FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1990024993> ?p ?o ?g. }

• W1990024993 endingPage "269" @default.
• W1990024993 startingPage "261" @default.
• W1990024993 abstract "Topological studies of multi-spanning membrane proteins commonly use sequentially truncated proteins fused to a C-terminal translocation reporter to deduce transmembrane (TM) segment orientation and key biogenesis events. Because these truncated proteins represent an incomplete stage of synthesis, they transiently populate intermediate folding states that may or may not reflect topology of the mature protein. For example, in Xenopus oocytes, the aquaporin-1 (AQP1) water channel is cotranslationally directed into a four membrane-spanning intermediate, which matures into the six membrane-spanning topology at a late stage of synthesis (Skach, W. R., Shi, L. B., Calayag, M. C., Frigeri, A., Lingappa, V. R., and Verkman, A. S. (1994) J. Cell Biol. 125, 803–815 and Lu, Y., Turnbull, I. R., Bragin, A., Carveth, K., Verkman, A. S., and Skach, W. R. (2000) Mol. Biol. Cell 11, 2973–2985). The hallmark of this process is that TM3 initially acquires an Nexo/Ccyto (Type I) topology and must rotate 180° to acquire its mature orientation. In contrast, recent studies in HEK-293 cells have suggested that TM3 acquires its mature topology cotranslationally without the need for reorientation (Dohke, Y., and Turner, R. J. (2002) J. Biol. Chem. 277, 15215–15219). Here we re-examine AQP1 biogenesis and show that irrespective of the reporter or fusion site used, oocytes and mammalian cells yielded similar topologic results. AQP1 intermediates containing the first three TM segments generated two distinct cohorts of polypeptides in which TM3 spanned the ER membrane in either an Ncyto/Cexo (mature) or Nexo/Ccyto (immature) topology. Pulse-chase analyses revealed that the immature form was predominant immediately after synthesis but that it was rapidly degraded via the proteasome-mediated endoplasmic reticulum associated degradation (ERAD) pathway with a half-life of less than 25 min in HEK cells. As a result, the mature topology predominated at later time points. We conclude that (i) differential stability of biogenesis intermediates is an important factor for in vivo topological analysis of truncated chimeric proteins and (ii) cotranslational events of AQP1 biogenesis reflect a common AQP1 folding pathway in diverse expression systems. Topological studies of multi-spanning membrane proteins commonly use sequentially truncated proteins fused to a C-terminal translocation reporter to deduce transmembrane (TM) segment orientation and key biogenesis events. Because these truncated proteins represent an incomplete stage of synthesis, they transiently populate intermediate folding states that may or may not reflect topology of the mature protein. For example, in Xenopus oocytes, the aquaporin-1 (AQP1) water channel is cotranslationally directed into a four membrane-spanning intermediate, which matures into the six membrane-spanning topology at a late stage of synthesis (Skach, W. R., Shi, L. B., Calayag, M. C., Frigeri, A., Lingappa, V. R., and Verkman, A. S. (1994) J. Cell Biol. 125, 803–815 and Lu, Y., Turnbull, I. R., Bragin, A., Carveth, K., Verkman, A. S., and Skach, W. R. (2000) Mol. Biol. Cell 11, 2973–2985). The hallmark of this process is that TM3 initially acquires an Nexo/Ccyto (Type I) topology and must rotate 180° to acquire its mature orientation. In contrast, recent studies in HEK-293 cells have suggested that TM3 acquires its mature topology cotranslationally without the need for reorientation (Dohke, Y., and Turner, R. J. (2002) J. Biol. Chem. 277, 15215–15219). Here we re-examine AQP1 biogenesis and show that irrespective of the reporter or fusion site used, oocytes and mammalian cells yielded similar topologic results. AQP1 intermediates containing the first three TM segments generated two distinct cohorts of polypeptides in which TM3 spanned the ER membrane in either an Ncyto/Cexo (mature) or Nexo/Ccyto (immature) topology. Pulse-chase analyses revealed that the immature form was predominant immediately after synthesis but that it was rapidly degraded via the proteasome-mediated endoplasmic reticulum associated degradation (ERAD) pathway with a half-life of less than 25 min in HEK cells. As a result, the mature topology predominated at later time points. We conclude that (i) differential stability of biogenesis intermediates is an important factor for in vivo topological analysis of truncated chimeric proteins and (ii) cotranslational events of AQP1 biogenesis reflect a common AQP1 folding pathway in diverse expression systems. Polytopic membrane proteins are synthesized and oriented in the endoplasmic reticulum (ER) 1The abbreviations used are: ER, endoplasmic reticulum; AQP, aquaporin; TM, transmembrane; spanning, membrane-spanning; EGFP, enhanced green fluorescent protein; ERAD, endoplasmic reticulum associated degradation; PNGase F, N-glycosidase F. by the ribosome and Sec61 translocon complex (1Alder N.N. Johnson A.E. J. Biol. Chem. 2004; 279: 22787-22790Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar, 2Turner R.J. J. Membr. Biol. 2003; 192: 149-157Crossref PubMed Scopus (7) Google Scholar, 3Sadlish H. Skach W. J. Membr. Biol. 2004; (in press)PubMed Google Scholar). In the simplest model, topology of each transmembrane (TM) segment is established in a vectoral and sequential manner (N to C termini) (4Blobel G. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 1496-1500Crossref PubMed Scopus (910) Google Scholar) as independent signal anchor and stop transfer sequences alternately gate the translocon and the ribosome-translocon junction and direct TM segment integration into the lipid bilayer (cotranslational model) (5Rothman R.E. Andrews D.W. Calayag M.C. Lingappa V.R. J. Biol. Chem. 1988; 263: 10470-10480Abstract Full Text PDF PubMed Google Scholar, 6Lipp J. Flint N. Haeuptle M.T. Dobberstein B. J. Cell Biol. 1989; 109: 2013-2022Crossref PubMed Scopus (56) Google Scholar, 7Wessels H.P. Spiess M. Cell. 1988; 55: 61-70Abstract Full Text PDF PubMed Scopus (123) Google Scholar). However, a growing body of evidence has demonstrated that the final topology of many native proteins is not necessarily established cotranslationally but rather through cooperative interactions between topogenic determinants (TM segments) located within different regions of the polypeptide (post-translational model) (8Moss K. Helm A. Lu Y. Bragin A. Skach W.R. Mol. Biol. Cell. 1998; 9: 2681-2697Crossref PubMed Scopus (32) Google Scholar, 9Skach W.R. Lingappa V.R. Cancer Res. 1994; 54: 3202-3209PubMed Google Scholar, 10Carveth K. Buck T. Anthony V. Skach W.R. J. Biol. Chem. 2002; 277: 39507-39514Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar, 11Lin J. Addison R. J. Biol. Chem. 1995; 270: 6942-6948Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar, 12Wilkinson B.M. Critchley A.J. Stirling C.J. J. Biol. Chem. 1996; 271: 25590-25597Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 13Xie Y. Langhans-Rajasekaran S.A. Bellovino D. Morimoto T. J. Biol. Chem. 1996; 271: 2563-2573Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 14Beguin P. Hasler U. Beggah A. Horisberger J.D. Geering K. J. Biol. Chem. 1998; 273: 24921-24931Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 15Beguin P. Hasler U. Staub O. Geering K. Mol. Biol. Cell. 2000; 11: 1657-1672Crossref PubMed Scopus (52) Google Scholar, 16Goder V. Bieri C. Spiess M. J. Cell Biol. 1999; 147: 257-266Crossref PubMed Scopus (80) Google Scholar). One example of the post-translational model occurs during the biogenesis of aquaporin-1 (AQP1), a hydrophobic membrane protein of ∼29 kDa that exists as a homo-tetramer in cell membranes. AQP1 is a member of the MIP (major intrinsic protein) family (17Fujiyoshi Y. Mitsuoka K. de Groot B.L. Philippsen A. Grubmèuller H. Agre P. Engel A. Curr. Opin. Struct. Biol. 2002; 12: 509-515Crossref PubMed Scopus (236) Google Scholar, 18Agre P. King L.S. Yasui M. Guggino W.B. Ottersen O.P. Fujiyoshi Y. Engel A. Nielsen S. J. Physiol. 2002; 542: 3-16Crossref PubMed Scopus (932) Google Scholar). In its mature form it exhibits a characteristic topology with six TM segments and two additional short helical regions flanked by conserved NPA motifs that fold inward within the plane of the membrane to form a monomeric, water-selective pore (19Fu D. Libson A. Miercke L.J. Weitzman C. Nollert P. Krucinski J. Stroud R.M. Science. 2000; 290: 481-486Crossref PubMed Scopus (889) Google Scholar, 20Sui H. Han B.G. Lee J.K. Walian P. Jap B.K. Nature. 2001; 414: 872-878Crossref PubMed Scopus (970) Google Scholar). AQP1 is expressed in diverse cell types and is localized in the kidney to the proximal tubule and descending limb of the loop of Henle where it plays a major role in renal water reabsorption (18Agre P. King L.S. Yasui M. Guggino W.B. Ottersen O.P. Fujiyoshi Y. Engel A. Nielsen S. J. Physiol. 2002; 542: 3-16Crossref PubMed Scopus (932) Google Scholar, 21Schnermann J. Chou C.L. Ma T. Traynor T. Knepper M.A. Verkman A.S. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 9660-9664Crossref PubMed Scopus (398) Google Scholar). Early biogenesis studies of AQP1 in cell-free systems and microinjected Xenopus oocytes revealed a novel mechanism in which only four of its six transmembrane segments cotranslationally acquired a membrane spanning topology (22Skach W.R. Shi L.B. Calayag M.C. Frigeri A. Lingappa V.R. Verkman A.S. J. Cell Biol. 1994; 125: 803-815Crossref PubMed Scopus (69) Google Scholar). This four-spanning intermediate later matures in the ER membrane to form the final six-spanning structure (23Lu Y. Turnbull I.R. Bragin A. Carveth K. Verkman A.S. Skach W.R. Mol. Biol. Cell. 2000; 11: 2973-2985Crossref PubMed Scopus (106) Google Scholar, 24Foster W. Helm A. Turnbull I. Gulati H. Yang B. Verkman A.S. Skach W.R. J. Biol. Chem. 2000; 275: 34157-34165Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). AQP1 biogenesis differs from the cotranslational pathway utilized by a close homolog, AQP4 (25Shi L.B. Skach W.R. Ma T. Verkman A.S. Biochemistry. 1995; 34: 8250-8256Crossref PubMed Scopus (51) Google Scholar), in part because hydrophilic residues within the N terminus of TM2 (Asn49 and Lys51) disrupt stop transfer sequence and allow TM2 to transiently pass through the translocon and into the ER lumen (24Foster W. Helm A. Turnbull I. Gulati H. Yang B. Verkman A.S. Skach W.R. J. Biol. Chem. 2000; 275: 34157-34165Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). As a result, when TM3 emerges from the ribosome, it acts as a stop transfer sequence to terminate translocation and cotranslationally adopt an Nexo/Ccyto (Type I) topology. A four-spanning intermediate is synthesized because TM4 does not reinitiate translocation, and TM5 and TM6 act as signal and stop transfer sequences, respectively (see Fig. 1A). The defining feature of this folding intermediate is that TM3 is initially oriented with its C terminus positioned in the cytosol. In Xenopus oocytes, TM3 topology is “corrected,” because it rotates 180° about the plane of the membrane to acquire its mature topology during a later stage or following the completion of AQP1 synthesis (23Lu Y. Turnbull I.R. Bragin A. Carveth K. Verkman A.S. Skach W.R. Mol. Biol. Cell. 2000; 11: 2973-2985Crossref PubMed Scopus (106) Google Scholar).Fig. 1Two models for AQP1 biogenesis. Topology of reporter fusion sites used for experiments in Xenopus oocytes (A) and HEK-293 cells (B) are indicated. Fusion sites in which topology differs between these systems are shown in black, whereas fusion sites with the same topology are shown in gray. In oocytes AQP1 is initially synthesized as a four-spanning intermediate that is converted into the mature six-spanning form. In HEK-293 cells the reporter did not identify the immature topology (26Dohke Y. Turner R.J. J. Biol. Chem. 2002; 277: 15215-15219Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar).View Large Image Figure ViewerDownload Hi-res image Download (PPT) Recent work has suggested that the AQP1 biogenesis pathway may be dependent on cell type (26Dohke Y. Turner R.J. J. Biol. Chem. 2002; 277: 15215-15219Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). A study by the Turner group (26Dohke Y. Turner R.J. J. Biol. Chem. 2002; 277: 15215-15219Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar) examined the topology of truncated constructs in which variable numbers of AQP1 TM segments were placed into a chimeric protein containing N- and C-terminal reporter domains derived from EGFP and the β-subunit of the H/K-ATPase, respectively. The topology of TM segments was inferred by N-linked glycosylation of the C-terminal reporter in intact HEK-293 cells. In contrast to results in oocytes, the Turner group found that TM3 had already acquired its mature Ncyt/Cexo topology (e.g. the reporter was glycosylated) in constructs containing only the first three AQP1 TM segments and concluded that AQP1 biogenesis therefore occurs in a cotranslational fashion without reorientation from a four-spanning intermediate. These studies have lead to several unanswered questions regarding AQP1 biogenesis. Different reporter domains (prolactin versus H/K-ATPase β-subunit derivatives), translocation assays (protease protection versus glycosylation) and fusion sites could potentially account for the different apparent topology observed for TM3. Because C-terminal reporters are routinely used to study polytopic protein biogenesis, these factors are of more than just academic interest. In addition, although truncated proteins provide important structural information at a relatively defined point of synthesis, they lack C-terminal sequence information and therefore must be viewed as populating intermediate folding states. As such they are potential candidates for recognition by ER quality control machinery. Consistent with this we had previously observed that certain AQP1 fusion proteins are relatively unstable in oocytes (27Skach W.R. Verkman A.S. Biophysical J. 1995; 68: A334Google Scholar). A final possibility proposed by the Turner group is that oocytes and mammalian cells handle topological information in fundamentally different ways. If true, this would have major implications for protein biogenesis. Xenopus oocytes efficiently express diverse aquaporins and have been extensively used to study AQP biosynthesis, trafficking, and function (28Tamarappoo B.K. Verkman A.S. J. Clin. Investig. 1998; 101: 2257-2267Crossref PubMed Scopus (290) Google Scholar, 29Sasaki S. Fushimi K. Saito H. Saito F. Uchida S. Ishibashi K. Kuwahara M. Ikeuchi T. Inui K. Nakajima K. Watanabe T. Marumo F. J. Clin. Investig. 1994; 93: 1250-1256Crossref PubMed Scopus (209) Google Scholar, 30Mulders S.M. Knoers N.V. Van Lieburg A.F. Monnens L.A. Leumann E. Wèuhl E. Schober E. Rijss J.P. Van Os C.H. Deen P.M. J. Am. Soc. Nephrol. 1997; 8: 242-248Crossref PubMed Google Scholar, 31Deen P.M. Croes H. van Aubel R.A. van Ginsel L.A. Os C.H. J. Clin. Investig. 1995; 95: 2291-2296Crossref PubMed Scopus (218) Google Scholar, 32Deen P.M. Verdijk M.A. Knoers N.V. Wieringa B. van Monnens L.A. van Os C.H. Oost B.A. Science. 1994; 264: 92-95Crossref PubMed Scopus (768) Google Scholar). However, a direct comparison of biosynthetic mechanisms in oocyte and mammalian cells has not previously been carried out. We therefore systematically examined AQP1 fusion proteins containing two, three, or four TM segments in both Xenopus oocytes and HEK-293 cells to determine the origin of previous discrepancies. We now show that irrespective of the reporter or fusion site examined, both systems yielded similar topologic results. AQP1 intermediates containing the first three TM segments gave rise to two distinct cohorts of polypeptides in which TM3 spanned the ER membrane in either an Ncyto/Cexo (mature) or Nexo/Ccyto (immature) topology. Careful pulse-chase analyses revealed that the immature form predominated immediately after synthesis in both cell types but that it was rapidly degraded via the proteasome-mediated ERAD pathway. As a result, the mature topology predominated 1–2 h after synthesis in HEK cells. We conclude that differential stability of biogenesis intermediates is an important factor for in vivo analysis of truncated chimeric proteins and that cotranslational events of AQP1 biogenesis are conserved in diverse expression systems. cDNA Construction—Plasmids AQP1P77.P, AQP1L139.P, and AQP1P169.P are described previously as clones 3, 6, and 7 (22Skach W.R. Shi L.B. Calayag M.C. Frigeri A. Lingappa V.R. Verkman A.S. J. Cell Biol. 1994; 125: 803-815Crossref PubMed Scopus (69) Google Scholar); AQP1S66.P, AQP1T120.P, and AQP1L164.P were generated using the same strategy by PCR amplification of AQP coding region using antisense oligonucleotides: S66, GCTGATGGTCACCCCACTCTGCGCCAGCGTGGC; T120, AAGCGAGGTCACCGTCAGGGAGGAGGTGAT; and L164, GGGGGCGGTCACCCCAAGGTCACGGCGCCTCCG. The resulting constructs contain AQP1 residues 1–66, 1–77, 1–120, 1–139, 1–164, or 1–169 followed by the C-terminal 142 amino acids of bovine prolactin, a passive translocation reporter (5Rothman R.E. Andrews D.W. Calayag M.C. Lingappa V.R. J. Biol. Chem. 1988; 263: 10470-10480Abstract Full Text PDF PubMed Google Scholar). Plasmid pEGFP. AQP1T120.β was kindly provided by R. James Turner and is derived from pEGFP-C3 (Clontech, Palo Alto, CA) (26Dohke Y. Turner R.J. J. Biol. Chem. 2002; 277: 15215-15219Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). It contains AQP1 codons 1–120 fused between EGFP and the C-terminal 177 amino acids of the H/K-ATPase β-subunit. pEGFP.AQP1S66.β, pEGFP.AQP1P77.β, pEGFP.AQP1L139.β, pEGFP.AQP1L164.β, and pEGFP.AQP1P169.β were generated by PCR amplification of AQP1 cDNA using a sense oligonucleotide (TGAGTAGATCTCATGGCCAGCGAGTTCAAG) and corresponding antisense oligonucleotides S66 (TGAGTAAGCTTCCACTCTGCGCCAGCGTC), P77C (AGTGTGAAGCTTCCCGGGTTGAGGTGGGCCCG), L139 (ATCTCGAAGCTTCCCAGGCCCTGGCCCGAGTTC), L164 (TGAGTAAGCTTCCAAGGTCACGGCGCCT), and P169 (CCGATGAAGCTTCCGGGGGCTGAGCCACCAAGG) encoding BglII (sense) and HindIII (antisense) restrictions sites that were used to ligate DNA fragments into the EGFP-β subunit cassette. The constructs encode AQP1 residues 1–66, 1–77, 1–139, 1–164, or 1–169 flanked by EGFP and β-subunit. The full-length AQP1 construct was generated by ligating AQP1 cDNA into the mammalian expression vector pEGFP-N3 (Clontech) between the HindIII and NotI restriction sites resulting in a full-length AQP1 construct without an EGFP tag. The sequence of all PCR-amplified DNA was verified by automated DNA sequencing. Xenopus laevis Expression—mRNA was transcribed in vitro with SP6 RNA polymerase (New England Biolabs, Beverly, MA) using 2 μg of plasmid DNA in a 10-μl volume at 40 °C for 1 h as previously described (22Skach W.R. Shi L.B. Calayag M.C. Frigeri A. Lingappa V.R. Verkman A.S. J. Cell Biol. 1994; 125: 803-815Crossref PubMed Scopus (69) Google Scholar). The aliquots were used immediately or frozen in liquid nitrogen and stored at -80 °C. 2 μl of transcript was mixed with 50 μCi of [35S]methionine (0.5 μl of a 10× concentrated Tran35S-label; ICN Pharmaceuticals, Irvine, CA), and 50 nl was injected into stage VI X. laevis oocytes (50 nl/oocyte) on an ice-cold stage. The oocytes were incubated at 18 °C in MBSH (88 mm NaCl, 1 mm KCl, 24 mm NaHCO3, 0.82 mm MgSO4, 0.33 mm Ca(NO3)2, 0.41 mm CaCl2, 10 mm HEPES, pH 7.4, 50 μg/ml gentamicin, 100 units/ml penicillin, and 100 μg/ml streptomycin sulfate). Protease Protection and Pulse-Chase Assays in Oocytes—The oocytes were injected as described above, incubated at 18 °C for 3 h, and homogenized by hand in 3 volumes of 0.25 m sucrose, 50 mm KAc, 5 mm MgAc2, 1.0 mm dithiothreitol, 50 mm Tris-Cl, pH 7.5. The homogenates were divided into three 10-μl aliquots on ice. Proteinase K (Roche Applied Science) was added (final concentration, 0.2 mg/ml) in the presence or absence of 1% Triton X-100. The reactions were incubated on ice for 1 h and rapidly mixed with phenylmethylsulfonyl fluoride (10 mm) and boiled in 10 volumes of 1% SDS, 0.1 m Tris-HCl, pH 8.0, for 5 min. The samples were then diluted in 10 volumes of buffer A (100 mm Tris, pH 8.0, 100 mm NaCl, 1% Triton X-100, 2 mm EDTA), incubated at 4 °C for 15 min, and centrifuged at 16,000 × g for 10 min at 4 °C to remove insoluble debris. Efficiency of the assay was regularly assessed using a known secretory control protein and was >80%. For pulse-chase assays oocytes were injected as described and incubated at 18 °C for 2 h, and the medium was then replaced with fresh MBSH containing 2 mm methionine. The oocytes were harvested at the specified time points and processed as above. HEK-293 Pulse-Chase Studies—HEK-293 cells were cultured in Dulbecco's modified essential medium (Fisher) supplemented with 100 units/ml penicillin, 100 μg/ml streptomycin sulfate, and 10% heat-inactivated fetal bovine serum (Invitrogen). The cells were grown on plastic in a humidified incubator at 37 °C and 5% CO2 and were passaged every 3–4 days. The cells were transfected at 50–60% confluence with TransIT-LT transfection reagent (Mirus, Madison, WI) according to the manufacturer's instructions (3 μg of cDNA and 12 μl of TransIT-LT reagent/60-mm plate). Transfection efficiencies were ∼40% as determined by EGFP fluorescence. 48 h after transfection media was replaced with 1 ml of methionine-cysteine-free medium for 30 min. The cells were then pulse-labeled with 80 μCi of [35S]methionine for 15 min, and the medium was removed and replaced with fresh complete medium for the indicated duration of the chase. The cells were lysed on ice with 1 ml of radioimmune precipitation assay buffer (0.1% SDS, 1% Triton X-100, 1% dexoycholate, 150 mm NaCl, 10 mm Tris-Cl, pH 8.0, 2.5 mm MgCl2,1× protease inhibitors III (CalBiochem, San Diego, CA), and 1 mm phenylmethylsulfonyl fluoride) for 30 min on ice and passed through a 26-gauge needle three times. The samples were then clarified at 16,000 × g for 12 min. Immunoprecipitation—Clarified oocyte or HEK cell homogenates were incubated with anti-prolactin antisera (ICN Biomedicals, Costa Mesa, CA) at 1:2000 dilution, polyclonal anti-EGFP antibody (Molecular Probes, Eugene, OR) at 1:2000 dilution, or polyclonal rabbit anti-AQP1 antisera raised against purified AQP1 protein (generously provided by A. Verkman, UCSF, San Francisco, CA) at 1:1000 dilution and 5.0 μl of protein-A Affigel (Bio-Rad). The samples were rotated for 10 h at 4 °C (oocyte homogenates) and 4 h (HEK cells) prior to washing three times with solubilization buffer and twice with 100 mm NaCl, 100 mm Tris-Cl, pH 8.0. The samples were boiled in protein SDS loading buffer (33Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar) and analyzed by SDS-PAGE, EN3HANCE (PerkinElmer Life Sciences) fluorography. The intensity of recovered bands was quantitated using a Bio-Rad personal Molecular PhosphorImager Fx (Kodak screens, Quantity-1 software). PNGase F Digests—Beads from immunoprecipitations were resuspended after the final wash in 15 μl of 0.1 m Tris-Cl, pH 7.5, and 0.3 μl of PNGase F (New England Biolabs, Beverly, MA), and incubated at 37 °C for 3 h. The samples were then analyzed by SDS-PAGE as described above. C-terminal translocation reporters placed after connecting peptide loops have been widely used to study membrane protein topology and biogenesis (6Lipp J. Flint N. Haeuptle M.T. Dobberstein B. J. Cell Biol. 1989; 109: 2013-2022Crossref PubMed Scopus (56) Google Scholar, 12Wilkinson B.M. Critchley A.J. Stirling C.J. J. Biol. Chem. 1996; 271: 25590-25597Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 13Xie Y. Langhans-Rajasekaran S.A. Bellovino D. Morimoto T. J. Biol. Chem. 1996; 271: 2563-2573Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 22Skach W.R. Shi L.B. Calayag M.C. Frigeri A. Lingappa V.R. Verkman A.S. J. Cell Biol. 1994; 125: 803-815Crossref PubMed Scopus (69) Google Scholar, 34San Millan J.L. Boyd D. Dalbey R. Wickner W. Beckwith J. J. Bacteriol. 1989; 171: 5536-5541Crossref PubMed Scopus (75) Google Scholar, 35Boyd D. Traxler B. Beckwith J. J. Bacteriol. 1993; 175: 553-556Crossref PubMed Google Scholar, 36Skach W.R. Calayag M.C. Lingappa V.R. J. Biol. Chem. 1993; 268: 6903-6908Abstract Full Text PDF PubMed Google Scholar, 37Tector M. Hartl F.U. EMBO J. 1999; 18: 6290-6298Crossref PubMed Scopus (42) Google Scholar, 38Bayle D. Weeks D. Sachs G. J. Biol. Chem. 1997; 272: 19697-19707Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar, 39Ota K. von Sakaguchi M. Heijne G. Hamasaki N. Mihara K. Mol. Cell. 1998; 2: 495-503Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). The rationale for this approach is that topology of TM segments and their connecting loops is controlled by the action of topogenic determinants encoded within the nascent polypeptide. TM segments that function as signal (anchor) sequences open the Sec61 translocon channel and initiate translocation of polypeptide into the ER lumen. All else being equal, translocation will continue until a second TM segment is synthesized that functions as a stop transfer sequence to close the translocon, relax the ribosome-translocon junction, and allow the next peptide loop to enter the cytosol. In this manner, topology is determined cotranslationally as the nascent polypeptide emerges from the ribosome. A passive reporter domain (i.e. one containing no intrinsic topogenic information) fused to a peptide loop downstream of a signal sequence will therefore follow the loop into the ER lumen, whereas a reporter located downstream of a stop transfer will, in turn, remain in the cytosol. Two variations on this strategy have been employed to map the cotranslational topology of AQP1. In the first approach, a C-terminal reporter domain derived from the secretory protein prolactin was fused to each AQP1 peptide loop, and topology was determined in vitro and in microinjected Xenopus oocytes using a protease protection assay (22Skach W.R. Shi L.B. Calayag M.C. Frigeri A. Lingappa V.R. Verkman A.S. J. Cell Biol. 1994; 125: 803-815Crossref PubMed Scopus (69) Google Scholar). The second approach used a different chimeric cassette containing an N-terminal EGFP domain and a C-terminal reporter derived from the β-subunit of the H/K-ATPase. Topology of the β-subunit was then determined in HEK-293 cells based on N-linked glycosylation, which occurs exclusively in the ER lumen (26Dohke Y. Turner R.J. J. Biol. Chem. 2002; 277: 15215-15219Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar, 40Hubbard S.C. Ivatt R.J. Annu. Rev. Biochem. 1981; 50: 555-583Crossref PubMed Scopus (892) Google Scholar, 41Kaplan H.A. Welply J.K. Lennarz W.J. Biochim. Biophys. Acta. 1987; 906: 161-173Crossref PubMed Scopus (136) Google Scholar). Key differences between these studies are summarized in Fig. 1. In oocytes, reporters fused to the TM2–3 loop (residue Pro77) or the TM3–4 loop (Leu139) were located in the ER lumen and cytosol, respectively (Fig. 1A) (22Skach W.R. Shi L.B. Calayag M.C. Frigeri A. Lingappa V.R. Verkman A.S. J. Cell Biol. 1994; 125: 803-815Crossref PubMed Scopus (69) Google Scholar). Surprisingly this was different from their expected topology in the mature protein. Two subsequent studies confirmed these results and demonstrated that AQP1 TM segments 2–4 cotranslationally acquire an immature topology that is subsequently converted to the mature topology by an internal 180° rotation of TM3 (23Lu Y. Turnbull I.R. Bragin A. Carveth K. Verkman A.S. Skach W.R. Mol. Biol. Cell. 2000; 11: 2973-2985Crossref PubMed Scopus (106) Google Scholar, 24Foster W. Helm A. Turnbull I. Gulati H. Yang B. Verkman A.S. Skach W.R. J. Biol. Chem. 2000; 275: 34157-34165Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). In contrast, glycosylation patterns of the β-subunit domain lead to the conclusion that the TM2–3 and TM3–4 loops acquire their proper topology cotranslationally in the ER of mammalian cells and therefore do not undergo a topological reorientation (Fig. 1B). Although similar in many ways, these studies differed in several important aspects including the location of fusion sites, the reporter domain used, and the cell expression system. We therefore undertook a systematic comparison of AQP1 biogenesis in oocytes and mammalian cells using similar truncation sites and reporters to resolve these discrepancies. Because the major differences involved the initial orientation of TM3 (Type I in oocytes and Type II in HEK cells), we focused our attention primarily on the topology of TM3 and its immediate flanking residues. Topology of other regions such as the N and C termini and TM5–6 are well established and were therefore not retested here (Fig. 1). Reporter Fusion Site Does Not Affect Outcome of Early Biogenesis Experiments in Oocytes—We first addressed whether topological differences might arise from the use of different fusion sites. In particular, up to 10–15 flanking residues can influence topogenic activities of TM segments (42Hartmann E. Rapoport T.A. Lodish H.F. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5786-5790Crossref PubMed Scopus (489) Google Scholar). Thus fusion sites very close to the TM C terminus such as those used in the EGFP-β-subunit chimeras might delete potentially important topogenic information. Alternatively, the fusion site might introduce new flanking residues (from the β-subunit) that could inadvertently alter TM2 behavior. AQP1 fusion sites were therefore tested head-to-head by placing the prolactin reporter at both truncations sites downstream of TM2 (Ser66 and Pro77), TM3 (Thr120 and Leu139)," @default.
• W1990024993 created "2016-06-24" @default.
• W1990024993 creator A5007894424 @default.
• W1990024993 creator A5059782168 @default.
• W1990024993 date "2005-01-01" @default.
• W1990024993 modified "2023-09-30" @default.
• W1990024993 title "Differential Stability of Biogenesis Intermediates Reveals a Common Pathway for Aquaporin-1 Topological Maturation" @default.
• W1990024993 cites W1485969786 @default.
• W1990024993 cites W1526405993 @default.
• W1990024993 cites W1561829393 @default.
• W1990024993 cites W1586011710 @default.
• W1990024993 cites W1954280041 @default.
• W1990024993 cites W1973643925 @default.
• W1990024993 cites W1973975116 @default.
• W1990024993 cites W1978764917 @default.
• W1990024993 cites W1981460409 @default.
• W1990024993 cites W1985434749 @default.
• W1990024993 cites W1985899857 @default.
• W1990024993 cites W1988328980 @default.
• W1990024993 cites W1994184002 @default.
• W1990024993 cites W1995419987 @default.
• W1990024993 cites W2009497172 @default.
• W1990024993 cites W2020099135 @default.
• W1990024993 cites W2025521663 @default.
• W1990024993 cites W2026542719 @default.
• W1990024993 cites W2029991532 @default.
• W1990024993 cites W2030241797 @default.
• W1990024993 cites W2036031058 @default.
• W1990024993 cites W2037598092 @default.
• W1990024993 cites W2038270621 @default.
• W1990024993 cites W2043038227 @default.
• W1990024993 cites W2045711395 @default.
• W1990024993 cites W2046389334 @default.
• W1990024993 cites W2047243609 @default.
• W1990024993 cites W2048796422 @default.
• W1990024993 cites W2052858784 @default.
• W1990024993 cites W2053724642 @default.
• W1990024993 cites W2057589234 @default.
• W1990024993 cites W2062702609 @default.
• W1990024993 cites W2066525632 @default.
• W1990024993 cites W2073726493 @default.
• W1990024993 cites W2078936885 @default.
• W1990024993 cites W2079126167 @default.
• W1990024993 cites W2079902597 @default.
• W1990024993 cites W2080699605 @default.
• W1990024993 cites W2082270046 @default.
• W1990024993 cites W2089841008 @default.
• W1990024993 cites W2092398899 @default.
• W1990024993 cites W2092986485 @default.
• W1990024993 cites W2093189530 @default.
• W1990024993 cites W2098730572 @default.
• W1990024993 cites W2100837269 @default.
• W1990024993 cites W2106501288 @default.
• W1990024993 cites W2108595383 @default.
• W1990024993 cites W2115303678 @default.
• W1990024993 cites W2115833191 @default.
• W1990024993 cites W2116406216 @default.
• W1990024993 cites W2117761303 @default.
• W1990024993 cites W2121530802 @default.
• W1990024993 cites W2137457846 @default.
• W1990024993 cites W2141626933 @default.
• W1990024993 cites W2143357099 @default.
• W1990024993 cites W2149736282 @default.
• W1990024993 cites W2162824898 @default.
• W1990024993 cites W2169846015 @default.
• W1990024993 doi "https://doi.org/10.1074/jbc.m409920200" @default.
• W1990024993 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15516332" @default.
• W1990024993 hasPublicationYear "2005" @default.
• W1990024993 type Work @default.
• W1990024993 sameAs 1990024993 @default.
• W1990024993 citedByCount "32" @default.
• W1990024993 countsByYear W19900249932012 @default.
• W1990024993 countsByYear W19900249932013 @default.
• W1990024993 countsByYear W19900249932014 @default.
• W1990024993 countsByYear W19900249932015 @default.
• W1990024993 countsByYear W19900249932018 @default.
• W1990024993 countsByYear W19900249932019 @default.
• W1990024993 countsByYear W19900249932020 @default.
• W1990024993 countsByYear W19900249932021 @default.
• W1990024993 countsByYear W19900249932023 @default.
• W1990024993 crossrefType "journal-article" @default.
• W1990024993 hasAuthorship W1990024993A5007894424 @default.
• W1990024993 hasAuthorship W1990024993A5059782168 @default.
• W1990024993 hasBestOaLocation W19900249931 @default.
• W1990024993 hasConcept C104317684 @default.
• W1990024993 hasConcept C112972136 @default.
• W1990024993 hasConcept C114614502 @default.
• W1990024993 hasConcept C119857082 @default.
• W1990024993 hasConcept C121332964 @default.
• W1990024993 hasConcept C131934819 @default.
• W1990024993 hasConcept C184720557 @default.
• W1990024993 hasConcept C185592680 @default.
• W1990024993 hasConcept C33923547 @default.
• W1990024993 hasConcept C41008148 @default.
• W1990024993 hasConcept C54355233 @default.
• W1990024993 hasConcept C86803240 @default.
• W1990024993 hasConcept C93226319 @default.
• W1990024993 hasConcept C95444343 @default.

• next