FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1990002364> ?p ?o ?g. }

• W1990002364 endingPage "27948" @default.
• W1990002364 startingPage "27943" @default.
• W1990002364 abstract "A phage display system for the selection of peptides binding to heterologously expressed human melanocortin receptor 1 on the surface of insect cells has been established. It could be shown that phage particles displaying the natural ligand α-melanocyte-stimulating hormone bind selectively to cells expressing this receptor and that these phages exhibit biological activity on mouse B16F1 melanoma cells. Insect cells were superior to other cell lines tested and have been used to select binders from a small library, in which critical determinants (Phe7-Arg8-Trp9) were kept, whereas the flanking regions where allowed to variate freely. One peptide displaying little similarity with native hormone was found that binds to the receptor also in its free form with an affinity of 7 nm. It showed a remarkable selectivity for this receptor, because it binds to the other melanocortin receptor subtypes with a maximum affinity of 21 μm. This is the first time phage display has been used successfully with G-protein-coupled receptors lacking an extracellular binding domain. A phage display system for the selection of peptides binding to heterologously expressed human melanocortin receptor 1 on the surface of insect cells has been established. It could be shown that phage particles displaying the natural ligand α-melanocyte-stimulating hormone bind selectively to cells expressing this receptor and that these phages exhibit biological activity on mouse B16F1 melanoma cells. Insect cells were superior to other cell lines tested and have been used to select binders from a small library, in which critical determinants (Phe7-Arg8-Trp9) were kept, whereas the flanking regions where allowed to variate freely. One peptide displaying little similarity with native hormone was found that binds to the receptor also in its free form with an affinity of 7 nm. It showed a remarkable selectivity for this receptor, because it binds to the other melanocortin receptor subtypes with a maximum affinity of 21 μm. This is the first time phage display has been used successfully with G-protein-coupled receptors lacking an extracellular binding domain. Phage display techniques, i.e. the display of libraries of peptides, enzymes, antibodies, and other proteins on the surface of bacteriophages and selection of functional sequences thereof, have undergone a rapid development (1Kay B. Winter J. McCafferty J. Phage Display of Peptides and Proteins: A Laboratory Manual. Academic Press, San Diego1996Google Scholar, 2Cortese R. Monaci P. Nicosia A. Luzzago A. Felici F. Galfre G. Pessi A. Tramontano A. Sollazzo M. Curr. Opin. Biotechnol. 1995; 6: 73-80Crossref PubMed Scopus (124) Google Scholar, 3O'Neil K.T. DeGrado W.F. Mousa S.A. Ramachandran N. Hoess R.H. Methods Enzymol. 1994; 245: 370-386Crossref PubMed Scopus (13) Google Scholar). Originally used as selection systems to identify peptide epitopes (4Smith G.P. Science. 1985; 228: 1315-1317Crossref PubMed Scopus (3010) Google Scholar, 5Parmley S.F. Smith G.P. Adv. Exp. Med. Biol. 1989; 251: 215-218PubMed Google Scholar), phage display is today in use for almost any kind of problem that involves the interaction of peptides and proteins with other materials. Most of the published literature deals with the development of antibodies (6Clackson T. Hoogenboom H.R. Griffiths A.D. Winter G. Nature. 1991; 352: 624-628Crossref PubMed Scopus (977) Google Scholar, 7Hoogenboom H.R. Griffiths A.D. Johnson K.S. Chiswell D.J. Hudson P. Winter G. Nucleic Acids Res. 1991; 19: 4133-4137Crossref PubMed Scopus (888) Google Scholar, 8Marks J.D. Hoogenboom H.R. Bonnert T.P. McCafferty J. Griffiths A.D. Winter G. J. Mol. Biol. 1991; 222: 581-597Crossref PubMed Scopus (1420) Google Scholar). With the use of this technique one comes close to the power of the human immune system. Other milestones were the display of enzymes (9McCafferty J. Jackson R.H. Chiswell D.J. Protein Eng. 1991; 4: 955-961Crossref PubMed Scopus (115) Google Scholar), enzyme inhibitors (10Roberts B.L. Markland W. Siranosian K. Saxena M.J. Guterman S.K. Ladner R.C. Gene (Amst.). 1992; 121: 9-15Crossref PubMed Scopus (47) Google Scholar), hormones (11Lowman H.B. Wells J.A. J. Mol. Biol. 1993; 234: 564-578Crossref PubMed Scopus (219) Google Scholar), and cloning of active protein domains (12Jacobsson K. Frykberg L. BioTechniques. 1995; 18: 878-885PubMed Google Scholar), to list only a few applications. Among the numerous publications about the display of hormones there are only a few dealing with the bioactivity of the phage (for examples see Refs. 13Saggio I. Gloaguen I. Laufer R. Gene (Amst.). 1995; 152: 35-39Crossref PubMed Scopus (25) Google Scholar and 14Gram H. Strittmatter U. Lorenz M. Gluck D. Zenke G. J. Immunol. Methods. 1993; 161: 169-176Crossref PubMed Scopus (39) Google Scholar), because in almost all cases purified domains of cell surface receptors are used for the selection of binders from libraries (for examples see Refs. 11Lowman H.B. Wells J.A. J. Mol. Biol. 1993; 234: 564-578Crossref PubMed Scopus (219) Google Scholarand 15Saggio I. Gloaguen I. Poiana G. Laufer R. EMBO J. 1995; 14: 3045-3054Crossref PubMed Scopus (54) Google Scholar). Only a very few successful experiments are published with receptors displayed on living cells and in all such cases the receptors bind the ligands with extracellular domains (16Doorbar J. Winter G. J. Mol. Biol. 1994; 244: 361-369Crossref PubMed Scopus (94) Google Scholar, 17Goodson R.J. Doyle M.V. Kaufman S.E. Rosenberg S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 7129-7133Crossref PubMed Scopus (197) Google Scholar, 18Doyle M.V. Doyle L.V. Fong S. Goodson R.J. Panganiban L. Drummond R. Winter J. Rosenberg S. Cortese R. Combinatorial Libraries: Synthesis, Screening and Application Potential. deGruyter, Berlin1995: 159-174Google Scholar). The selection of random libraries of small peptides is naturally rendered more difficult when working with impure target proteins. Libraries of larger protein ligands usually contain common structural features directing and restricting binding of phages to the intended target. Especially G-protein-coupled receptors for small ligands that bind the ligands within their transmembrane helices have been the exclusive target for chemical peptide and other compound libraries (19Dooley C.T. Houghten R.A. Life Sci. 1993; 52: 1509-1517Crossref PubMed Scopus (177) Google Scholar, 20Dooley C.T. Chung N.N. Wilkes B.C. Schiller P.W. Bidlack J.M. Pasternak G.W. Houghten R.A. Science. 1994; 266: 2019-2022Crossref PubMed Scopus (153) Google Scholar, 21Zuckermann R.N. Martin E.J. Spellmeyer D.C. Stauber G.B. Shoemaker K.R. Kerr J.M. Figliozzi G.M. Goff D.A. Siani M.A. Simon R.J. Banville S.C. Brown E.G. Wang L. Richter L.S. Moos W.H. J. Med. Chem. 1994; 37: 2678-2685Crossref PubMed Scopus (350) Google Scholar, 22Dooley C.T. Kaplan R.A. Chung N.N. Schiller P.W. Bidlack J.M. Houghten R.A. Pept. Res. 1995; 8: 124-137PubMed Google Scholar, 23Hirschmann R. Yao W. Cascieri M.A. Strader C.D. Maechler L. Cichy-Knight M.A. Hynes Jr., J. van-Rijn R.D. Sprengeler P.A. Smith 3rd, A.B.- J. Med. Chem. 1996; 39: 2441-2448Crossref PubMed Scopus (67) Google Scholar). These can be analyzed and deconvoluted by other means than just the affinity of the compounds, as has been shown for example for the MC1 receptor (24Quillan J.M. Jayawickreme C.K. Lerner M.R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2894-2898Crossref PubMed Scopus (58) Google Scholar), but they lack the complexity of bacteriophage displayed libraries. Because these receptors have not yet been purified in quantities and in a quality sufficient for the standard panning of phages, the selection on isolated membranes or whole cells remains the only possibility. Good candidates for studying whether phage panning on such receptors is possible in principle against these odds are the recently cloned melanocortin receptors. Some of their ligands, the family of melanocortin peptides, have been known already for a long time for their effects on pigmentation in melanocytes (α-MSH) 1The abbreviations used are: α-MSH, α-melanocyte-stimulating hormone; gpIII, product of bacteriophage fd geneIII; MC, melanocortin; PCR, polymerase chain reaction. 1The abbreviations used are: α-MSH, α-melanocyte-stimulating hormone; gpIII, product of bacteriophage fd geneIII; MC, melanocortin; PCR, polymerase chain reaction. and for regulation of steroid production in the adrenal gland (adrenocorticotropic hormone). Already in early studies it was recognized that they display numerous other effects (25O'Donahue T.L. Dorsa D.M. Peptides. 1982; 3: 353-395Crossref PubMed Scopus (506) Google Scholar, 26Eberle A.N. The Melanotropins; Chemistry, Physiology and Mechanisms of Action. Karger, Basel, Switzerland1988: 210-319Google Scholar), which is now confirmed and explained by molecular cloning of different receptor subtypes. The first receptor to be cloned was the melanocortin receptor (MC1) of the melanocytes, soon followed by the identification of the adrenocorticotropic hormone receptor of the adrenal gland (MC2) and three other receptor subtypes (MC3, MC4, and MC5) with initially unknown functions (27Chhajlani V. Wikberg J.E.S. FEBS Lett. 1992; 309: 417-420Crossref PubMed Scopus (575) Google Scholar, 28Mountjoy K.G. Robbins L.S. Mortrud M.T. Cone R.D. Science. 1992; 257: 1248-1251Crossref PubMed Scopus (1443) Google Scholar, 29Gantz I. Konda Y. Tashiro T. Shimoto Y. Miwa H. Munzert G. Watson S.J,. DelValle J. Yamada T. J. Biol. Chem. 1993; 268: 8246-8250Abstract Full Text PDF PubMed Google Scholar, 30Gantz I. Miwa H. Konda Y. Shimoto Y. Tashiro T. Watson S.J. DelValle J. Yamada T. J. Biol. Chem. 1993; 268: 15174-15179Abstract Full Text PDF PubMed Google Scholar, 31Chhajlani V. Muceniece R. Wikberg J.E.S. Biochem. Biophys. Res. Commun. 1993; 195: 866-873Crossref PubMed Scopus (317) Google Scholar). The distribution of these receptors in different tissues is known (29Gantz I. Konda Y. Tashiro T. Shimoto Y. Miwa H. Munzert G. Watson S.J,. DelValle J. Yamada T. J. Biol. Chem. 1993; 268: 8246-8250Abstract Full Text PDF PubMed Google Scholar, 31Chhajlani V. Muceniece R. Wikberg J.E.S. Biochem. Biophys. Res. Commun. 1993; 195: 866-873Crossref PubMed Scopus (317) Google Scholar, 32Roselli-Rehfuss L. Mountjoy K.G. Robbins L.S. Mortrud M.T. Low M.J. Tatro J.B. Entwistle M.L. Simerly R.B. Cone R.D. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8856-8860Crossref PubMed Scopus (659) Google Scholar, 33Chhajlani V. Biochem. Mol. Biol. Int. 1996; 38: 73-80PubMed Google Scholar), but the cellular function of these three subtypes is still not identified. Only the MC4 receptor, which is found in many tissues of the brain (30Gantz I. Miwa H. Konda Y. Shimoto Y. Tashiro T. Watson S.J. DelValle J. Yamada T. J. Biol. Chem. 1993; 268: 15174-15179Abstract Full Text PDF PubMed Google Scholar, 34Mountjoy K.G. Mortrud M.T. Low M.J. Simerly R.B. Cone R.D. Mol. Endocrinol. 1994; 8: 1298-1308Crossref PubMed Scopus (1021) Google Scholar), has recently been identified to be involved in weight homeostasis (35Huszar D. Lynch C.A. Fairchild-Huntress V. Dunmore J.H. Fang Q. Berkemeier L.R. Gu W. Kesterson R.A. Boston B.A. Cone R.D. Smith F.J. Campfield L.A. Burn P. Lee F. Cell. 1997; 88: 131-141Abstract Full Text Full Text PDF PubMed Scopus (2516) Google Scholar, 36Fan W. Boston B.A. Kesterson R.A. Hruby V.J. Cone R.D. Nature. 1997; 385: 165-168Crossref PubMed Scopus (1649) Google Scholar). Aside from the MC2 receptor, all of them bind the 13-amino acid-long α-MSH or analogues with nanomolar and subnanomolar affinities (37Schiöth H.B. Muceniece R. Wikberg J.E.S. Chhajlani V. Eur. J. Pharmacol. Mol. Pharm. Sect. 1995; 288: 311-317Crossref PubMed Scopus (115) Google Scholar, 38Schiöth H.B. Muceniece R. Wikberg J.E.S. Pharmacol. Toxicol. 1996; 79: 161-165Crossref PubMed Scopus (125) Google Scholar, 39Schiöth H.B. Chhajlani V. Muceniece R. Klusa V. Wikberg J.E.S. Life Sci. 1996; 59: 797-801Crossref PubMed Scopus (143) Google Scholar, 40Schiöth H.B. Kuusinen A. Muceniece R. Szardenings M. Keinänen K. Wikberg J.E.S. Biochem. Biophys. Res. Commun. 1996; 221: 807-814Crossref PubMed Scopus (27) Google Scholar), but ligands highly specific for a single receptor subtype have not been found up to now. Intense studies have been carried out on the characterization and identification of residues involved in binding of the receptors, and the synthesis of numerous natural and unnatural peptides have been tried to achieve peptides with selectivity for a single receptor (24Quillan J.M. Jayawickreme C.K. Lerner M.R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2894-2898Crossref PubMed Scopus (58) Google Scholar, 41Hruby V.J. Lu D. Sharma S.D. Castrucci A.L. Kesterson R.A. Al-Obeidi F.A. Hadley M.E. Cone R.D. J. Med. Chem. 1995; 38: 3454-3461Crossref PubMed Scopus (343) Google Scholar, 42Adan R.A.H. Oosterom J. Ludviksdottir G. Brakkee J.H. Burbach J.P.H. Gispen W.H. Eur. J. Pharmacol. 1994; 269: 331-337Crossref PubMed Scopus (59) Google Scholar). A common and essential motif of natural MSH peptides is a stretch of four amino acids (His6-Phe7-Arg8-Trp9) believed to be essential for binding, an usually short N terminus preceding this sequence, and a less size-restricted C-terminal sequence (26Eberle A.N. The Melanotropins; Chemistry, Physiology and Mechanisms of Action. Karger, Basel, Switzerland1988: 210-319Google Scholar). These are features that should allow the design of phage libraries, where the C terminus is linked to the phage protein. It should also be possible to improve the selection procedure by using only partially randomized sequences with the motif His6-Phe7-Arg8-Trp9 or parts thereof. This should restrict specific phage binding to the receptor protein. This report shows that phages displaying an α-MSH-gpIII fusion protein bind specifically to cells expressing the MC1 receptor and even retain a biological activity. A selection system based on heterologously expressed receptors on the cell surface was established and was exploited to select novel peptides specific for the MC1 receptor from a phage display library. Plasmid pComb3d derived from pComb3 (43Barbas C. Kang A.S. Lerner R.A. Benkovic S.J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 7978-7982Crossref PubMed Scopus (1021) Google Scholar) with the light chain cloning sites removed as a NheI fragment (44Widersten M. Mannervik B. J. Mol. Biol. 1995; 250: 115-122Crossref PubMed Scopus (96) Google Scholar) and pG3H6 (45Jacobsson K. Jonsson H. Lindmark H. Guss B. Lindberg M. Frykberg L. Microbiol. Res. 1997; 152: 1-8Crossref Scopus (16) Google Scholar), a derivative of pHEN (7Hoogenboom H.R. Griffiths A.D. Johnson K.S. Chiswell D.J. Hudson P. Winter G. Nucleic Acids Res. 1991; 19: 4133-4137Crossref PubMed Scopus (888) Google Scholar), were used in this study. The plasmids were cut with EcoRI/SmaI and PstI/XhoI, respectively. PCR reactions were carried out in 100-μl volumes with 5 μm dNTPs and 2 units of Vent or exo −-Vent-polymerase (Biolabs) in the buffer supplied with the enzymes. In a typical PCR reaction about 500 ng of template DNA and 20 pmol of each primer were used. The PCR reactions were carried out in a Biometra Trio PCR cycler using the following cycling: three cycles of 94 °C for 30 s, 48 °C for 30 s, and 72 °C for 6 min; seventeen cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 6 min); and then one cycle of 72 °C for 10 min. The primers were kinased with T4 polynucleotide kinase (Boehringer Mannheim) prior to PCR. The oligonucleotides used in this study were MS-4pcr (5′AACAGGTTTACCCCAACGGAAGTGCTCCATAGAGTAAGAGGCCATGGCTGGTTGGGCAGC-3′) and MS-5pcr (5′-VNNVNNVNNVNNCCAACGGAAVNNVNNVNNVNNVNNAGAGGCCATGGCTGGTTGGGCAGCGAGTA-3′) (N = A, C, G, or T; V = A, C, or G) with a 3′ sequence complementary to the pelB leader sequence gene in both vectors and cp3–1 (5′-CCCGGGGCCGCATAGACTGTT-3′) and cp3–198 (5′-CCCGGGGGCGGTGGCTCTCCA-3′) partially complementary to the 5′ region of geneIII in the vectors pG3H6 and pComb3d, respectively. PCR products were purified by agarose gel electrophoresis (46Boyle J.S. Lew A.M. Trends Genet. 1995; 11: 8Abstract Full Text PDF PubMed Scopus (181) Google Scholar). Ligation reactions were carried out with T4 ligase at a DNA concentration of 4–6 μg/ml in 500-μl volumes at 15 °C overnight. For standard transformation a simple one-step procedure was used (47Chung C.T. Miller R.H. Methods Enzymol. 1993; 218: 621-627Crossref PubMed Scopus (55) Google Scholar). For library construction the ligation products (3 μg) were purified on a silica support (JetPure, Genomed) and used for 12 individual electroporations of XL1-Blue using Electroporator II (InVitrogen) according to the manufacturer's descriptions. All media used were ISO approved and obtained from Difco or Oxoid. To avoid counterselection due to overexpression of the gpIII fusion protein only freshly transformed bacteria were used. Precultures of XL1-Blue harboring the phagemid were grown in Antibiotic-Medium-3 with 30 μg/ml tetracycline and 250 μg/ml ampicillin at 37 °C. dYT medium (10 g/liter yeast extract, 16 g/liter BactoTryptone, 5 g/liter NaCl) with ampicillin was inoculated 1:100 with this culture, and library transformed cells were directly added to about 200 ml in a 1-liter erlenmeyer flask. At anA 555 of 0.5–0.7 the culture was superinfected at a multiplicity of infection of 5 with low titer M13KO7 (48Vieira J. Messing J. Methods Enzymol. 1987; 153: 3-11Crossref PubMed Scopus (1998) Google Scholar) prepared as in Ref. 49Szardenings M. Collins J. Gene (Amst.). 1990; 94: 1-7Crossref PubMed Scopus (11) Google Scholar. After 1 h, kanamycin (30 μg/ml) and optionally isopropyl β-d-thiogalactoside (0.5 mm) were added. The culture was shaken an additional 8–12 h, the bacteria were removed carefully in 1–2 centrifugation steps, and phages were precipitated in the cold by addition of ¼ volume filtered 20% PEG6000, 2.5 m NaCl and centrifugation at 20,000 ×g. The resulting phage pellet was resuspended in 110of the original volume 100 mm HEPES (pH 7.2), centrifuged to remove insoluble debris, precipitated a second time, and finally resuspended in 1100 of the original volume HEPES buffer. These phage preparations did not disturb the growth of HEK293 or COS-1 cells if diluted 1:500 in cell culture medium. Aliquots of purified libraries were stored at −70 °C with 50% glycerol. The melanocortin receptors were cloned into pZeoSV (InVitrogen). The resulting vectors were used for transformation of the mammalian cell lines HEK293 (50Graham F.L. Smiley J. Russell W.C. Nairn R. J. Gen. Virol. 1977; 36: 59-74Crossref PubMed Scopus (3446) Google Scholar) and COS-1 (51Gluzman Y. Cell. 1981; 23: 175-182Abstract Full Text PDF PubMed Scopus (1449) Google Scholar) using liposomes (52Campbell M.J. BioTechniques. 1995; 18: 1027-1032PubMed Google Scholar) as described previously (53Schiöth H.B. Muceniece R. Wikberg J.E.S. Szardenings M. Eur. J. Pharmacol. 1996; 314: 381-384Crossref PubMed Scopus (12) Google Scholar). Cells were cultivated in Dulbecco's modified Eagle's medium with 10% fetal calf serum at 7% CO2. Transfected cell lines were kept under selection of 180 μg/ml, respectively, 250 μg/ml zeocin for at least 2–3 days. COS-1 cells could even be distributed two or three times under selection pressure without loss of receptors. Sf9 (54Smith G.E. Ju G. Ericson B.L. Moschera J. Lahm H.W. Chizzonite R. Summers M.D. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 8404-8408Crossref PubMed Scopus (218) Google Scholar) and High Five (InVitrogen; Ref. 55Wickham T.J. Davis T. Granados R.R. Shuler M.L. Wood H.A. Biotechnol. Prog. 1992; 8: 391-396Crossref PubMed Scopus (229) Google Scholar) insect cell lines were grown in synthetic medium (SF900II, Life Technologies, Inc.) and infected with baculovirus v508-6 carrying a gene for the hMC1 receptor as described (40Schiöth H.B. Kuusinen A. Muceniece R. Szardenings M. Keinänen K. Wikberg J.E.S. Biochem. Biophys. Res. Commun. 1996; 221: 807-814Crossref PubMed Scopus (27) Google Scholar) in T80 flasks. 48 h after infection the cells were dissociated by pounding the flasks several times on the table and collecting cells by centrifugation. Peptides were synthesized on a Pioneer Peptide Synthesis System (PerSeptive Biosystems) and purified by high pressure liquid chromatography. The molecular weight of the peptides was confirmed by mass spectrometry. B16F1 cells expressing the mMC1 receptor (56Lunec J. Pieron C. Thody A.J. Melanoma Res. 1992; 2: 5-12Crossref PubMed Scopus (40) Google Scholar) were grown as above. Cells were detached from almost confluent adherent cultures and incubated for 30–60 min at 37 °C in ordinary growth medium containing 0.5 mm of the phosphodiesterase inhibitor 3-iso-butyl-1-methyl-xanthine. 50-μl aliquots of the hormone dilutions in growth medium were prepared in 1.5-ml tubes and placed in a water bath at 37 °C. For the stimulation about 3 × 105 cells in 450 μl were quickly added to each tube to obtain immediate mixing. After 20 min, 50 μl of 4.4m perchloric acid were added, mixed, neutralized after a few minutes by the addition of 50 μl of base (5 m KOH, 1m Tris), and centrifuged. The determination of cAMP in the resulting supernatant was carried out as described (57Nordstedt C. Fredholm B.B. Anal. Biochem. 1990; 189: 231-234Crossref PubMed Scopus (249) Google Scholar). All binding and selection experiments with phages as well as radio ligand competition experiments were carried out in buffers and under conditions as described previously for COS-1 (37Schiöth H.B. Muceniece R. Wikberg J.E.S. Chhajlani V. Eur. J. Pharmacol. Mol. Pharm. Sect. 1995; 288: 311-317Crossref PubMed Scopus (115) Google Scholar) and Sf9 (40Schiöth H.B. Kuusinen A. Muceniece R. Szardenings M. Keinänen K. Wikberg J.E.S. Biochem. Biophys. Res. Commun. 1996; 221: 807-814Crossref PubMed Scopus (27) Google Scholar) cells; in addition, 1 mm 2-mercaptoethanol was added to protect the free sulfhydryl groups of some peptides. Phage binding experiments were usually carried out with total phagemid titers of 1 × 109 colony-forming units/ml. For competition experiments with pGEM7 (Promega) phagemid solution usually contained about 2% pMS4-23 or pMS4-26. 2.5 × 106 insect cells or 1 × 106 COS-1 were incubated at 37 °C gently shaken in a water bath in 4 ml of phage suspension in binding buffer (Ref. 37Schiöth H.B. Muceniece R. Wikberg J.E.S. Chhajlani V. Eur. J. Pharmacol. Mol. Pharm. Sect. 1995; 288: 311-317Crossref PubMed Scopus (115) Google Scholar, minimal essential medium with proteinase inhibitors) for 30 min. The cells were washed four times with 4 ml of binding buffer after centrifugation at a maximum of 1000 × g for 10 min. Finally only 1 ml of binding buffer was added, and the incubation was extended to 30 min. Cells were harvested by centrifugation at 5000 × g, and aliquots of the cell pellet and this final supernatant were used to infect logarithmic cultures of XL1-blue at different dilutions. After 30 min of incubation at 37 °C, the bacteria were plated on agar plates containing 250 μg/ml ampicillin, 0.5 mm isopropyl β-d-thiogalactoside, and 40 μg/ml X-Gal. Blue/white colonies were counted after 20 h of incubation in the dark at 37 °C. In library panning the entire cell pellet was used to infect 100 ml of XL1-blue atA 555 = 0.4–0.6 and grown as described above. For library analysis an aliquot was plated on agar plates containing 250 μg/ml ampicillin 1–2 h after the infection. To display α-MSH in an active form on bacteriophages constructs were made by long inverse PCR amplification of the entire plasmids. Although we are still not satisfied with the quality of the DNA obtained, other groups recently applied a similar approach for codon mutagenesis (58Eisinger D.P. Trumpower B.L. BioTechniques. 1996; 22: 250-254Crossref Scopus (7) Google Scholar) and deletions (59Hidajat R. McNicol P. BioTechniques. 1997; 22: 32-34Crossref PubMed Scopus (11) Google Scholar), indicating that this still could be a useful approach for the generation of peptide libraries in smaller vectors. Two constructs were made originally, based on the vectors pG3H6 (45Jacobsson K. Jonsson H. Lindmark H. Guss B. Lindberg M. Frykberg L. Microbiol. Res. 1997; 152: 1-8Crossref Scopus (16) Google Scholar) and a pComb3 derivative (43Barbas C. Kang A.S. Lerner R.A. Benkovic S.J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 7978-7982Crossref PubMed Scopus (1021) Google Scholar, 44Widersten M. Mannervik B. J. Mol. Biol. 1995; 250: 115-122Crossref PubMed Scopus (96) Google Scholar) fusing the sequence of human α-MSH to the N terminus (pMS4-23 from pG3H6) and amino acid 198 (pMS4-26 from pComb3d) of bacteriophage fd geneIII as outlined in Fig.1. Cyclizing the PCR product with DNA ligase resulted in vectors containing no additional sequences above those needed for the phage display. pMS4-23 behaved similarly to pMS4-26, but we did not study this construct in great detail, because it turned out to be difficult to obtain clean phage preparations due to lysis of the bacterial host. Both constructs required induction by isopropyl β-d-thiogalactoside, otherwise no enrichment on cells expressing the MC1 receptor was found (data not shown). The phagemids obtained were tested for specific binding to the hMC1 receptor heterologously expressed in the mammalian cell lines HEK293 and COS-1, as well as baculovirus-infected insect cells. We tried to improve the amounts of receptor generally obtained in our laboratory in mammalian cell culture using the vector pZEO-SV (InVitrogen). COS-1 cells expressing the large SV40 antigen maintained this plasmid due to its SV40 origin and could be replated at least three times under selection without loss of receptor expression, reducing the experimental effort involved in the transfection of cells, but these procedures did not improve the number of binding sites significantly above levels published earlier (40Schiöth H.B. Kuusinen A. Muceniece R. Szardenings M. Keinänen K. Wikberg J.E.S. Biochem. Biophys. Res. Commun. 1996; 221: 807-814Crossref PubMed Scopus (27) Google Scholar). Insect cells infected with baculovirus v508-6 (40Schiöth H.B. Kuusinen A. Muceniece R. Szardenings M. Keinänen K. Wikberg J.E.S. Biochem. Biophys. Res. Commun. 1996; 221: 807-814Crossref PubMed Scopus (27) Google Scholar) turned out to express at least the same number of receptors per cell, although they are substantially smaller in size. 2M. Szardenings, unpublished results. Because panning with adherently growing cells failed, gentle centrifugation of detached cells had to be used instead. HEK293 cells lysed during these procedures. COS-1 cells were more stable and used for more intensive studies together with different insect cell lines. The binding experiments were carried out with pMS4-26 in direct competition with a 50-fold excess of phagemids derived from pGEM7, which allowed easy evaluation of the binding experiments after infecting Escherichia coli XL1-blue and counting blue (pGEM7) and white colonies on X-Gal plates (TableI). Because incubation in the final washing step for more than 1 h was not sufficient to remove the majority of bound phage, we used also the resuspended cell pellet to infect XL1-blue. The addition of the MC1 ligand [Nle4,d-Phe7]α-MSH (2 μm) had no effect on phage elution in the final step, but the same concentration did abolish all enrichment when applied in the first incubation step (data not shown). This is not unusual for this receptor, because the complexes of the MC1 receptor with natural and synthetic ligands also exhibit high stability and low dissociation constants (60Haskell-Luevano C. Miwa H. Dickinson C. Hadley M.E. Hruby V.J. Yamada T. Gantz I. J. Med. Chem. 1996; 39: 432-435Crossref PubMed Scopus (45) Google Scholar). In general only a very weak enrichment of pMS4-26 phage particles over pGEM7 on COS-1 expressing the receptor could be seen. This may be caused by a high unspecific binding of phage particles to the membranes under the conditions used for selection, and a similar tendency had been found earlier (17Goodson R.J. Doyle M.V. Kaufman S.E. Rosenberg S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 7129-7133Crossref PubMed Scopus (197) Google Scholar). Recently published data about peptides selected on insect cells revealed a strong preference for sequences containing tryptophan and arginine as present in all displayed peptides (18Doyle M.V. Doyle L.V. Fong S. Goodson R.J. Panganiban L. Drummond R. Winter J. Rosenberg S. Cortese R. Combinatorial Libraries: Synthesis, Screening and Application Potential. deGruyter, Berlin1995: 159-174Google Scholar). There seemed to be a slight enrichment of pMS4-26 on insect cells without the MC1 receptor, but the statistics of these data were weak and seemed not to rectify alternating library selection on insect cells and mammalian cells as had been necessary to obtain ligands for the urokinase receptor (17Goodson R.J. Doyle M.V. Kaufman S.E. Rosenberg S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 7129-7133Crossref PubMed Scopus (197) Google Scholar). The difference of binding on Sf9 and High Five cells may simply be due to a slightly higher expressional level found with the latter. These expression levels vary even within our lab, and the conclusion that those cells are in general better should not be drawn from these data.Table IEnrichment of pMS4–26 phagemids over pGEM7 phagemidsCOS mc1SF9 gluSF9 mc1Hi-5Hi-5 mc1WashPelletWashPelletWashPelletWashPelletWashPelletAverage enrichment×1.72 ± 0.21×1.75 ± 0.75×1.6 ± 1.65×1.71 ± 1.07×2.5 ± 0.55×7.05 ± 3.22×1.69 ± 0.41×2.76 ± 1.3×2.32 ± 0.94×15.9 ± 1.94No. exp.n = 5n = 5n = 4n = 4n = 6n = 6n = 2n = 2n = 4n = 4Experiments presented here were carried out using COS-1, baculovirus-infected SF9 and High Five cells expressing the MC1 receptor, infected SF9 cells expressing a subunit of the" @default.
• W1990002364 created "2016-06-24" @default.
• W1990002364 creator A5011188399 @default.
• W1990002364 creator A5025447223 @default.
• W1990002364 creator A5036290531 @default.
• W1990002364 creator A5045879308 @default.
• W1990002364 creator A5059736207 @default.
• W1990002364 creator A5081984122 @default.
• W1990002364 creator A5085253268 @default.
• W1990002364 date "1997-10-01" @default.
• W1990002364 modified "2023-10-10" @default.
• W1990002364 title "Phage Display Selection on Whole Cells Yields a Peptide Specific for Melanocortin Receptor 1" @default.
• W1990002364 cites W112591529 @default.
• W1990002364 cites W1549258100 @default.
• W1990002364 cites W1549372716 @default.
• W1990002364 cites W1555021163 @default.
• W1990002364 cites W1566308385 @default.
• W1990002364 cites W1727138331 @default.
• W1990002364 cites W1964847660 @default.
• W1990002364 cites W1965274591 @default.
• W1990002364 cites W1979420492 @default.
• W1990002364 cites W1981321765 @default.
• W1990002364 cites W1983245830 @default.
• W1990002364 cites W1987823655 @default.
• W1990002364 cites W1991255999 @default.
• W1990002364 cites W2000183149 @default.
• W1990002364 cites W2001977731 @default.
• W1990002364 cites W2007601585 @default.
• W1990002364 cites W2008782354 @default.
• W1990002364 cites W2010142606 @default.
• W1990002364 cites W2015370922 @default.
• W1990002364 cites W2015451996 @default.
• W1990002364 cites W2015608844 @default.
• W1990002364 cites W2018205221 @default.
• W1990002364 cites W2018650843 @default.
• W1990002364 cites W2021106556 @default.
• W1990002364 cites W2021583967 @default.
• W1990002364 cites W2023234589 @default.
• W1990002364 cites W2025827008 @default.
• W1990002364 cites W2027827094 @default.
• W1990002364 cites W2034254870 @default.
• W1990002364 cites W2038911909 @default.
• W1990002364 cites W2042658226 @default.
• W1990002364 cites W2044296969 @default.
• W1990002364 cites W2052332203 @default.
• W1990002364 cites W2061883290 @default.
• W1990002364 cites W2061916904 @default.
• W1990002364 cites W2065389660 @default.
• W1990002364 cites W2069448677 @default.
• W1990002364 cites W2070360032 @default.
• W1990002364 cites W2071378581 @default.
• W1990002364 cites W2075412315 @default.
• W1990002364 cites W2077288582 @default.
• W1990002364 cites W2084547258 @default.
• W1990002364 cites W2084677170 @default.
• W1990002364 cites W2088167128 @default.
• W1990002364 cites W2089595455 @default.
• W1990002364 cites W2091663002 @default.
• W1990002364 cites W2092830012 @default.
• W1990002364 cites W2095414142 @default.
• W1990002364 cites W2132031535 @default.
• W1990002364 cites W2144969564 @default.
• W1990002364 cites W2155309949 @default.
• W1990002364 cites W2162250498 @default.
• W1990002364 cites W2164015875 @default.
• W1990002364 cites W2216201316 @default.
• W1990002364 cites W2355345 @default.
• W1990002364 cites W77293332 @default.
• W1990002364 doi "https://doi.org/10.1074/jbc.272.44.27943" @default.
• W1990002364 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9346944" @default.
• W1990002364 hasPublicationYear "1997" @default.
• W1990002364 type Work @default.
• W1990002364 sameAs 1990002364 @default.
• W1990002364 citedByCount "78" @default.
• W1990002364 countsByYear W19900023642012 @default.
• W1990002364 countsByYear W19900023642013 @default.
• W1990002364 countsByYear W19900023642015 @default.
• W1990002364 countsByYear W19900023642018 @default.
• W1990002364 countsByYear W19900023642022 @default.
• W1990002364 crossrefType "journal-article" @default.
• W1990002364 hasAuthorship W1990002364A5011188399 @default.
• W1990002364 hasAuthorship W1990002364A5025447223 @default.
• W1990002364 hasAuthorship W1990002364A5036290531 @default.
• W1990002364 hasAuthorship W1990002364A5045879308 @default.
• W1990002364 hasAuthorship W1990002364A5059736207 @default.
• W1990002364 hasAuthorship W1990002364A5081984122 @default.
• W1990002364 hasAuthorship W1990002364A5085253268 @default.
• W1990002364 hasBestOaLocation W19900023641 @default.
• W1990002364 hasConcept C104317684 @default.
• W1990002364 hasConcept C127716648 @default.
• W1990002364 hasConcept C154945302 @default.
• W1990002364 hasConcept C170493617 @default.
• W1990002364 hasConcept C182843373 @default.
• W1990002364 hasConcept C185592680 @default.
• W1990002364 hasConcept C186268636 @default.
• W1990002364 hasConcept C2777241137 @default.
• W1990002364 hasConcept C2779281246 @default.
• W1990002364 hasConcept C2779993316 @default.

• next