FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1990452511> ?p ?o ?g. }

• W1990452511 endingPage "280" @default.
• W1990452511 startingPage "275" @default.
• W1990452511 abstract "The molecular evolution of DAX1, SRY, and SOX9, genes involved in mammalian sex determination, was examined in six primate species. DAX1 and SRY have been added to the X and Y chromosomes, respectively, during mammalian evolution, whereas SOX9 remains autosomal. We determined the genomic sequences of DAX1, SRY, and SOX9 in all six species, and calculated Ka, the number of nonsynonymous substitutions per nonsynonymous site, and compared this with the Ks, the number of synonymous substitutions per synonymous site. Phylogenetic trees were constructed by means of the DAX1, SRY, and SOX9 coding sequences, and phylogenetic analysis was performed using maximum likelihood. Overall measures of gene and protein similarity were closer for DAX1 and SOX9, but DAX1 exhibited nonsynonymous amino acid substitutions at an accelerated frequency relative to synonymous changes, similar to SRY and significantly higher than SOX9. We conclude that, at the protein level, DAX1 and SRY are under less selective pressure to remain conserved than SOX9, and, therefore, diverge more across species than does SOX9. These results are consistent with evolutionary stratification of the mammalian sex determination pathway, analogous to that for sex chromosomes. The molecular evolution of DAX1, SRY, and SOX9, genes involved in mammalian sex determination, was examined in six primate species. DAX1 and SRY have been added to the X and Y chromosomes, respectively, during mammalian evolution, whereas SOX9 remains autosomal. We determined the genomic sequences of DAX1, SRY, and SOX9 in all six species, and calculated Ka, the number of nonsynonymous substitutions per nonsynonymous site, and compared this with the Ks, the number of synonymous substitutions per synonymous site. Phylogenetic trees were constructed by means of the DAX1, SRY, and SOX9 coding sequences, and phylogenetic analysis was performed using maximum likelihood. Overall measures of gene and protein similarity were closer for DAX1 and SOX9, but DAX1 exhibited nonsynonymous amino acid substitutions at an accelerated frequency relative to synonymous changes, similar to SRY and significantly higher than SOX9. We conclude that, at the protein level, DAX1 and SRY are under less selective pressure to remain conserved than SOX9, and, therefore, diverge more across species than does SOX9. These results are consistent with evolutionary stratification of the mammalian sex determination pathway, analogous to that for sex chromosomes. DAX1 is a member of the nuclear hormone receptor superfamily (Zanaria et al. Zanaria et al., 1994Zanaria E Muscatelli F Bardoni B Strom TM Guioli S Guo W Lalli E Moser C Walker AP McCabe ERB Meitinger T Monaco AP Sassone-Corsi P Camerino G An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita.Nature. 1994; 372: 635-641Crossref PubMed Scopus (686) Google Scholar). Mutations in this transcription factor result in developmental and functional abnormalities of the steroidogenic axis, as well as the clinical phenotypes of adrenal hypoplasia congenita (MIM 300200) and hypogonadotropic hypogonadism (Muscatelli et al. Muscatelli et al., 1994Muscatelli F Strom TM Walker AP Zanaria E Recan D Meindl A Bardoni B Guiolo S Zehetner G Rabl W Schwarz HP Kaplan J-C Camerino G Meitinger T Monaco AP Mutations in the DAX-1 gene give rise to both X-linked adrenal hypoplasia congenita and hypogonadotropic hypogonadism.Nature. 1994; 372: 672-676Crossref PubMed Scopus (599) Google Scholar; Zanaria et al. Zanaria et al., 1994Zanaria E Muscatelli F Bardoni B Strom TM Guioli S Guo W Lalli E Moser C Walker AP McCabe ERB Meitinger T Monaco AP Sassone-Corsi P Camerino G An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita.Nature. 1994; 372: 635-641Crossref PubMed Scopus (686) Google Scholar; Guo et al. Guo et al., 1995Guo W Mason JS Stone Jr, CG Morgan SA Madu SI Baldini A Lindsay EA Biesecker LG Copeland KC Horlick MNB Pettigrew AL Zanaria E McCabe ERB Diagnosis of X-linked adrenal hypoplasia congenita by mutation analysis of the DAX1 gene.JAMA. 1995; 274: 324-330Crossref PubMed Scopus (88) Google Scholar; Habiby et al. Habiby et al., 1996Habiby RL Boepple P Nachtigall L Sluss PM Crowley Jr, WF Jameson JL Adrenal hypoplasia congenita with hypogonadotropic hypogonadism: evidence that DAX-1 mutations lead to combined hypothalamic and pituitary defects in gonadotropin production.J Clin Invest. 1996; 98: 1055-1062Crossref PubMed Scopus (222) Google Scholar; McCabe McCabe, 2000McCabe ERB Adrenal hypoplasias and aplasias.in: Scriver CR Beaudet AL Sly WS Valle D Childs B Vogelstein B The metabolic and molecular bases of inherited disease. 8th ed. McGraw-Hill, New York2000Google Scholar). Since DAX1 maps to the dosage-sensitive sex reversal (DSS [MIM 300018]) critical region (Bardoni et al. Bardoni et al., 1994Bardoni B Zanaria E Guioli S Floridia G Worley KC Tonini G Ferrante E Chiumello G McCabe ERB Fraccaro M Zuffardi O Camerino G A dosage sensitive locus at chromosome Xp21 is involved in male to female sex reversal.Nat Genet. 1994; 7: 497-501Crossref PubMed Scopus (555) Google Scholar; Zanaria et al. Zanaria et al., 1994Zanaria E Muscatelli F Bardoni B Strom TM Guioli S Guo W Lalli E Moser C Walker AP McCabe ERB Meitinger T Monaco AP Sassone-Corsi P Camerino G An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita.Nature. 1994; 372: 635-641Crossref PubMed Scopus (686) Google Scholar), and transgenic overexpression of DAX1 in mice with a Y chromosome containing a weak SRY allele can result in XY sex reversal (Swain et al. Swain et al., 1998Swain A Narvaez V Burgoyne P Camerino G Lovell-Badge R Dax1 antagonizes Sry action in mammalian sex determination.Nature. 1998; 391: 761-767Crossref PubMed Scopus (401) Google Scholar), DAX1 is a candidate gene for DSS. However, experimental and clinical evidence suggests that the role of DAX1 in sex determination is more complex. Targeted deletion of DAX1 exon 2 in mice fails to give the expected sex-reversed phenotype (Yu et al. Yu et al., 1998Yu RN Ito M Saunders TL Camper SA Jameson JL Role of Ahch in gonadal development and gametogenesis.Nat Genet. 1998; 20: 353-357Crossref PubMed Scopus (370) Google Scholar), and a female human who is genotypically homozygous for a DAX1 mutation also does not exhibit the expected phenotype (Merke et al. Merke et al., 1999Merke DP Tajima T Baron J Cutler Jr, GB Hypogonadotropic hypogonadism in a female caused by an X-linked recessive mutation in the DAX1 gene.N Engl J Med. 1999; 340: 1248-1252Crossref PubMed Scopus (100) Google Scholar). It is possible, however, that DAX1 acts as a part of a dosage-sensitive multiprotein complex, that time of expression is important, and that DAX1 functions differently in human and mouse (Swain et al. Swain et al., 1998Swain A Narvaez V Burgoyne P Camerino G Lovell-Badge R Dax1 antagonizes Sry action in mammalian sex determination.Nature. 1998; 391: 761-767Crossref PubMed Scopus (401) Google Scholar; Goodfellow and Camerino Goodfellow and Camerino, 1999Goodfellow PN Camerino G DAX-1, an `antitestis' gene.Cell Mol Life Sci. 1999; 55: 857-863PubMed Google Scholar). DAX1 is a relatively recent addition to the X chromosome, since it is autosomal in marsupials (Pask et al. Pask et al., 1997Pask A Toder R Wilcox SA Camerino G Graves JAM The candidate sex reversing DAX-1 gene is autosomal in marsupials: implication for the evolution of sex determination in mammals.Genomics. 1997; 41: 422-426Crossref PubMed Scopus (27) Google Scholar) and maps to the stratum that was acquired by the eutherian mammal X chromosome ∼80–130 million years ago (Lahn and Page Lahn and Page, 1999Lahn BT Page DC Four evolutionary strata on the human X chromsome.Science. 1999; 286: 964-967Crossref PubMed Scopus (641) Google Scholar). SRY encodes a protein containing a “high-mobility group” domain (HMG box), which enables it to bind DNA (Sinclair et al. Sinclair et al., 1990Sinclair AH Berta P Palmer MS Hawkin JR Griffiths BL Smith MJ Foster JM Frischauf AM Lovell-Badge R Goodfellow PN A gene from the human sex determining region encodes a protein with homology to a conserved DNA binding motif.Nature. 1990; 346: 240-244Crossref PubMed Scopus (2421) Google Scholar; Giese et al. Giese et al., 1994Giese K Pagel J Grosschedl R Distinct DNA-binding properties of the high mobility group domain of murine and human SRY sex-determining factors.Proc Natl Acad Sci USA. 1994; 91: 3368-3372Crossref PubMed Scopus (105) Google Scholar). Mutations that map to the HMG box disrupt the SRY-DNA complex and result in XY sex reversal (Pontiggia et al. Pontiggia et al., 1994Pontiggia A Rimini R Harley VR Goodfellow PN Lovell-Badge R Bianchi ME Sex-reversing mutations affect the architecture of SRY-DNA complexes.EMBO J. 1994; 13: 6115-6124Crossref PubMed Scopus (249) Google Scholar), and XX mice carrying the Sry transgene may develop as males (Koopman et al. Koopman et al., 1991Koopman P Gubbay J Vivian N Goodfellow P Lovell-Badge R Male development of chromosomally female mice transgenic for Sry.Nature. 1991; 351: 117-121Crossref PubMed Scopus (1601) Google Scholar). Among eutherian mammals, the SRY sequence is rapidly evolving outside the HMG box (Tucker and Lundrigan Tucker and Lundrigan, 1993Tucker PK Lundrigan BL Rapid evolution of the sex determining locus in Old World mice and rats.Nature. 1993; 364: 715-717Crossref PubMed Scopus (193) Google Scholar; Whitfield et al. Whitfield et al., 1993Whitfield LS Lovell-Badge R Goodfellow PN Rapid sequence evolution of the mammalian sex-determining gene SRY.Nature. 1993; 364: 713-715Crossref PubMed Scopus (316) Google Scholar). SRY is a relatively recent addition to the sex-determination pathway, appearing for the first time in mammals (Graves and Foster Graves and Foster, 1994Graves JAM Foster JW Evolution of mammalian sex chromosomes and sex-determining genes.Int Rev Cytol. 1994; 154: 191-259Crossref PubMed Scopus (23) Google Scholar). SOX9, located on human chromosome 17, has also been implicated in the sex-determination pathway (Foster et al. Foster et al., 1994Foster JW Dominguez-Steglich MA Guioli S Kwok G Weller PA Stevanovic M Weissenbach J Mansour S Young ID Goodfellow PN Brook JD Schafer AJ Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene.Nature. 1994; 372: 525-530Crossref PubMed Scopus (1258) Google Scholar; Wagner et al. Wagner et al., 1994Wagner T Wirth J Meyer J Zabel B Held M Zimmer J Pasantes J Bricarelli FD Keutel J Hustert E Wolf U Tommerup N Schempp W Scherer G Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9.Cell. 1994; 79: 1111-1120Abstract Full Text PDF PubMed Scopus (1232) Google Scholar). SOX9, like SRY, is an HMG family member, and mutations in a single allele of SOX9 are responsible for XY sex reversal and campomelic dysplasia (MIM 114290) (Foster et al. Foster et al., 1994Foster JW Dominguez-Steglich MA Guioli S Kwok G Weller PA Stevanovic M Weissenbach J Mansour S Young ID Goodfellow PN Brook JD Schafer AJ Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene.Nature. 1994; 372: 525-530Crossref PubMed Scopus (1258) Google Scholar; Wagner et al. Wagner et al., 1994Wagner T Wirth J Meyer J Zabel B Held M Zimmer J Pasantes J Bricarelli FD Keutel J Hustert E Wolf U Tommerup N Schempp W Scherer G Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9.Cell. 1994; 79: 1111-1120Abstract Full Text PDF PubMed Scopus (1232) Google Scholar; Morais da Silva et al. Morais da Silva et al., 1996Morais da Silva S Hacker A Harley V Goodfellow P Swain A Lovell-Badge R Sox9 expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds.Nat Genet. 1996; 14: 62-68Crossref PubMed Scopus (667) Google Scholar). SOX9 duplications in humans (Huang et al. Huang et al., 1999Huang B Wang S Ning Y Lamb AN Bartley J Autosomal XX sex reversal caused by duplication of SOX9.Am J Med Genet. 1999; 87: 349-353Crossref PubMed Scopus (315) Google Scholar) can result in XX males in the absence of SRY. SOX9 is much older evolutionarily than DAX1 or SRY (Morais da Silva et al. Morais da Silva et al., 1996Morais da Silva S Hacker A Harley V Goodfellow P Swain A Lovell-Badge R Sox9 expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds.Nat Genet. 1996; 14: 62-68Crossref PubMed Scopus (667) Google Scholar; McBride et al. McBride et al., 1997McBride D Sang H Clinton M Expression of Sry-related genes in the developing genital ridge/mesonephros of the chick embryo.J Reprod Fertil. 1997; 109: 59-63Crossref PubMed Scopus (15) Google Scholar), may be part of an ancient “core” sex-determination mechanism that predates the mammalian radiation (Koopman Koopman, 1999Koopman P Sry and Sox9: mammalian testis determining genes.Cell Mol Life Sci. 1999; 55: 839-856PubMed Google Scholar) and has important roles in sex determination and bone development (Bi et al. Bi et al., 1999Bi W Deng JM Zhang Z Behringer RR de Crombrugghe B Sox9 is required for cartilage formation.Nat Genet. 1999; 22: 85-89Crossref PubMed Scopus (1290) Google Scholar). These factors may explain the highly conserved nature of SOX9. The purpose of our investigations was to examine the molecular evolution of DAX1 in relation to SRY and to SOX9. Genomic DNA was obtained from cell lines for each species ATCC numbers CRL-1857: Pan troglodytes (chimpanzee); CRL-1850: Pongo pygmaeus (orangutan); TIB-201: Hylobates species (gibbon); CRL-1773: Callithrix jacchus (marmoset); and from ClonTech Laboratories: Homo sapiens (human) and Macaca mulatta (rhesus) (fig. 1). A PCR-based approach was used to sequence the primate homologue of each gene. We used or adapted previously published primers for SRY (Whitfield et al. Whitfield et al., 1993Whitfield LS Lovell-Badge R Goodfellow PN Rapid sequence evolution of the mammalian sex-determining gene SRY.Nature. 1993; 364: 713-715Crossref PubMed Scopus (316) Google Scholar) and SOX9 (Wagner et al. Wagner et al., 1994Wagner T Wirth J Meyer J Zabel B Held M Zimmer J Pasantes J Bricarelli FD Keutel J Hustert E Wolf U Tommerup N Schempp W Scherer G Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9.Cell. 1994; 79: 1111-1120Abstract Full Text PDF PubMed Scopus (1232) Google Scholar). PCR primers used for DAX1 were A5 (TTGAACTACCGAGGTCATGGG) and A3 (CATGTTGTAGAGGATGCTGCC), B5 (GGGCTGCAGGAGCCGCGGGCC) and B3 (GCAGCGGTACAGGAGTGCCAC), C5 (GGGTGGGCAGAAAAGGGCTGC) and C3 (GGTGCTGCCCTGCTGCGGGTG), D5 (GGCCAGGGGGTAGAGAGGCGC) and D3 (GATCTTCTGCAGCATGCTGGG), E5 (GAGACTGTAGAAGTCTCGGAG) and E3 (GTAGGCGTACTCCTTGGTACT, F5 (AGTACCAAGGAGTACGCCTAC and F3 (CCACTGGAGTCCCTGAATGTTCTT), and G5 (ACGGGACGTGCCGGCAGTGCG) and G3 (CACTTGTGTGGCCCACATGAC). Sequences were deposited into GenBank. PCR products were sequenced using ABI 375 (PE Biosystems), and sequence data were formatted and analyzed using the GCG software package, version 10.0. The ratios of nonsynonymous to synonymous (Ka/Ks) were estimated with the use of codeml, from the phylogenetic analysis using maximum likelihood (PAML) package (Goldman and Yang Goldman and Yang, 1994Goldman N Yang Z A codon-based model of nucleotide substitution for protein-coding DNA sequences.Mol Biol Evol. 1994; 11: 725-736PubMed Google Scholar). We imposed the commonly accepted primate topology (Pilbeam Pilbeam, 1984Pilbeam D The descent of hominoids and hominids.Sci Am. 1984; 250: 84-96Crossref PubMed Scopus (81) Google Scholar) and estimated kappa (κ) and omega (ω, i.e., Ka/Ks), with alpha (α) and rho (ρ) fixed at zero. A single ω was used for the entire topology, since a model with separate ω for each branch did not give a significantly better fit. Codon frequencies were determined by means of the 12-parameter f3×4 model, but parameter estimates were largely independent of the codon-frequency model used. The tree-shape comparisons among genes were performed by likelihood-ratio tests. We compared a restricted model, having a constant ratio between respective branches of the trees for the two genes but all other evolutionary parameters unrestricted, with a more general model having separate evolutionary parameters (including the branch lengths) for the two genes. The maximum likelihood of the restricted model (18 parameters) and the maximum likelihood of the general model (26 parameters) were calculated by use of the HKY nucleotide-substitution model (Hasegawa et al. Hasegawa et al., 1985Hasegawa M Kishino H Yano T Dating of the human-ape splitting by a molecular clock of mitochondrial DNA.J Mol Evol. 1985; 22: 160-174Crossref PubMed Scopus (6378) Google Scholar), implemented in a modification of Schadt et al. (Schadt et al., 1998Schadt EE Sinsheimer JS Lange K Computational advances in maximum likelihood methods for molecular phylogeny.Genome Res. 1998; 8: 222-233Crossref PubMed Scopus (37) Google Scholar) (fig. 2). Our results showed that at the nucleotide level, SRY was highly divergent (92.5% average pairwise identity) and SOX9 was very conserved (98.9% average pairwise identity) (table 1). When the overall nucleotide sequence of DAX1 was examined, it was also conserved (98.1% average pairwise identity), falling closer to SOX9 than to SRY.Table 1Overall Measure of Sequence Divergence for Primate SRY, DAX1, and SOX9 Nucleotide SequencesParameterSRYDAX1SOX9Nucleotide identityaAverage pairwise comparisons.92.5%98.1%98.9%Amino acid identityaAverage pairwise comparisons.85.8%96.6%99.8%Ka/KsbKa/Ks ratios estimated by means of PAML (Goldman and Yang 1994). Imposing the topologies in figure 1 gave similar results with alternative topology for DAX1..62.43.0061Ka/Ks SEbKa/Ks ratios estimated by means of PAML (Goldman and Yang 1994). Imposing the topologies in figure 1 gave similar results with alternative topology for DAX1..11.08.0036Phylogenetic tree branch lengthcThe sum of branch lengths in the maximum-likelihood tree, as estimated by PAML, when the topology was imposed (Goldman and Yang 1994). Similar results were obtained with the use of an alternative topology..71.18.11a Average pairwise comparisons.b Ka/Ks ratios estimated by means of PAML (Goldman and Yang Goldman and Yang, 1994Goldman N Yang Z A codon-based model of nucleotide substitution for protein-coding DNA sequences.Mol Biol Evol. 1994; 11: 725-736PubMed Google Scholar). Imposing the topologies in figure 1 gave similar results with alternative topology for DAX1.c The sum of branch lengths in the maximum-likelihood tree, as estimated by PAML, when the topology was imposed (Goldman and Yang Goldman and Yang, 1994Goldman N Yang Z A codon-based model of nucleotide substitution for protein-coding DNA sequences.Mol Biol Evol. 1994; 11: 725-736PubMed Google Scholar). Similar results were obtained with the use of an alternative topology. Open table in a new tab We investigated the protein products of these genes at the amino acid level. We aligned the deduced DAX1 amino acid sequences for these primate species (fig. 3). The results were consistent with the nucleotide analysis. The average pairwise identities at the amino acid level were 85.8% for SRY, 96.6% for DAX1, and 99.8% for SOX9 (table 1). Inspection of the alignment suggests a clustering of amino acid changes between residues 180 and 240 of DAX1. Proteins subjected to different functional selective pressures should accumulate amino acid differences in varying proportions relative to the silent mutations. Therefore, we calculated the frequency of nonsynonymous (Ka) and synonymous (Ks) nucleotide changes for our six primate species (Li et al. Li et al., 1985Li WH Wu CI Luo CC A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes.Mol Biol Evol. 1985; 2: 150-174PubMed Google Scholar) (table 2). When Ka values for SRY, DAX1, and SOX9 were examined within individual species, it was clear that SRY had the highest values, with DAX1 intermediate and SOX9 lowest. Ks values were consistently lower for DAX1 than for SRY or for SOX9. Ka values, however, were consistently higher for DAX1 than for SOX9.Table 2Ka and Ks Values for Nonhuman Primate to Human SRY, DAX1, and SOX9 Nucleotide SequencesSpecies and MeasureSRYDAX1SOX9P. troglodytes: Ka × 102 (95% CI)1.44 (.35–2.53).47 (.05–.88).00 (.00–.17)aUpper bound calculated assuming a maximum of two nonsynonymous substitutions. Ks × 102 (95% CI).82 (.00–2.46).30 (.00–.91).29 (.00–.87)P. pygmaeus: Ka × 102 (95% CI)2.52 (1.05–3.98)1.03 (.41–1.66).00 (.00–.17)aUpper bound calculated assuming a maximum of two nonsynonymous substitutions. Ks × 102 (95% CI)2.51 (.00–5.45)1.83 (.33–3.33)4.53 (2.15–6.91)Hylobates: Ka × 102 (95% CI)3.56 (1.82–5.32)1.60 (.82–2.37).08 (.00–.26) Ks × 102 (95% CI)5.87 (1.37–10.38)2.46 (.71–4.21)5.98 (3.27–8.70)M. mulatta: Ka × 102 (95% CI)4.63 (2.63–6.63)1.12 (.47–1.77).00 (.00–.17)aUpper bound calculated assuming a maximum of two nonsynonymous substitutions. Ks × 102 (95% CI)13.22 (6.16–20.29)2.78 (.91–4.65)4.20 (1.91–6.49)C. jacchus: Ka × 102 (95% CI)12.9 (9.44–16.43)2.69 (1.68–3.71).17 (.00–.41) Ks × 102 (95% CI)27.6 (16.52–38.59)6.45 (3.53–9.34)6.63 (3.74–9.52)Note.—Ka and Ks values were estimated by means of the pairwise comparison method of Li et al. (Li et al., 1985Li WH Wu CI Luo CC A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes.Mol Biol Evol. 1985; 2: 150-174PubMed Google Scholar).a Upper bound calculated assuming a maximum of two nonsynonymous substitutions. Open table in a new tab Note.— Ka and Ks values were estimated by means of the pairwise comparison method of Li et al. (Li et al., 1985Li WH Wu CI Luo CC A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes.Mol Biol Evol. 1985; 2: 150-174PubMed Google Scholar). To examine the relative frequency of nonsynonymous nucleotide changes in comparison with the frequency of synonymous nucleotide changes, we calculated the Ka/Ks ratio for all six primate species (Goldman and Yang Goldman and Yang, 1994Goldman N Yang Z A codon-based model of nucleotide substitution for protein-coding DNA sequences.Mol Biol Evol. 1994; 11: 725-736PubMed Google Scholar). This ratio controls for different intrinsic rates of mutation focusing on the relative preference for amino acid changing substitutions. We found that DAX1 (Ka/Ks=.43±.08) was not significantly different from SRY (Ka/Ks=.62±.11) and was much higher than SOX9 (Ka/Ks=.0061±.0036) (table 1). Phylogenetic trees were constructed by means of the DAX1, SRY, and SOX9 coding sequences. PAML was performed (Goldman and Yang 1994) (fig. 2). Homo sapiens (human) and P. troglodytes (chimpanzee) were always most closely related, and M. mulatta (rhesus) and C. jacchus (marmoset) were also sister taxa. The relationship of Hylobates species and P. pygmaeus could not definitely be resolved for the two genes DAX1 and SOX9. The shapes of the phylogenetic trees for DAX1, SRY, and SOX9, however, were distinct. We compared the tree shapes under the commonly accepted primate topology (Pilbeam Pilbeam, 1984Pilbeam D The descent of hominoids and hominids.Sci Am. 1984; 250: 84-96Crossref PubMed Scopus (81) Google Scholar). Tree shape under a given topology was compared by testing whether the ratio of branch length i, for gene 1 (ti), and branch length i, for gene 2 (si), is the same for all branches (ti/si=r for all branches i) (Goldman and Yang Goldman and Yang, 1994Goldman N Yang Z A codon-based model of nucleotide substitution for protein-coding DNA sequences.Mol Biol Evol. 1994; 11: 725-736PubMed Google Scholar). DAX1 and SRY did not differ (χ2=8.10, df 8, P=.424), whereas DAX1 differed from SOX9 (χ2=16.68, df 8, P=.0336), and SRY differed from SOX9 (χ2=30.120, df 8, P=.0002). Therefore, the SOX9 tree had a distinctive shape, differing from the tree shapes for DAX1 and SRY, which were similar to each other. These results were consistent with a discontinuity in the pressures driving the evolution of SOX9 versus SRY and DAX1. An evaluation of rates of primate DAX1 evolution indicates that DAX1 may be under selective pressure for its amino acid sequence to evolve at a rate faster than SOX9. The Ka/Ks ratio would increase when the number of nonsynonymous changes (Ka) are well tolerated or selected, relative to the number of synonymous substitutions (Ks). Using the maximum-likelihood method for estimating Ka/Ks ratios (Goldman and Yang Goldman and Yang, 1994Goldman N Yang Z A codon-based model of nucleotide substitution for protein-coding DNA sequences.Mol Biol Evol. 1994; 11: 725-736PubMed Google Scholar), we found that, for the six primates that we examined, DAX1 has a Ka/Ks ratio that was statistically indistinguishable from SRY and was much higher than SOX9 (table 1). Therefore, whereas DAX1 is more highly conserved than SRY at the nucleotide level, the Ka/Ks ratio distinguished DAX1 and SOX9 as being under different evolutionary pressures. Analysis of the phylogenetic tree shapes for these three genes confirmed this distinction. Our data suggest that, although DAX1 is a relatively conserved protein overall, it is, nevertheless, experiencing amino acid substitutions at a rate higher than is SOX9. We speculate that this selective pressure may be a consequence of the relatively recent evolutionary addition of DAX1 to the sex-determination pathway (Pask et al. Pask et al., 1997Pask A Toder R Wilcox SA Camerino G Graves JAM The candidate sex reversing DAX-1 gene is autosomal in marsupials: implication for the evolution of sex determination in mammals.Genomics. 1997; 41: 422-426Crossref PubMed Scopus (27) Google Scholar; Lahn and Page Lahn and Page, 1999Lahn BT Page DC Four evolutionary strata on the human X chromsome.Science. 1999; 286: 964-967Crossref PubMed Scopus (641) Google Scholar) and/or to a role in spermatogenesis (Yu et al. Yu et al., 1998Yu RN Ito M Saunders TL Camper SA Jameson JL Role of Ahch in gonadal development and gametogenesis.Nat Genet. 1998; 20: 353-357Crossref PubMed Scopus (370) Google Scholar), since male reproductive genes evolve rapidly (Wyckoff et al. Wyckoff et al., 2000Wyckoff GJ Wang W Wu C-I Rapid evolution of male reproductive genes in the descent of man.Nature. 2000; 403: 304-309Crossref PubMed Scopus (423) Google Scholar). The more highly conserved nature of DAX1, relative to SRY, may reflect additional constraints on DAX1 stemming from its role in adrenal development. DAX1 and SRY may be recent additions to an evolutionary ancient “core” sex-determination program that involves SOX9. Our data on the molecular evolution of SRY, DAX1, and SOX9 support this hypothesis for a stepwise evolution of the sex-determination pathway. Just as the human sex chromosomes may be evolving by punctuated sequential events (Lahn and Page Lahn and Page, 1997Lahn BT Page DC Functional coherence of the human Y chromosome.Science. 1997; 278: 675-679Crossref PubMed Scopus (686) Google Scholar, Lahn and Page, 1999Lahn BT Page DC Four evolutionary strata on the human X chromsome.Science. 1999; 286: 964-967Crossref PubMed Scopus (641) Google Scholar), our results are consistent with evolutionary stratification of the sex-determination pathway. We speculate that SRY and DAX1 may be evolving dynamically as more recent additions to an evolutionarily stratified sex-determination pathway. This work was supported, in part, by grants R01 HD22563, R01 HD39322, and P30 HD34610 from the National Institute of Child Health and Human Development." @default.
• W1990452511 created "2016-06-24" @default.
• W1990452511 creator A5013824247 @default.
• W1990452511 creator A5037264695 @default.
• W1990452511 creator A5040723091 @default.
• W1990452511 creator A5054595121 @default.
• W1990452511 creator A5071150922 @default.
• W1990452511 creator A5072645846 @default.
• W1990452511 creator A5078428763 @default.
• W1990452511 creator A5087276189 @default.
• W1990452511 date "2001-01-01" @default.
• W1990452511 modified "2023-10-16" @default.
• W1990452511 title "Primate DAX1, SRY, and SOX9: Evolutionary Stratification of Sex-Determination Pathway" @default.
• W1990452511 cites W1501066624 @default.
• W1990452511 cites W1537498059 @default.
• W1990452511 cites W1574722884 @default.
• W1990452511 cites W1589679285 @default.
• W1990452511 cites W1673606065 @default.
• W1990452511 cites W184563540 @default.
• W1990452511 cites W1920973730 @default.
• W1990452511 cites W1973295687 @default.
• W1990452511 cites W1979275186 @default.
• W1990452511 cites W1984083837 @default.
• W1990452511 cites W1991167271 @default.
• W1990452511 cites W1991873334 @default.
• W1990452511 cites W1997046908 @default.
• W1990452511 cites W2000777137 @default.
• W1990452511 cites W2007969716 @default.
• W1990452511 cites W2009596137 @default.
• W1990452511 cites W2011935366 @default.
• W1990452511 cites W2013082510 @default.
• W1990452511 cites W2013246689 @default.
• W1990452511 cites W2017288138 @default.
• W1990452511 cites W2020362369 @default.
• W1990452511 cites W2021719160 @default.
• W1990452511 cites W2094434685 @default.
• W1990452511 cites W2104306559 @default.
• W1990452511 cites W2109183032 @default.
• W1990452511 cites W2117823121 @default.
• W1990452511 cites W2128825533 @default.
• W1990452511 cites W2159231404 @default.
• W1990452511 cites W2169384293 @default.
• W1990452511 cites W2324710644 @default.
• W1990452511 cites W2339347416 @default.
• W1990452511 cites W3138934332 @default.
• W1990452511 doi "https://doi.org/10.1086/316932" @default.
• W1990452511 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1234927" @default.
• W1990452511 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11112659" @default.
• W1990452511 hasPublicationYear "2001" @default.
• W1990452511 type Work @default.
• W1990452511 sameAs 1990452511 @default.
• W1990452511 citedByCount "24" @default.
• W1990452511 countsByYear W19904525112012 @default.
• W1990452511 countsByYear W19904525112014 @default.
• W1990452511 countsByYear W19904525112015 @default.
• W1990452511 crossrefType "journal-article" @default.
• W1990452511 hasAuthorship W1990452511A5013824247 @default.
• W1990452511 hasAuthorship W1990452511A5037264695 @default.
• W1990452511 hasAuthorship W1990452511A5040723091 @default.
• W1990452511 hasAuthorship W1990452511A5054595121 @default.
• W1990452511 hasAuthorship W1990452511A5071150922 @default.
• W1990452511 hasAuthorship W1990452511A5072645846 @default.
• W1990452511 hasAuthorship W1990452511A5078428763 @default.
• W1990452511 hasAuthorship W1990452511A5087276189 @default.
• W1990452511 hasBestOaLocation W19904525111 @default.
• W1990452511 hasConcept C104317684 @default.
• W1990452511 hasConcept C169760540 @default.
• W1990452511 hasConcept C2778486617 @default.
• W1990452511 hasConcept C2780246931 @default.
• W1990452511 hasConcept C2780509455 @default.
• W1990452511 hasConcept C54355233 @default.
• W1990452511 hasConcept C70721500 @default.
• W1990452511 hasConcept C73456138 @default.
• W1990452511 hasConcept C78458016 @default.
• W1990452511 hasConcept C86339819 @default.
• W1990452511 hasConcept C86803240 @default.
• W1990452511 hasConceptScore W1990452511C104317684 @default.
• W1990452511 hasConceptScore W1990452511C169760540 @default.
• W1990452511 hasConceptScore W1990452511C2778486617 @default.
• W1990452511 hasConceptScore W1990452511C2780246931 @default.
• W1990452511 hasConceptScore W1990452511C2780509455 @default.
• W1990452511 hasConceptScore W1990452511C54355233 @default.
• W1990452511 hasConceptScore W1990452511C70721500 @default.
• W1990452511 hasConceptScore W1990452511C73456138 @default.
• W1990452511 hasConceptScore W1990452511C78458016 @default.
• W1990452511 hasConceptScore W1990452511C86339819 @default.
• W1990452511 hasConceptScore W1990452511C86803240 @default.
• W1990452511 hasIssue "1" @default.
• W1990452511 hasLocation W19904525111 @default.
• W1990452511 hasLocation W19904525112 @default.
• W1990452511 hasLocation W19904525113 @default.
• W1990452511 hasLocation W19904525114 @default.
• W1990452511 hasOpenAccess W1990452511 @default.
• W1990452511 hasPrimaryLocation W19904525111 @default.
• W1990452511 hasRelatedWork W1988749905 @default.
• W1990452511 hasRelatedWork W2014476616 @default.
• W1990452511 hasRelatedWork W2016611045 @default.
• W1990452511 hasRelatedWork W2017288138 @default.

• next