenberg E.V. Ward S.B. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9358-9365Crossref PubMed Scopus (169) Google Scholar), resulting in a complex set of modifications of gene expression, including, as shown in this work, intracellular calcium pump isoenzymes. The use of specific inhibitors of the different key factors of this complex signaling system and experiments addressing SERCA gene transcription and mRNA stability will permit a more detailed analysis of the mechanisms involved in the regulation of SERCA expression. The plasticity of expression of the various SERCA isoforms upon cell activation represents a previously unrecognized level of complexity of lymphocyte calcium homeostasis and shows that different SERCA isoforms and therefore presumably different calcium pools may play distinct roles in cell activation. This finding points at the dinamic nature of the structure and function of calcium homeostatic systems of differentiating cells and may open new perspectives in the understanding of intracellular calcium homeostasis and in the pharmacological control of lymphocyte function. We are grateful to Dr. Agnes Enyedi, Dr. Balàzs Sarkadi, Dr. Anna Berardi, and Dr. Ali Saı̈b for helpful discussions. The help of Dr. Jacques Maclouf with the IL-2 ELISA experiments is acknowledged. We express special thanks to Prof. Neville Crawford for giving us the PL/IM430 hybridoma." @default.
W1988406918 created "2016-06-24" @default.
W1988406918 creator A5000772405 @default.
W1988406918 creator A5001587423 @default.
W1988406918 creator A5010112438 @default.
W1988406918 creator A5042235796 @default.
W1988406918 creator A5049363078 @default.
W1988406918 creator A5083294960 @default.
W1988406918 creator A5091028608 @default.
W1988406918 date "1997-04-01" @default.
W1988406918 modified "2023-09-29" @default.
W1988406918 title "Modulation of Endoplasmic Reticulum Calcium Pump Expression during T Lymphocyte Activation" @default.
W1988406918 cites W1492839186 @default.
W1988406918 cites W1499927580 @default.
W1988406918 cites W1505781390 @default.
W1988406918 cites W1517335434 @default.
W1988406918 cites W1520989958 @default.
W1988406918 cites W1580727347 @default.
W1988406918 cites W1586649084 @default.
W1988406918 cites W1670677674 @default.
W1988406918 cites W1874327812 @default.
W1988406918 cites W1915985314 @default.
W1988406918 cites W1950580345 @default.
W1988406918 cites W1967398848 @default.
W1988406918 cites W1980166477 @default.
W1988406918 cites W1982594790 @default.
W1988406918 cites W1983118151 @default.
W1988406918 cites W1987276980 @default.
W1988406918 cites W1997238055 @default.
W1988406918 cites W2000595280 @default.
W1988406918 cites W2009919643 @default.
W1988406918 cites W2010428440 @default.
W1988406918 cites W2012760219 @default.
W1988406918 cites W2013056080 @default.
W1988406918 cites W2015084021 @default.
W1988406918 cites W2017955188 @default.
W1988406918 cites W2026108503 @default.
W1988406918 cites W2028826149 @default.
W1988406918 cites W2044406741 @default.
W1988406918 cites W2059570070 @default.
W1988406918 cites W2068716929 @default.
W1988406918 cites W2078144829 @default.
W1988406918 cites W2080698860 @default.
W1988406918 cites W2084053895 @default.
W1988406918 cites W2092109378 @default.
W1988406918 cites W2128270335 @default.
W1988406918 cites W2137407985 @default.
W1988406918 cites W2154886269 @default.
W1988406918 cites W2157118497 @default.
W1988406918 cites W2206236475 @default.
W1988406918 cites W2332467066 @default.
W1988406918 cites W236654392 @default.
W1988406918 cites W2396712276 @default.
W1988406918 cites W2406942522 @default.
W1988406918 cites W2412223496 @default.
W1988406918 cites W2799503982 @default.
W1988406918 cites W4313314629 @default.
W1988406918 cites W54735960 @default.
W1988406918 doi "https://doi.org/10.1074/jbc.272.16.10746" @default.
W1988406918 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9099725" @default.
W1988406918 hasPublicationYear "1997" @default.
W1988406918 type Work @default.
W1988406918 sameAs 1988406918 @default.
W1988406918 citedByCount "46" @default.
W1988406918 countsByYear W19884069182012 @default.
W1988406918 countsByYear W19884069182013 @default.
W1988406918 countsByYear W19884069182014 @default.
W1988406918 countsByYear W19884069182015 @default.
W1988406918 countsByYear W19884069182017 @default.
W1988406918 countsByYear W19884069182020 @default.
W1988406918 countsByYear W19884069182021 @default.
W1988406918 crossrefType "journal-article" @default.
W1988406918 hasAuthorship W1988406918A5000772405 @default.
W1988406918 hasAuthorship W1988406918A5001587423 @default.
W1988406918 hasAuthorship W1988406918A5010112438 @default.
W1988406918 hasAuthorship W1988406918A5042235796 @default.
W1988406918 hasAuthorship W1988406918A5049363078 @default.
W1988406918 hasAuthorship W1988406918A5083294960 @default.
W1988406918 hasAuthorship W1988406918A5091028608 @default.
W1988406918 hasBestOaLocation W19884069181 @default.
W1988406918 hasConcept C121332964 @default.
W1988406918 hasConcept C123079801 @default.
W1988406918 hasConcept C126322002 @default.
W1988406918 hasConcept C142579037 @default.
W1988406918 hasConcept C158617107 @default.
W1988406918 hasConcept C162740809 @default.
W1988406918 hasConcept C185592680 @default.
W1988406918 hasConcept C203014093 @default.
W1988406918 hasConcept C24890656 @default.
W1988406918 hasConcept C2777761686 @default.
W1988406918 hasConcept C519063684 @default.
W1988406918 hasConcept C71924100 @default.
W1988406918 hasConcept C86803240 @default.
W1988406918 hasConcept C95444343 @default.
W1988406918 hasConceptScore W1988406918C121332964 @default.
W1988406918 hasConceptScore W1988406918C123079801 @default.
W1988406918 hasConceptScore W1988406918C126322002 @default.
W1988406918 hasConceptScore W1988406918C142579037 @default.