FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1989711933> ?p ?o ?g. }

• W1989711933 endingPage "27912" @default.
• W1989711933 startingPage "27905" @default.
• W1989711933 abstract "HFE C282Y, the mutant protein associated with hereditary hemochromatosis (HH), fails to acquire the correct conformation in the endoplasmic reticulum (ER) and is targeted for degradation. We have recently shown that an active unfolded protein response (UPR) is present in the cells of patients with HH. Now, by using HEK 293T cells, we demonstrate that the stability of HFE C282Y is influenced by the UPR signaling pathway that promotes its degradation. Treatment of HFE C282Y-expressing cells with tauroursodeoxycholic acid (TUDCA), a bile acid derivative with chaperone properties, or with the chemical chaperone sodium 4-phenylbutyrate (4PBA) impeded the UPR activation. However, although TUDCA led to an increased stability of the mutant protein, 4PBA contributed to a more efficient disposal of HFE C282Y to the degradation route. Fluorescence microscopy and biochemical analysis of the subcellular localization of HFE revealed that a major portion of the C282Y mutant protein forms intracellular aggregates. Although neither TUDCA nor 4PBA restored the correct folding and intracellular trafficking of HFE C282Y, 4PBA prevented its aggregation. These data suggest that TUDCA hampers the UPR activation by acting directly on its signal transduction pathway, whereas 4PBA suppresses ER stress by chemically enhancing the ER capacity to cope with the expression of misfolded HFE, facilitating its degradation. Together, these data shed light on the molecular mechanisms involved in HFE C282Y-related HH and open new perspectives on the use of orally active chemical chaperones as a therapeutic approach for HH. HFE C282Y, the mutant protein associated with hereditary hemochromatosis (HH), fails to acquire the correct conformation in the endoplasmic reticulum (ER) and is targeted for degradation. We have recently shown that an active unfolded protein response (UPR) is present in the cells of patients with HH. Now, by using HEK 293T cells, we demonstrate that the stability of HFE C282Y is influenced by the UPR signaling pathway that promotes its degradation. Treatment of HFE C282Y-expressing cells with tauroursodeoxycholic acid (TUDCA), a bile acid derivative with chaperone properties, or with the chemical chaperone sodium 4-phenylbutyrate (4PBA) impeded the UPR activation. However, although TUDCA led to an increased stability of the mutant protein, 4PBA contributed to a more efficient disposal of HFE C282Y to the degradation route. Fluorescence microscopy and biochemical analysis of the subcellular localization of HFE revealed that a major portion of the C282Y mutant protein forms intracellular aggregates. Although neither TUDCA nor 4PBA restored the correct folding and intracellular trafficking of HFE C282Y, 4PBA prevented its aggregation. These data suggest that TUDCA hampers the UPR activation by acting directly on its signal transduction pathway, whereas 4PBA suppresses ER stress by chemically enhancing the ER capacity to cope with the expression of misfolded HFE, facilitating its degradation. Together, these data shed light on the molecular mechanisms involved in HFE C282Y-related HH and open new perspectives on the use of orally active chemical chaperones as a therapeutic approach for HH. A large number of diseases result from protein misfolding and aggregation. Hereditary hemochromatosis (HH) 3The abbreviations used are: HHhereditary hemochromatosisUPRunfolded protein responseERendoplasmic reticulumTUDCAtauroursodeoxycholic acid4PBA4-phenylbutyrateATF6activating transcription factor-6HAhemagglutininGFPgreen fluorescent proteinDMEMDulbecco's modified Eagle's mediumPBSphosphate-buffered salineAbantibodymAbmonoclonal AbEndo Hendoglycosidase HHSPheat shock protein. constitutes an example of such a disease. HFE, a type I transmembrane glycoprotein homologous to major histocompatibility complex I, interacts with β2-microglobulin, and only the HFE/β2-microglobulin heterodimer is able to reach the cell surface through the standard secretory pathway (1Feder J.N. Gnirke A. Thomas W. Tsuchihashi Z. Ruddy D.A. Basava A. Dormishian F. Domingo R. Nat. Genet. 1996; 13: 399-408Crossref PubMed Scopus (3354) Google Scholar). The C282Y mutation in HFE prevents the formation of an intra-molecular disulfide bridge in the α3 domain of HFE blocking β2-microglobulin association and the trafficking of the protein to the cell surface (2Feder J.N. Tsuchihashi Z. Irrinki A. Lee V.K. Mapa F.A. Morikang E. Prass C.E. Starnes S.M. Wolff R.K. Parkkila S. Sly W.S. Schatzman R.C. J. Biol. Chem. 1997; 272: 14025-14028Abstract Full Text Full Text PDF PubMed Scopus (462) Google Scholar). The resulting misfolded protein is retained in the endoplasmic reticulum (ER) and subjected to accelerated proteasomal degradation (3Waheed A. Parkkila S. Zhou X.Y. Tomatsu S. Tsuchihashi Z. Feder J.N. Schatzman R.C. Britton R.S. Bacon B.R. Sly W.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12384-12389Crossref PubMed Scopus (364) Google Scholar). The observation that HFE binds to transferrin receptor I implicated this protein in the regulation of iron metabolism (4Feder J.N. Penny D.M. Irrinki A. Lee V.K. Lebron J.A. Watson N. Tsuchihashi Z. Sigal E. Bjorkman P.J. Schatzman R.C. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 1472-1477Crossref PubMed Scopus (723) Google Scholar), a fact supported by the finding that carriers of the HFE C282Y mutation develop HH, an iron overload disorder (1Feder J.N. Gnirke A. Thomas W. Tsuchihashi Z. Ruddy D.A. Basava A. Dormishian F. Domingo R. Nat. Genet. 1996; 13: 399-408Crossref PubMed Scopus (3354) Google Scholar). hereditary hemochromatosis unfolded protein response endoplasmic reticulum tauroursodeoxycholic acid 4-phenylbutyrate activating transcription factor-6 hemagglutinin green fluorescent protein Dulbecco's modified Eagle's medium phosphate-buffered saline antibody monoclonal Ab endoglycosidase H heat shock protein. It has been known for some time that some compounds collectively called chemical chaperones have the ability to stabilize proteins in their native conformation contributing in some cases to rescue of the folding defect of mutant proteins (5Welch W.J. Brown C.R. Cell Stress Chaperones. 1996; 1: 109-115Crossref PubMed Scopus (433) Google Scholar). One well studied example of this mechanism is the restoration of the cell surface expression and function of the mutant cystic fibrosis transmembrane conductance regulator protein by chemical chaperones (6Brown C.R. Hong-Brown L.Q. Biwersi J. Verkman A.S. Welch W.J. Cell Stress Chaperones. 1996; 1: 117-125Crossref PubMed Scopus (362) Google Scholar). It is thought, however, that these compounds may be effective in a number of other protein folding defects, thus providing an interesting therapeutic approach for a large number of different human diseases (7Chaudhuri T.K. Paul S. FEBS J. 2006; 273: 1331-1349Crossref PubMed Scopus (285) Google Scholar). We have recently reported that cells expressing HFE C282Y have an active unfolded protein response (UPR) (8de Almeida S.F. Fleming J.V. Azevedo J.E. Carmo-Fonseca M. de Sousa M. J. Immunol. 2007; 178: 3612-3619Crossref PubMed Scopus (57) Google Scholar). This specific ER stress response enhances the levels of molecular chaperones involved in protein folding and degradation and reduces the rate of protein synthesis (9Schroder M. Kaufman R.J. Annu. Rev. Biochem. 2005; 74: 739-789Crossref PubMed Scopus (2444) Google Scholar). Upon UPR activation, activating transcription factor-6 (ATF6), an ER stress-transducing protein, is cleaved (nATF6) and relocates to the nucleus where it promotes expression of UPR-responsive genes (10Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1552) Google Scholar, 11Shen J. Chen X. Hendershot L. Prywes R. Dev. Cell. 2002; 3: 99-111Abstract Full Text Full Text PDF PubMed Scopus (1074) Google Scholar). Another active transcription factor that promotes transcription of UPR-responsive genes is produced by the alternative splicing of X box-binding protein-1 (sXBP1) (12Yoshida H. Matsui T. Yamamoto A. Okada T. Mori K. Cell. 2001; 107: 881-891Abstract Full Text Full Text PDF PubMed Scopus (2982) Google Scholar). Our goal in this study is to investigate the effect of the chemical chaperones tauroursodeoxycholic acid (TUDCA) and sodium 4-phenylbutyrate (4PBA) in the HFE C282Y-associated UPR as well as the impact of these compounds on the intracellular trafficking and localization of the HFE mutant protein. We show that chemical enhancement of the ER folding capacity results in the prevention of the UPR activation and influences the degradation of HFE C282Y. In addition, investigation of the subcellular localization of HFE C282Y revealed that this misfolded protein forms aggregates and that 4PBA is effective in preventing their formation. These findings offer a potential new strategy for therapy designed to prevent the potential toxicity of the intracellular aggregates. Antibodies and Plasmids-The following Abs were used: 8C-10 (mouse anti-human HFE, a kind gift from Dr. Rachel Ehrlich, Tel Aviv University, Israel); rabbit anti-HFE cytoplasmic tail (CT) (13Ben-Arieh S.V. Zimerman B. Smorodinsky N.I. Yaacubovicz M. Schechter C. Bacik I. Gibbs J. Bennink J.R. Yewdell J.W. Coligan J.E. Firat H. Lemonnier F. Ehrlich R. J. Virol. 2001; 75: 10557-10562Crossref PubMed Scopus (64) Google Scholar); mouse anti-KDEL (detects mainly BiP, an GRP94) and rabbit anti-β-actin (Abcam, Cambridge, UK); mouse anti-HA (Abcam, Cambridge, UK); donkey anti-mouse fluorescein isothiocyanate, anti-rabbit fluorescein isothiocyanate, and donkey anti-mouse-Cy3-conjugated secondary antibodies (Jackson ImmunoResearch, West Grove, PA. The HFE WT-pcDNA3 construct was a kind gift from Dr. Luísa Salter-Cid. HFE C282Y-pcDNA3 was described previously (8de Almeida S.F. Fleming J.V. Azevedo J.E. Carmo-Fonseca M. de Sousa M. J. Immunol. 2007; 178: 3612-3619Crossref PubMed Scopus (57) Google Scholar). β2-Microglobulin-pcDNA3.1 constructs were a kind gift from Dr. Hal Drakesmith (University of Oxford, Oxford, UK). The pEP7-nATF6-FL vector expressing a nuclear targeted and transcriptionally active fragment of ATF6 (amino acids 1-373) was described previously (8de Almeida S.F. Fleming J.V. Azevedo J.E. Carmo-Fonseca M. de Sousa M. J. Immunol. 2007; 178: 3612-3619Crossref PubMed Scopus (57) Google Scholar, 14Fleming J.V. Sanchez-Jimenez F. Moya-Garcia A.A. Langlois M.R. Wang T.C. Biochem. J. 2004; 379: 253-261Crossref PubMed Google Scholar). A plasmid encoding the spliced form of XBP-1 was the kind gift of Dr. K. Mori (Kyoto University, Japan) and acted as template for a pfu PCR amplification as described (8de Almeida S.F. Fleming J.V. Azevedo J.E. Carmo-Fonseca M. de Sousa M. J. Immunol. 2007; 178: 3612-3619Crossref PubMed Scopus (57) Google Scholar). The pEP7 HFE WT-GFP and pEP7 HFE C282Y-GFP vectors were generated by pfu PCR amplification using specific sense (GGTCAGATCTGGCCACCATGGGCCCGCGAGCCAGGCCG) and antisense (CCCCCTCGTCGACTCACGTTCAGCTAAGACGTA) primers and the HFE WT-pcDNA3 and HFE C282Y-pcDNA3 constructs, respectively, as templates. Amplified products were cloned into the BglII and SalI sites of the pEP7-GFP vector. The pEP7-GFP vector was generated by pfu PCR amplification using the pEGFP-N1 (Clontech) plasmid as template and the specific sense (GCGGGGTCGACGATGGTGAGCAAGGGCGAGGAGCTG) and antisense (GGGCACCGCGGCCGCTTACTTGTACAGCTCGTCCATGCC) primers. Amplified GFP was cloned into the SalI and NotI sites of the pEP7-HA vector (15Fleming J.V. Wang T.C. J. Biol. Chem. 2003; 278: 686-694Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar), thus replacing the carboxyl-terminal HA tag with enhanced green fluorescent protein. The pEP7 HFE WT-HA and pEP7 HFE C282Y-HA vectors used in Figs. 1, 2, 3, 4B, and 6 were generated using the HFE WT-pcDNA3 and HFE C282Y-pcDNA3 constructs as templates, with the HA tag inserted at the carboxyl terminus.FIGURE 2Chemical chaperones protect from UPR activation and modulate HFE C282Y protein levels. A, BiP and GRP94 from whole cell lysates of HFE WT-HA- or C282Y-HA-transfected cells either untreated or treated with 1 mm TUDCA or 5 mm 4PBA were detected by Western blot with anti-KDEL. The intensity of the bands was quantified, normalized to β-actin, and plotted as average ±1 S.D. Data are from three independent experiments. The asterisks represent statistically significant differences (*, p < 0.05; **, p < 0.01) between the cells treated with the chemical chaperones and the untreated cells. B, BiP mRNA levels of 293T cells transfected with empty vector (Mock), HFE WT-HA, or HFE C282Y-HA either left untreated or treated with the chemical chaperones TUDCA and 4PBA were assessed by quantitative real time PCR. The graph represents the average ±1 S.D. of three independent experiments. β-Actin was used as an endogenous control gene. **, p < 0.01 relative to HFE C282Y-HA untreated cells. C, cells transfected to express the indicated proteins were either treated with 1 mm TUDCA or left untreated and BiP and GRP94 levels detected by Western blot. The intensity of the bands corresponding to BiP and GRP94 was quantified, normalized to β-actin, and plotted on a bar graph as average ±1 S.D. of three independent experiments. *, p < 0.05; **, p < 0.01 relative to untreated cells expressing the same proteins. D, HFE protein levels of HA-tagged HFE WT or C282Y transfected cells either untreated or treated with TUDCA or 4PBA were detected by Western blot with anti-HA mAb. The asterisk indicates the position of a nonspecific band. The intensity of the HFE band was normalized to β-actin and plotted on a bar graph as average ±1 S.D. of three independent experiments. *, p < 0.05 compared with HFE C282Y-HA transfected cells.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 3Chemical chaperones do not affect the transcription efficiency of HFE. 293T cells transfected with empty vector (Mock), HFE WT-HA, or HFE C282Y-HA were either left untreated or incubated for 30 h in the presence of 1 mm TUDCA or 5 mm 4PBA, and HFE mRNA levels were assessed by quantitative real time PCR. The graph represents the average ±1 S.D. of three independent experiments. No statistically significant differences were observed. β-Actin was used as an endogenous control gene.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 4Chemical chaperones do not restore the cell surface expression of HFE C282Y. A, 293T cells transfected with HFE WT-GFP or HFE C282Y-GFP were either left untreated or treated with chemical chaperones and stained without permeabilization using anti-HFE Abs plus Cy3-conjugated secondary Abs. GFP-positive cells were gated, and the HFE cell surface expression was analyzed by flow cytometry. The negative (-) control was obtained by incubation with an isotype-matched nonspecific antibody. The black lines in each histogram represent the untreated cells, gray lines represent TUDCA-treated cells, and dashed lines represent 4PBA-treated cells. These are representative data from three independent experiments performed. B, whole cell lysates of 293T cells transfected with HFE C282Y-HA and either left untreated or treated with chemical chaperones were digested with Endo H or glycosidase F. Western blot was then performed using anti-HA mAb. The position of the Endo H-resistant (+CHO) and -sensitive (-CHO) forms of HFE is indicated. The asterisk indicates the position of a nonspecific band. One representative experiment of three performed with similar results is shown.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Cells-Human embryonic kidney 293T cells (HEK 293T) were obtained from the American Type Culture Collection. Cells were cultured in DMEM with GlutaMAX medium (Invitrogen) containing 1% penicillin/streptomycin/amphotericin solution (Sigma) and 10% heat-inactivated fetal bovine serum. Transfections-293T cells were transiently transfected using Lipofectamine 2000 (Invitrogen) in 60-mm plates accordingly to the manufacturer's protocol. At the time of transfection, cells were 90-95% confluent. Opti-MEM was used to dilute both DNA and Lipofectamine at a final DNA/Lipofectamine ratio of 1:2.5. After transfection cells were incubated for 48 h in DMEM with GlutaMAX medium (Invitrogen) containing 1% penicillin/streptomycin/amphotericin solution (Sigma) and 10% heat-inactivated fetal bovine serum. In these studies a plasmid encoding β2-microglobulin was co-transfected with HFE expression vectors to ensure that sufficient quantity of this protein was available for correct assembly of the HFE. Pulse-Chase-48 h after transfection, 1 × 107 293T cells were starved for 1 h in cysteine/methionine-free DMEM (Invitrogen) supplemented with 1% l-glutamine and pulsed for 20 min with 140 μCi/ml Pro-Mix l-[35S]cysteine/methionine (Amersham Biosciences). The culture medium was then supplemented with cold cysteine and methionine and chased for the indicated times. At each time point 1 aliquot was taken, washed, and lysed in ice-cold lysis buffer (300 mm NaCl, 50 mm Tris-HCl, pH 7.4, 1% Triton X, Complete EDTA-free protease inhibitor mixture (Roche Diagnostics), 10 mm iodoacetamide). Cell debris was removed by centrifugation, and the lysates were precleared with 100 μl of protein A-Sepharose bead slurry (50%) for 1 h at 4 °C. The lysates were incubated overnight at 4 °C with anti-HA. Immunocomplexes were pulled down with protein A-Sepharose beads and washed three times in ice-cold lysis buffer. After addition of gel loading buffer solution (16Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207227) Google Scholar) with 10% β-mercaptoethanol and boiling for 5 min, samples were loaded on 10% SDS-PAGE. SDS-PAGE and Quantitation-10% SDS-PAGE was performed using a Bio-Rad Mini Protean II kit. Gels were fixed in 10% acetic acid, 40% methanol, incubated for 30 min with Amplify solution (Amersham Biosciences), dried, and exposed to a radioactivity storage screen. Quantitation was performed using a Typhoon PhosphorImager (GE Healthcare) with ImageQuant version 5.1 software. Western Blot, Endo H Digestion, and Ultracentrifugation-Protein concentration in whole cell lysates was determined with RC/DC protein assay (Bio-Rad), and 30 μg were separated by SDS-PAGE. The proteins were then transferred to a nitrocellulose Hybond-C membrane (Amersham Biosciences). After blocking at 4 °C with 5% dry milk, 0.05% Tween 20 in TBS (TBS-T), the membrane was incubated with anti-HA or anti-KDEL, washed three times with TBS-T, and detected with the respective horseradish peroxidase-conjugated secondary antibody (Molecular Probes, Eugene, OR) and an enhanced chemiluminescence substrate (Pierce). To control loadings, the membrane was stripped using Restore WB Stripping Buffer (Pierce) and incubated with anti-β-actin. For the Endo H assay, whole cell lysates were digested for 4 h at 37°C with Endo H (Roche Diagnostics) or glycosidase F (Roche Diagnostics) as described by the manufacturer. The reaction was stopped by addition of gel loading buffer solution (GLB) (16Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207227) Google Scholar) with 10% β-mercaptoethanol and boiling for 5 min. For detection of protein aggregates, cells were solubilized in 1% Triton X lysis buffer for 1 h on ice. After a centrifugation step at 300 × g for 5 min to clear cell debris, whole cell lysates were split into 2 equal portions. One represented the total protein content, and the other was ultracentrifuged at 100,000 × g for 1 h at 4°C in a Sorvall Ultra Pro80 centrifuge. The pellet fraction and the protein content of the supernatant fraction (obtained by a 10% trichloroacetic acid precipitation) were solubilized with GLB, 10% β-mercaptoethanol, and boiling for 5 min. Equivalent gel loading was confirmed by staining the nitrocellulose membrane with 0.1% Ponceau S. Treatment with Chemical Chaperones-18 h post-transfection, 293T cells were washed and incubated for 30 h in DMEM with GlutaMAX medium supplemented with 1% penicillin/streptomycin/amphotericin solution and 10% fetal bovine serum in the presence of 1 mm TUDCA (Calbiochem) or 5 mm 4PBA (Sigma). The percentage of transfected cells was not affected by the treatment with the chemical chaperones (data not shown). Real Time PCR-Total RNA was extracted with TRIzol reagent (Invitrogen), according to the manufacturer's instructions. Following treatment with 2 units/sample of RQ1 DNase, in the presence of 50 units/sample of RNase inhibitor (Invitrogen), for 30 min at 37 °C, 1 μg of RNA was reverse-transcribed, using Superscript reverse transcriptase (Invitrogen), following the manufacturer's instructions. Expression levels were evaluated by quantitative real time PCR with the ABI PRISM 7700 instrument (Applied Biosystems, Foster City, CA) using 1× SYBR Green PCR Master Mix (Applied Biosystems). Quantification of β-actin gene expression was performed as a control. Relative expression levels were calculated as 2[caret](Ct human β-actin - Ct HLA-A × 10,000) (for details see ABI PRISM 7700, User Bulletin 2). The oligonucleotides used were 5′-CTCCTTTGGTGAAGGTGACACATC-3′ and 5′-ATCACAATGAGGGGCTGATCC-3′ for HFE and 5′-CCTGGGTGGCGGAACCTTCGATGTG-3′ and 5′-CTGGACGGGCTTCATAGTAGACCGG-3′ for BiP. Flow Cytometry-293T cells transiently expressing GFP-tagged HFE WT or C282Y were washed in ice-cold PBS, 0.2% bovine serum albumin, 0.1% NaN3 followed by incubation at 4 °C with a saturating amount of primary Ab for 30 min in 96-well plates. After three washes cells were incubated with Cy3-conjugated secondary Ab for 30 min on ice without permeabilization. Cells were washed, and flow cytometry analysis was performed in a FACS-Calibur (BD Biosciences). The Cy3 fluorescence, representing cell surface expression of HFE, was measured in GFP-positive cells. For each sample a minimum of 15,000 events were acquired. To define the background staining, irrelevant mAbs of the same isotype were used. Fluorescence Microscopy-HFE WT-GFP or HFE C282Y-GFP transiently transfected 293T cells were grown on coverslips and either left untreated or treated with 1 mm TUDCA or 5 mm 4PBA for 30 h. Cells were rinsed three times in PBS, fixed in 3.5% paraformaldehyde, and simultaneously blocked and permeabilized with 5% bovine serum albumin, 0.1% Triton X-100 in PBS, for 30 min at room temperature. Fixed cells were incubated for 30 min with anti-KDEL, washed twice with PBS, and incubated with anti-mouse Cy3-conjugated Ab. Coverslips were mounted on glass slides in 1:5 4,6-diamidino-2-phenylindole (10 μg/ml; Sigma):Vectashield (Vector Laboratories, Burlingame, CA), and immunofluorescence analysis was performed on a Axiovert Carl Zeiss microscope (Carl Zeiss, Thornwood, NY). For quantification of cells containing HFE aggregates, at least 200 cells were counted according to an unbiased systematic random sampling scheme. Statistical Analysis-To test the significance of the differences observed, the Student's t test was used. In all tests the statistical significance was two-sided and considered at p < 0.05. Data are displayed as mean ± 1 S.D. Modulation of the UPR Interferes with HFE C282Y Stability-Previous studies have shown that HFE C282Y fails to travel beyond the ER and is subjected to accelerated proteasomal degradation in COS7 cells (3Waheed A. Parkkila S. Zhou X.Y. Tomatsu S. Tsuchihashi Z. Feder J.N. Schatzman R.C. Britton R.S. Bacon B.R. Sly W.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12384-12389Crossref PubMed Scopus (364) Google Scholar). Pulse-chase analysis performed in 293T cells confirmed these observations specifically in our transfected cell model system (Fig. 1A). In 293T cells overexpressing HFE WT or C282Y, only the WT protein can reach the cell surface as observed by flow cytometry (supplemental Fig. 1A) and by the HFE WT resistance to Endo H digestion (supplemental Fig. 1B). In contrast, no Endo H-resistant protein is observed in HFE C282Y-transfected cells, confirming that the mutant protein is unable to leave the ER through the standard secretory pathway (supplemental Fig. 1B). We have recently shown that the ER-retained HFE C282Y mutant protein leads to the activation of the UPR (8de Almeida S.F. Fleming J.V. Azevedo J.E. Carmo-Fonseca M. de Sousa M. J. Immunol. 2007; 178: 3612-3619Crossref PubMed Scopus (57) Google Scholar). To investigate the involvement of the ER stress pathway on the protein stability of HFE, 293T cells were co-transfected with plasmids encoding HFE WT or C282Y, and the UPR was genetically modulated by the co-expression of transcriptionally active isoforms of either ATF6 (nATF6) or XBP1 (sXBP1). Induction of the UPR was confirmed by analysis of GRP94 and BiP levels by Western blotting (supplemental Fig. 1C). Stimulation of the UPR by either sXBP1 or nATF6 resulted in highly significant decreases in steady state expression of the HFE C282Y protein compared with HFE WT (Fig. 1B). Chemical Chaperones Block the UPR Activation and Alter the HFE C282Y Stability-To evaluate the effect of chemical chaperones on the ER stress response, HFE WT- or C282Y-expressing cells were cultured in the presence of TUDCA and 4PBA. Using BiP and GRP94 levels as markers for the UPR activation, we observed that HFE C282Y-transfected cells treated with chemical chaperones have lower levels of both proteins indicating that these compounds were effective in inhibiting the activation of the UPR in HFE C282Y-expressing cells (Fig. 2A). As an independent measure of UPR activation, real time PCR was performed to quantify BiP expression at the transcriptional level. Although no significant effect was observed in HFE WT-transfected cells, analysis of the data showed a statistically significant decrease in BiP mRNA in HFE C282Y-transfected cells cultured in the presence of TUDCA or 4PBA when compared with untreated cells (Fig. 2B). The efficiency of chemical chaperones was further confirmed by the capacity of TUDCA to alleviate ER stress in cells co-expressing HFE C282Y plus nATF6 or sXBP1 (Fig. 2C). By having shown in Fig. 1 that stimulation of the UPR lowers the levels of HFE C282Y, treatment with chemical chaperones should rescue the mutant protein from degradation. Indeed, we observed increased levels of this protein in HFE C282Y-transfected cells when TUDCA was present in the culture medium (Fig. 2D, right-hand side blot, 2nd versus 3rd lane). However, treatment with 4PBA did not result in the stabilization of the HFE C282Y protein. In the presence of this chemical chaperone, the amount of protein detected was smaller than that observed in untreated cells (Fig. 2D, righthand side blot, 2nd versus 4th lane). HFE WT transfection did not result in the UPR activation (Fig. 2A). Neither TUDCA nor 4PBA had a significant effect on steady state expression of BiP, GRP94 (Fig. 2A), and HFE WT (Fig. 2D, left-hand side blot). To exclude a possible effect of the chemical chaperones on the transcription efficiency of HFE, mRNA from TUDCA or 4PBA-treated and -untreated cells was quantified by real time PCR. Fig. 3 shows that no significant differences were observed in the HFE mRNA levels, corroborating the hypothesis that 4PBA facilitates HFE C282Y degradation. Chemical Chaperones Do Not Restore HFE C282Y Cell Surface Expression-Several examples of mutant proteins whose folding defects are corrected by the action of chemical chaperones have already been described (5Welch W.J. Brown C.R. Cell Stress Chaperones. 1996; 1: 109-115Crossref PubMed Scopus (433) Google Scholar). As the C282Y mutation impairs the correct assembly of HFE molecules and concomitantly their trafficking beyond the ER toward the cell surface, we wanted to investigate if treatment with TUDCA or 4PBA promoted the stabilization of a conformation that restores HFE C282Y cell surface expression. To do that, 293T cells transiently expressing HFE WT-GFP or HFE C282Y-GFP were cultured in the presence or absence of TUDCA or 4PBA. Cell surface expression of HFE was then evaluated by flow cytometry analysis of the anti-HFE staining in GFP-positive cells (cells successfully transfected with HFE WT or HFE C282Y). The results revealed that treatment with the chemical chaperones had no effect on the correct cell surface expression of HFE WT when compared with untreated cells (Fig. 4A). Regarding the effect of TUDCA and 4PBA on HFE C282Y, this set of experiments revealed that none of the chemical chaperones used was able to restore the cell surface expression of the mutant protein (Fig. 4A). The failure of these compounds to promote the correct intracellular trafficking of HFE C282Y was further confirmed by the results obtained with Endo H. Following digestion with this glycosidase, analysis of protein extracts of cells expressing HFE C282Y and cultured in the presence or absence of TUDCA or 4PBA did not reveal any Endo H-resistant HFE protein, as observed by the conversion of all the protein to a deglycosylated (HFE-CHO) state with higher electrophoretic mobility (Fig. 4B, 1st versus 2nd to 4th lanes). These data strongly suggest that chemical chaperones cannot overcome HFE C282Y ER retention. 4PBA Prevents HFE C282Y Aggregation-To investigate the intracellular localization of the HFE C282Y protein, 293T cells expressing either HFE WT-GFP or HFE C282Y-GFP were stained with anti-KDEL Ab and analyzed by immunofluorescence microscopy. KDEL is an ER retentio" @default.
• W1989711933 created "2016-06-24" @default.
• W1989711933 creator A5021891414 @default.
• W1989711933 creator A5028663304 @default.
• W1989711933 creator A5031739787 @default.
• W1989711933 creator A5082475088 @default.
• W1989711933 creator A5083230780 @default.
• W1989711933 creator A5084673453 @default.
• W1989711933 date "2007-09-01" @default.
• W1989711933 modified "2023-10-16" @default.
• W1989711933 title "Chemical Chaperones Reduce Endoplasmic Reticulum Stress and Prevent Mutant HFE Aggregate Formation" @default.
• W1989711933 cites W1851503957 @default.
• W1989711933 cites W1970090817 @default.
• W1989711933 cites W1975405079 @default.
• W1989711933 cites W1988146888 @default.
• W1989711933 cites W1988482079 @default.
• W1989711933 cites W1989746014 @default.
• W1989711933 cites W1991671803 @default.
• W1989711933 cites W2002605005 @default.
• W1989711933 cites W2003666655 @default.
• W1989711933 cites W2017794825 @default.
• W1989711933 cites W2048456744 @default.
• W1989711933 cites W2054128877 @default.
• W1989711933 cites W2054159211 @default.
• W1989711933 cites W2068586920 @default.
• W1989711933 cites W2073727172 @default.
• W1989711933 cites W2076834744 @default.
• W1989711933 cites W2080638597 @default.
• W1989711933 cites W2087689873 @default.
• W1989711933 cites W2097965815 @default.
• W1989711933 cites W2100837269 @default.
• W1989711933 cites W2111256689 @default.
• W1989711933 cites W2112286580 @default.
• W1989711933 cites W2123064737 @default.
• W1989711933 cites W2138023380 @default.
• W1989711933 cites W2141937988 @default.
• W1989711933 cites W2143716524 @default.
• W1989711933 cites W2144065739 @default.
• W1989711933 cites W2168316603 @default.
• W1989711933 cites W2168637323 @default.
• W1989711933 doi "https://doi.org/10.1074/jbc.m702672200" @default.
• W1989711933 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17626021" @default.
• W1989711933 hasPublicationYear "2007" @default.
• W1989711933 type Work @default.
• W1989711933 sameAs 1989711933 @default.
• W1989711933 citedByCount "149" @default.
• W1989711933 countsByYear W19897119332012 @default.
• W1989711933 countsByYear W19897119332013 @default.
• W1989711933 countsByYear W19897119332014 @default.
• W1989711933 countsByYear W19897119332015 @default.
• W1989711933 countsByYear W19897119332016 @default.
• W1989711933 countsByYear W19897119332017 @default.
• W1989711933 countsByYear W19897119332018 @default.
• W1989711933 countsByYear W19897119332019 @default.
• W1989711933 countsByYear W19897119332020 @default.
• W1989711933 countsByYear W19897119332021 @default.
• W1989711933 countsByYear W19897119332022 @default.
• W1989711933 countsByYear W19897119332023 @default.
• W1989711933 crossrefType "journal-article" @default.
• W1989711933 hasAuthorship W1989711933A5021891414 @default.
• W1989711933 hasAuthorship W1989711933A5028663304 @default.
• W1989711933 hasAuthorship W1989711933A5031739787 @default.
• W1989711933 hasAuthorship W1989711933A5082475088 @default.
• W1989711933 hasAuthorship W1989711933A5083230780 @default.
• W1989711933 hasAuthorship W1989711933A5084673453 @default.
• W1989711933 hasBestOaLocation W19897119331 @default.
• W1989711933 hasConcept C104317684 @default.
• W1989711933 hasConcept C12554922 @default.
• W1989711933 hasConcept C139447449 @default.
• W1989711933 hasConcept C142724271 @default.
• W1989711933 hasConcept C143065580 @default.
• W1989711933 hasConcept C158617107 @default.
• W1989711933 hasConcept C185592680 @default.
• W1989711933 hasConcept C204328495 @default.
• W1989711933 hasConcept C2775962898 @default.
• W1989711933 hasConcept C55493867 @default.
• W1989711933 hasConcept C61397870 @default.
• W1989711933 hasConcept C71924100 @default.
• W1989711933 hasConcept C86803240 @default.
• W1989711933 hasConcept C95444343 @default.
• W1989711933 hasConceptScore W1989711933C104317684 @default.
• W1989711933 hasConceptScore W1989711933C12554922 @default.
• W1989711933 hasConceptScore W1989711933C139447449 @default.
• W1989711933 hasConceptScore W1989711933C142724271 @default.
• W1989711933 hasConceptScore W1989711933C143065580 @default.
• W1989711933 hasConceptScore W1989711933C158617107 @default.
• W1989711933 hasConceptScore W1989711933C185592680 @default.
• W1989711933 hasConceptScore W1989711933C204328495 @default.
• W1989711933 hasConceptScore W1989711933C2775962898 @default.
• W1989711933 hasConceptScore W1989711933C55493867 @default.
• W1989711933 hasConceptScore W1989711933C61397870 @default.
• W1989711933 hasConceptScore W1989711933C71924100 @default.
• W1989711933 hasConceptScore W1989711933C86803240 @default.
• W1989711933 hasConceptScore W1989711933C95444343 @default.
• W1989711933 hasIssue "38" @default.
• W1989711933 hasLocation W19897119331 @default.
• W1989711933 hasOpenAccess W1989711933 @default.
• W1989711933 hasPrimaryLocation W19897119331 @default.

• next