FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1990687537> ?p ?o ?g. }

• W1990687537 endingPage "14997" @default.
• W1990687537 startingPage "14989" @default.
• W1990687537 abstract "The rat L-type pyruvate kinase gene is transcribed either from promoter L in the liver or promoter L′ in erythroid cells. We have now cloned and functionally characterized an erythroid-specific enhancer, mapped in the fetal liver as hypersensitive site B (HSSB) at 3.7 kilobases upstream from the promoter L′. Protein-DNA interactions were examined in the 200-base pair core of the site by in vivo footprinting experiments. In the fetal liver, footprints were revealed at multiple GATA and CACC/GT motifs, whose association is the hallmark of erythroid-specific regulatory sequences. Functional analysis of the HSSB element in transgenic mice revealed properties of a cell-restricted enhancer. Indeed, this element was able to activate the linked ubiquitous herpes simplex virus thymidine kinase promoter in erythroid tissues. The activation was also observed in a variety of nonerythroid tissues known to synthesize GATA-binding factors. In the context of L′-PK transgenes, HSSB was not needed for an erythroid-specific activation of the L′ promoter, while it was required to stimulate the L′ promoter activity to a proper level. Finally, HSSB cannot be replaced by strong ubiquitous viral or cellular enhancers, suggesting a preferential interaction of the HSSB region with the L′ promoter. The rat L-type pyruvate kinase gene is transcribed either from promoter L in the liver or promoter L′ in erythroid cells. We have now cloned and functionally characterized an erythroid-specific enhancer, mapped in the fetal liver as hypersensitive site B (HSSB) at 3.7 kilobases upstream from the promoter L′. Protein-DNA interactions were examined in the 200-base pair core of the site by in vivo footprinting experiments. In the fetal liver, footprints were revealed at multiple GATA and CACC/GT motifs, whose association is the hallmark of erythroid-specific regulatory sequences. Functional analysis of the HSSB element in transgenic mice revealed properties of a cell-restricted enhancer. Indeed, this element was able to activate the linked ubiquitous herpes simplex virus thymidine kinase promoter in erythroid tissues. The activation was also observed in a variety of nonerythroid tissues known to synthesize GATA-binding factors. In the context of L′-PK transgenes, HSSB was not needed for an erythroid-specific activation of the L′ promoter, while it was required to stimulate the L′ promoter activity to a proper level. Finally, HSSB cannot be replaced by strong ubiquitous viral or cellular enhancers, suggesting a preferential interaction of the HSSB region with the L′ promoter. The use of alternative promoters is a common mechanism of tissue- and development-specific gene expression. The rat L-type pyruvate kinase gene (L-PK)1( 1The abbreviations used are: L-PKL-type pyruvate kinaseHSShypersensitive sitePCRpolymerase chain reactionRTreverse transcriptaseDMSdimethyl sulfateCATchloramphenicol acetyltransferaseHSVhamster sarcoma virusntnucletotidebpbase pairkbkilobase pair.) affords a good example of such a mechanism since it encodes two tissue-specific isoforms of a glycolytic enzyme (EC 2.7.1.40), transcribed from two alternative promoters, located 500 bp apart. These two promoters direct the transcription of erythroid- (L′) and liver-specific (L) mRNAs, which differ only by their first exon(1Kahn A. Marie J. Methods Enzymol. 1982; 90: 131-141Crossref PubMed Scopus (39) Google Scholar, 2Noguchi T. Yamada K. Inoue H. Matsuda T. Tanaka T. J. Biol. Chem. 1987; 262: 14366-14371Abstract Full Text PDF PubMed Google Scholar). In fact, the L promoter is also active in two other gluconeogenic tissues, i.e. the small intestine and proximal tubules of the kidney(3Cartier N. Miquerol L. Tulliez M. Lepetit N. Levrat F. Grimber G. Briand P. Kahn A. Oncogene. 1992; 7: 1413-1422PubMed Google Scholar). The L′ promoter is strictly specific to erythroid cells. It is active in the fetal liver during its period of hematopoietic activity and in the adult bone marrow and spleen, which is an erythropoietic organ in rodents. In the liver, the amount of L′-mRNA decreases a few days after birth, when erythropoiesis stops in this organ. Sequences involved in the tissue-specific expression from the erythroid L′ promoter have been characterized either in vitro(4Lacronique V. Boquet D. Lopez S. Kahn A. Raymondjean M. Nucleic Acids Res. 1992; 20: 5669-5676Crossref PubMed Scopus (13) Google Scholar) or in transient transfection assays(5Max-Audit I. Eleouet J.-F. Romeo P-H. J. Biol. Chem. 1993; 268: 5431-5437Abstract Full Text PDF PubMed Google Scholar). Footprinting experiments and site-directed mutagenesis of a 300-bp proximal L′ promoter fragment have revealed that the promoter requires a cluster of binding sites for the hematopoietic restricted protein GATA-1- and CACC/GT-binding factors (4, 5). In vivo, this region corresponds to a strong DNase I hypersensitive site (HSSA) detected in the fetal liver (6Boquet D. Vaulont S. Tremp G. Ripoche A.M. Deagelen D. Jami J. Kahn A. Raymondjean M. Eur. J. Biochem. 1992; 207: 13-21Crossref PubMed Scopus (8) Google Scholar) (see Fig. 1A). Transcriptional activity of transgenes carrying this L′ promoter plus 2.7 kb of 5′-flanking sequence, although specific to erythropoietic tissues such as fetal liver, spleen, and bone marrow, was low in all transgenic lines as compared to that of the endogenous gene(7Tremp G. Boquet D. Ripoche A.M. Cognet M. Lone Y.C. Jami J. Kahn A. Deagelen D. J. Biol. Chem. 1989; 264: 19904-19910Abstract Full Text PDF PubMed Google Scholar). Therefore, we hypothesized that the transgenic constructs used in these experiments were lacking an essential positive control element. Since a second DNase I erythroid-specific hypersensitive region (HSSB), previously identified far upstream from the gene, was lacking in all of these microinjected constructs(6Boquet D. Vaulont S. Tremp G. Ripoche A.M. Deagelen D. Jami J. Kahn A. Raymondjean M. Eur. J. Biochem. 1992; 207: 13-21Crossref PubMed Scopus (8) Google Scholar, 7Tremp G. Boquet D. Ripoche A.M. Cognet M. Lone Y.C. Jami J. Kahn A. Deagelen D. J. Biol. Chem. 1989; 264: 19904-19910Abstract Full Text PDF PubMed Google Scholar), we decided to isolate the DNA fragment carrying HSSB and to investigate its effects on the expression from the L′ promoter. L-type pyruvate kinase hypersensitive site polymerase chain reaction reverse transcriptase dimethyl sulfate chloramphenicol acetyltransferase hamster sarcoma virus nucletotide base pair kilobase pair. 3 ´ 106 plaques of a ´ EMBL3 rat genomic DNA library were screened with a 377-bp DNA fragment extending from −2721 to −2344 (arbitrarily, the L′ start site of transcription will be referred to as (+1) throughout this report(7Tremp G. Boquet D. Ripoche A.M. Cognet M. Lone Y.C. Jami J. Kahn A. Deagelen D. J. Biol. Chem. 1989; 264: 19904-19910Abstract Full Text PDF PubMed Google Scholar). Filters were hybridized at 65°C in the following mix: 3 l SSC, 10% (w/v) polyethylene glycol, 1% (w/v) glycine, 1% (w/v) SDS, 0.2% (w/v) Ficoll, 0.2% (w/v) polyvinylpyrrolidone, supplemented with 50 μg/ml salmon sperm DNA, and washed in 2 ´ SSC, 0.1% SDS at 65°C. The probe was prepared and radiolabeled by PCR (8). Restriction mapping, combined with oligonucleotide hybridization, revealed that one genomic clone (l) contained the L′ promoter and more than 15 kb of 5′-flanking sequences. A 4.5-kb BamHI restriction fragment was subsequently subcloned into pEMBL18+. The 5′ end of this fragment (spanning from nt −5231 to −2721) was then sequenced on both strands by primer walking using the dideoxynucleotide chain-termination method with the Sequenase kit (U.S. Biochemical Corp.). Nuclei were isolated from 17-day-old rat liver fetuses and digested by increasing amounts of DNase I as previously described(6Boquet D. Vaulont S. Tremp G. Ripoche A.M. Deagelen D. Jami J. Kahn A. Raymondjean M. Eur. J. Biochem. 1992; 207: 13-21Crossref PubMed Scopus (8) Google Scholar). DNA samples were purified, digested by BamHI, and analyzed on a Southern blot by hybridization with a probe located either 5′ (nt −5231 to −4850; probe A) or 3′ (nt −3197 to −2721; probe B) of the HSSB site, labeled by random priming with [α-32P]dCTP. A pEMBL8+ plasmid containing the entire rat L-type pyruvate kinase gene plus 2.7 and 1.4 kb of the 5′- and 3′-flanking regions, respectively, was used to achieve two types of constructs(6Boquet D. Vaulont S. Tremp G. Ripoche A.M. Deagelen D. Jami J. Kahn A. Raymondjean M. Eur. J. Biochem. 1992; 207: 13-21Crossref PubMed Scopus (8) Google Scholar, 7Tremp G. Boquet D. Ripoche A.M. Cognet M. Lone Y.C. Jami J. Kahn A. Deagelen D. J. Biol. Chem. 1989; 264: 19904-19910Abstract Full Text PDF PubMed Google Scholar). First, the PK minigene was created by excision of 4.7 kb between the first and ninth intron of the pyruvate kinase gene by BglII digestion and religation. The second type of constructs corresponded to three PK-Tag chimeric genes: (i) a PK-Tag hybrid gene containing 2.7 kb of 5′-regulatory sequences of the PK gene, controlling the expression of large T and little t SV40 antigens, whose expression in transgenic mice has been previously reported(3Cartier N. Miquerol L. Tulliez M. Lepetit N. Levrat F. Grimber G. Briand P. Kahn A. Oncogene. 1992; 7: 1413-1422PubMed Google Scholar); (ii) enh SV40-PK-Tag, a hybrid gene containing the 72-bp repeats of enhancer SV40 spanning positions 95-270, inserted into the ClaI site(−532) of the PK-Tag construct; (iii) enh H-PK-Tag, a hybrid gene containing the H enhancer of the human aldolase A gene, extending from nt +2610 to +3100 of the published sequence (9Concordet J.P. Maire P. Kahn A. Deagelen D. Nucleic Acids Res. 1991; 19: 4173-4180Crossref PubMed Scopus (17) Google Scholar) and subcloned into the ClaI site(−532) of the PK-Tag construct. The erythroid-specific DNase I hypersensitive site HSSB was contained in a 4.5-kb BamHI fragment of the genomic clone l3, and subcloned into pEMBL18+. The resulting plasmid named HSSB-pEMBL18+ was taken as the source for two constructs. HSSB-PK minigene was constructed by inserting a KpnI fragment spanning from nt −989 to +9455 of the PK minigene into the KpnI site of HSSB-pEMBL18+; it contained 5225 bp of 5′-flanking region. HSSB-tk-CAT was obtained by insertion of a BamHI-EcoRI fragment spanning from nt −5230 to −3197, upstream of the CAT gene in pBLCAT2, which contains the thymidine kinase promoter (nt −105 to +51) and the SV40 early polyadenylation signal(10Luckow B. Schütz G. Nucleic Acids Res. 1987; 15: 5490Crossref PubMed Scopus (1401) Google Scholar). Plasmid DNA was digested with HindIII and ScaI for the HSSB-PK minigene, HindIII and ClaI for HSSB-tk-CAT, XbaI and ClaI for tk-CAT, and EcoRI and PvuI for enh SV40-PK-Tag and enh H-PK-Tag. The different inserts excised from the plasmids were purified on Elutip-d columns (according to the instructions of the supplier Schleicher & Schuell) and microinjected into fertilized mouse eggs by the method reported by Tremp et al.(7Tremp G. Boquet D. Ripoche A.M. Cognet M. Lone Y.C. Jami J. Kahn A. Deagelen D. J. Biol. Chem. 1989; 264: 19904-19910Abstract Full Text PDF PubMed Google Scholar). Transgenic mice were detected by Southern blot analysis of 5 μg of DNA isolated from 2-week-old mouse tail biopsies, using appropriate restriction enzymes and probes. Transgene copy number was determined by scanning autoradiograms with a Shimatzu densitometer with determined amounts of the injected DNA as standard. Positive founders F0 mice were outbred to establish transgenic lines. All subsequent studies were performed on F1 mice and 12-18-day-old fetuses. Total RNA was prepared from various tissues by the guanidium thiocyanate procedure(11Chirgwin J.M. Przybuyla A.Z. MacDonald R.Y. Rutter W.J. Biochemistry. 1979; 18: 5294-5299Crossref PubMed Scopus (16654) Google Scholar). First strand cDNA synthesis and PCR amplification were performed as described by Miquerol et al.(12Miquerol L. Lopez S. Cartier N. Tulliez M. Raymondjean M. Kahn A. J. Biol. Chem. 1994; 269: 8944-8951Abstract Full Text PDF PubMed Google Scholar). The sequence of synthetic oligonucleotides used in PCR amplification experiments is: 5′-CACGCTTTGGAAGCATG-3′, which is complementary to a segment of the erythroid-specific first exon; 5′-CACATCATCTGCCCAGATGG-3′, complementary to a segment of exon 10. Oligonucleotides specific to the rat β-actin gene were used as internal amplification standard. They allow for the amplification of both rat and mouse β-actin mRNAs(12Miquerol L. Lopez S. Cartier N. Tulliez M. Raymondjean M. Kahn A. J. Biol. Chem. 1994; 269: 8944-8951Abstract Full Text PDF PubMed Google Scholar). Amplification products were run through 6% (w/v) polyacrylamide gels, transferred onto a nylon membrane, and hybridized with radiolabeled specific oligonucleotides. The template used for S1 nuclease protection assays was a 1944-bp KpnI-BglII fragment (nt −989 to +955, subcloned into M13mp18) encompassing the two promoters. To map the start sites of transcription of L′ transcripts, an antisense single-stranded probe was synthesized by extension of a specific oligonucleotide complementary to nt +164 to +181, located in the first intron; the probe was excised by digestion with StyI(−160). To map the start sites of transcription of L transcripts, extension was made with a specific oligonucleotide complementary to nt +546 to +563. Located in the first intron downstream of the exon L, the probe was excised by digestion with NheI (+378). Both antisense probes were labeled by extension of the primers in the presence of two [α-32P]dNTPs adjacent to the 3′ end of the oligonucleotides and the Klenow fragment of DNA polymerase I (quasi-end labeling, previously reported in Tremp et al.(7Tremp G. Boquet D. Ripoche A.M. Cognet M. Lone Y.C. Jami J. Kahn A. Deagelen D. J. Biol. Chem. 1989; 264: 19904-19910Abstract Full Text PDF PubMed Google Scholar). Nuclease S1-resistant hybrids were detected as described previously(7Tremp G. Boquet D. Ripoche A.M. Cognet M. Lone Y.C. Jami J. Kahn A. Deagelen D. J. Biol. Chem. 1989; 264: 19904-19910Abstract Full Text PDF PubMed Google Scholar). Tissue samples were treated as described by Cuif et al.(13Cuif M.H. Cognet M. Boquet D. Tremp G. Kahn A. Vaulont S. Mol. Cell. Biol. 1992; 12: 4852-4861Crossref PubMed Scopus (43) Google Scholar), and CAT activity was assayed according to the standard methods(14Gorman C. Moffat L. Howard B. Mol. Cell. Biol. 1982; 2: 1044-1051Crossref PubMed Scopus (5294) Google Scholar). Specific activities were expressed as counts/min of reaction and per mg of protein. 17-day-old rat fetal liver and adult brain were treated by DMS, and genomic DNA was purified as described previously(4Lacronique V. Boquet D. Lopez S. Kahn A. Raymondjean M. Nucleic Acids Res. 1992; 20: 5669-5676Crossref PubMed Scopus (13) Google Scholar). Isolated nuclei were treated by DNase I as in standard DNase I hypersensitivity experiments(6Boquet D. Vaulont S. Tremp G. Ripoche A.M. Deagelen D. Jami J. Kahn A. Raymondjean M. Eur. J. Biochem. 1992; 207: 13-21Crossref PubMed Scopus (8) Google Scholar), but with 4-8 times reduced amounts of DNase I. Genomic DNA sequencing by ligation-mediated PCR method was performed according to Mueller and Wold(15Mueller P.R. Wold B. Science. 1989; 246: 780-786Crossref PubMed Scopus (798) Google Scholar). Two sets of primers were used to obtain sequence information on both strands of the HSSB site. They were used for the Sequenase extension reaction (primer 1), the PCR amplification reaction (primer 2), and the labeling reaction (primers 3 and 4). The primer set for the upper strand analysis was as follows: V1 −3520 to −3540: TAGCAGGCAAGTGCAGCTGTG; V2 −3527 to −3549: CAAGTGCAGCTGTGCTCTAGGCG; V3 −3541 to −3562: CTCTAGGCGGGAGGACACAGCC; V4 −3610 to −3630: AGAGAGCCGCGGCGGTCGGGC. The primer set for the lower strand analysis was as follows: V1R −3828 to −3809: GGCAGCAGAGTGCAACGTGC; V2R −3824 to −3802: GCAGAGTGCAACGTGCAGTTCGC; V3R −3817 to −3793: CAACGTGCAGTTCGCGTGCTACGGG; V4R −3735 to −3712: GATCATAGCACTCCGCGCAACCCC. In order to characterize the erythroid-specific HSSB element, we isolated from a rat DNA genomic library a 20-kb clone (clone l3) containing the 5′ distal region of the L-PK gene (Fig. 1A). This clone overlapped at its 3′ end with our previous L-PK genomic clone and contained 15 kb of additional 5′-flanking sequence. A subsequent 4.5-kb BamHI restriction fragment was used to generate new probes (probes A and B) to accurately localize the previously described HSSB element (Fig. 1B). DNA purified from DNase I-treated nuclei of 17-day-old rat fetal livers, used as source of erythroid cells, was digested with BamHI, and the fragments were electrophoresed in agarose before Southern blotting and hybridization with either probe A or probe B, as shown in Fig. 1B. These experiments showed cleavage of the 4.5-kb genomic BamHI fragment to give diffuse bands at about 1.5 and 3 kb with the probe A and the probe B, respectively. These results, in good agreement with the previous data (6), have allowed us to delineate the hypersensitive site to a 200-bp region, extending from nt −3800 to −3600 upstream of the erythroid-specific cap site. Other experiments have failed to detect HSSB in rat adult liver and brain tissues (not shown). The complete sequence of the 200-bp core of HSSB is presented in Fig. 2. The array of nuclear factors binding to the 200-bp core of the HSSB region was determined by in vivo footprinting analyses. To gain maximal information about protein-DNA interactions, we performed the in vivo analysis with two specific DNA cleavage methods: the DMS procedure, allowing for the identification of the nucleotides involved in protein-DNA contacts, and the DNase I procedure, as a complementary approach for the detection of protein occupancy on binding sites. Footprinting results are illustrated in Fig. 3. In vivo footprinting analysis showed interactions with nuclear proteins in erythroid cells, scattered all over the hypersensitive region. These interactions being more obvious on the upper strand than on the lower one, we present here data that concern only the upper strand. The in vivo interactions revealed by DMS reactivity consisted of hypersensitive residues rather than protected residues and were very weak compared with those obtained with in vivo DNase I cleavage. In vivo protein occupancy within the HSSB region is summarized in Fig. 2. DNase I in vivo footprinting analysis of the 200-bp core region revealed protein occupancy of seven boxes, numbered I-VII in Figure 2:, Figure 3:, Figure 4:. Boxes II, IV, and V encompass several putative binding motifs for the erythroid nuclear factor GATA-1 (for review, see Ref. 16); two of them conforming the consensus sequence WGATAR and the others being significantly different from this motif (see Fig. 2). Boxes I and III consist of two putative CACC/GT motifs. These motifs have been characterized as binding sites for either ubiquitous factors Sp1 (17Gidoni D. Kadonaga J.T. Barrera-Saldana H. Takahashi K. Chambon P. Tjian R. Science. 1985; 230: 511-514Crossref PubMed Scopus (219) Google Scholar) and TEF2 (18Jarman A.P. Wood W.G. Sharpe J.A. Gourdon G. Ayyub H. Higgs D.R. Mol. Cell. Biol. 1991; 11: 4679-4689Crossref PubMed Google Scholar) or the erythroid-specific EKLF (19Miller I.J. Bieker J.J. Mol. Cell. Biol. 1993; 13: 2776-2786Crossref PubMed Scopus (655) Google Scholar) and CACD (20Hartzog G. Myers R. Mol. Cell. Biol. 1993; 13: 44-56Crossref PubMed Google Scholar) proteins. Box VI corresponds to a GC-rich sequence, similar to the binding site for proteins of the Sp1 family. Finally, the sequence of the box VII does not give any clue on the nature of the cognate binding factor. Furthermore, a close examination of the 200-bp core fragment reveals additional elements related to GATA (nt −3653) and CACC/GT (nt −3576), but these motifs are not protected in the in vivo DNase I footprinting experiments (Fig. 2). Box I contains, in addition to the CACC/GT motif, a poly(pu) region homologous to the AGGAGGA sequence present in the promoter and enhancer of the chicken β-globin gene(21Gallarda J.L. Foley K.P. Yang Z. Engel J.D. Genes & Dev. 1989; 3: 1845-1859Crossref PubMed Scopus (70) Google Scholar), and in the human Ag-globin gene 3′ enhancer(22Purucker M. Bodine D. Lin H. McDonagh K. Nienhuis A.W. Nucleic Acids Res. 1990; 18: 7407-7415Crossref PubMed Scopus (37) Google Scholar). The AGGAGGA motif has been reported to interact with an erythroid-specific factor NF-E4, expressed during the late stages of definitive erythropoiesis(23Yang Z. Engel J.D. J. Biol. Chem. 1994; 269: 10079-10087Abstract Full Text PDF PubMed Google Scholar). The fetal liver protection pattern differs from the ones observed in the brain (Fig. 3) and the adult liver (not shown), in which the erythroid L′ promoter is inactive. Nevertheless, some footprints can be observed in these two nonexpressing tissues, as already reported for the upstream enhancer 5′ HS-2 of the human β-globin genes cluster in nonerythroid cells(24Reddy P.M.S. Stamatoyannopoulos G. Papayannopoulou T. Shen C-K.J. J. Biol. Chem. 1994; 269: 8287-8295Abstract Full Text PDF PubMed Google Scholar). To examine the in vivo role of the HSSB region, we first established two series of transgenic mouse lines. Both series contained a minigene construct either with 2.7 kb (PK minigene) or 5.2 kb (HSSB-PK minigene) of 5′-flanking sequence, respectively. Transgenic founder mice were identified by Southern blot analysis, and the number of integrated copies was estimated for each line. Fig. 4 presents all of the different PK transgenic lines analyzed, generally two lines for each constuct. All carried multiple intact copies, ranging from 2 to 50. Expression analysis was performed on F1 and F2 heterozygotes. The accumulation of the L′-PK transcripts from the transgenes was examined in various tissues by RT-PCR and compared to that of the rat endogenous gene expression (Fig. 5). In the PK minigene line B49 harboring 2.7 kb of 5′-flanking region, the transgenic L′ promoter was found to be active in erythropoietic tissues, i.e. the fetal liver, spleen and bone marrow of adult animals(7Tremp G. Boquet D. Ripoche A.M. Cognet M. Lone Y.C. Jami J. Kahn A. Deagelen D. J. Biol. Chem. 1989; 264: 19904-19910Abstract Full Text PDF PubMed Google Scholar). As it was observed for the endogenous gene in rat, this expression was undetectable in liver of newborn animals, reflecting the perinatal disappearance of erythroid cells from the liver (not shown). Transgenic L′-PK transcripts were also detected in various fetal tissues, probably due to the presence of circulating erythroblasts. This was also observed for the rat endogenous L′-PK transcripts. The analysis of the HSSB-PK minigene line 10 showed an expected developmental expression appropriately distributed in the different tissues. Thus, the tissue specificity was not modified by the presence or the absence of the erythroid-specific HSSB element. We have already reported that the level of expression of L-PK transgenes was in good correlation with the number of integrated copies and seemed to be independent of the integration site(3Cartier N. Miquerol L. Tulliez M. Lepetit N. Levrat F. Grimber G. Briand P. Kahn A. Oncogene. 1992; 7: 1413-1422PubMed Google Scholar, 6Boquet D. Vaulont S. Tremp G. Ripoche A.M. Deagelen D. Jami J. Kahn A. Raymondjean M. Eur. J. Biochem. 1992; 207: 13-21Crossref PubMed Scopus (8) Google Scholar, 7Tremp G. Boquet D. Ripoche A.M. Cognet M. Lone Y.C. Jami J. Kahn A. Deagelen D. J. Biol. Chem. 1989; 264: 19904-19910Abstract Full Text PDF PubMed Google Scholar). This is consistent with results shown in Fig. 6. Indeed, the abundance of both L- and L′-specific RNA precursors, quantified by S1 nuclease protection assays in fetal liver of 16-day-old transgenic mice, was higher in line 10 (five copies; Fig. 6A, lane 4) than in line 3 (two copies; Fig. 6A, lane 7), and the abundance of L transcripts was higher in line B49 (50 copies; Fig. 6B, lane 8) than in lines 10 and 3 (Fig. 6B, lanes 4 and 7). In contrast, the accumulation of L′ transcripts, appreciated by both RT-PCR (Fig. 5) and S1 nuclease protection assays (Fig. 6A), was roughly similar in line B49 devoid of the HSSB region (Fig. 6A, lane 8) and in line 10 (Fig. 6A, lane 4), while the number of integrated copies was 50 for the first line versus 5 for the latter one. These results suggest that the fragment encompassing HSSB could stimulate activity of the erythroid-specific promoter approximately 10-fold. This 10-fold stimulation is consistent with the previous report that transcription from the L′ promoter in line B49 harboring a transgene devoid of HSSB was approximately 5% of that from the endogenous L′ promoter(6Boquet D. Vaulont S. Tremp G. Ripoche A.M. Deagelen D. Jami J. Kahn A. Raymondjean M. Eur. J. Biochem. 1992; 207: 13-21Crossref PubMed Scopus (8) Google Scholar). Since the L′ promoter is erythroid-specific by itself, we wondered whether the HSSB region could be replaced by viral or cellular strong ubiquitous enhancers. To answer this question, we used a different set of transgenic lines (PK-Tag) developed in our laboratory for the purpose of a targeted oncogenesis program(3Cartier N. Miquerol L. Tulliez M. Lepetit N. Levrat F. Grimber G. Briand P. Kahn A. Oncogene. 1992; 7: 1413-1422PubMed Google Scholar, 12Miquerol L. Lopez S. Cartier N. Tulliez M. Raymondjean M. Kahn A. J. Biol. Chem. 1994; 269: 8944-8951Abstract Full Text PDF PubMed Google Scholar). As presented in Fig. 4, these constructs were directed either by the 2.7 kb of the 5′-flanking sequence (PK-Tag), the 72 bp repeats of the SV40 enhancer (enh SV40-PK-Tag), or the enhancer H of the human aldolase A gene (enh H-PK-Tag)(9Concordet J.P. Maire P. Kahn A. Deagelen D. Nucleic Acids Res. 1991; 19: 4173-4180Crossref PubMed Scopus (17) Google Scholar). Both enhancers were located 0.5 kb upstream of the L′ cap site. We compared three lines of transgenic mice, each of them harboring about five copies of the transgene. Tissue-specific patterns of expression of these three chimeric constructs were roughly similar (3).2( 2L. Miquerol et al., unpublished data.) As exemplified in Fig. 6A, both H and SV40 enhancers stimulated the activity of the L′ promoter (compare lanes 10 and 11 to lane 9), but relatively inefficiently compared with the DNA fragment encompassing HSSB and present in the transgene of line 10 (lane 4), while the number of integrated copies was identical. These results provide some evidence that maximal expression from the L′ promoter requires erythroid-specific elements shared by both promoter and HSSB regions. It should be noted that the level of RNA precursors transcribed from the liver-specific L promoter did not vary in transgenic lines harboring about five copies of a transgene encompassing (HSSB-PK minigene) or not (PK-Tag) the HSSB region (Fig. 6B, lanes 4 and 9). This result indicates that the expression from the L promoter is independent of the presence of HSSB in hepatocytes. In contrast, the abundance of L-specific transcripts dramatically decreased in the lines harboring either the enhancer H or the SV40 enhancer (Fig. 6B, lanes 10 and 11), compared with the control line PK-Tag (lane 9). Both enh SV40-PK-Tag and enh H-PK-Tag constructs were devoid of the DNase I liver-specific hypersensitive site 2 (HSS2, see Fig. 1A), which is known to be needed for a maximal activity of the L promoter(13Cuif M.H. Cognet M. Boquet D. Tremp G. Kahn A. Vaulont S. Mol. Cell. Biol. 1992; 12: 4852-4861Crossref PubMed Scopus (43) Google Scholar). It appears, therefore, that the two ubiquitous enhancers are not able to mimic the HSS2-dependent cis-activation of the L promoter in hepatocytes. In an attempt to define more precisely the tissue-specific properties of the HSSB region, we tested its ability to stimulate transcription from an heterologous promoter. Therefore, we analyzed in erythropoietic and nonerythropoietic tissues the expression of a CAT reporter gene driven by the HSV thymidine kinase promoter fused or not to a 2-kb BamHI-EcoRI restriction fragment encompassing HSSB. The levels of CAT activity were measured in various tissues for several individual mice and values are shown in. The two tk-CAT lines studied here did not express the CAT transgene at a detectable level (lines 81 and 87), and this has been confirmed in our laboratory for additional lines (not shown). Among the six HSSB-tk-CAT transgenic mouse lines established, two lines did not express the transgene, although stably inherited through the germ line (not shown). However, an important activation was clearly observed for each of the other four lines in erythroid fetal liver cells (see). This activation began before day 10 of development and remained detectable until day 17. Afterward, CAT activity decreased with the concomitant disappearance of erythropoietic cells in the developing liver (not shown). These results demonstrate that HSSB can confer, in fetal liver, an erythroid-specific expression on a minimal promoter and thus behaves as a tissue-specific enhancer. In tissues expressing the L′-pyruvate kinase isoform during the adult life, i.e. spleen, bone marrow, and blood, CAT activity was barely detectable. Unexpectedly, we noticed a significant and reproductible activation of the thymidine kinase promoter in various adult nonerythropoietic tissues, such as the thymus in lines 2, 18, and 31, the cardiac muscle in lines 2 and 31, and the brain in lines 2 and 23. Although each HSSB-tk-CAT line behaves slightly differently, the ectopic expression of the transgene was restricted to the above tissues. This result might reflect a preferential activation of the minimal thymidine kinase promoter in a set of specific cell-types. This is, however, not the case, since the tk-CAT insert was insufficient for a constitutive expre" @default.
• W1990687537 created "2016-06-24" @default.
• W1990687537 creator A5003744134 @default.
• W1990687537 creator A5013115400 @default.
• W1990687537 creator A5020223413 @default.
• W1990687537 creator A5063569210 @default.
• W1990687537 creator A5083150135 @default.
• W1990687537 creator A5085860314 @default.
• W1990687537 date "1995-06-01" @default.
• W1990687537 modified "2023-10-01" @default.
• W1990687537 title "Identification and Functional Characterization of an Erythroid-specific Enhancer in the L-type Pyruvate Kinase Gene" @default.
• W1990687537 cites W1024860189 @default.
• W1990687537 cites W1484108706 @default.
• W1990687537 cites W1496477358 @default.
• W1990687537 cites W1521285578 @default.
• W1990687537 cites W1534194237 @default.
• W1990687537 cites W1536708473 @default.
• W1990687537 cites W1537591711 @default.
• W1990687537 cites W1539598707 @default.
• W1990687537 cites W1605420823 @default.
• W1990687537 cites W1802962971 @default.
• W1990687537 cites W1926029550 @default.
• W1990687537 cites W1932186111 @default.
• W1990687537 cites W1945443309 @default.
• W1990687537 cites W1946088674 @default.
• W1990687537 cites W1971695712 @default.
• W1990687537 cites W1975287411 @default.
• W1990687537 cites W197557636 @default.
• W1990687537 cites W1982598173 @default.
• W1990687537 cites W1984363370 @default.
• W1990687537 cites W1985375619 @default.
• W1990687537 cites W2002886319 @default.
• W1990687537 cites W2007774250 @default.
• W1990687537 cites W2015980850 @default.
• W1990687537 cites W2021516648 @default.
• W1990687537 cites W2029177264 @default.
• W1990687537 cites W2037117971 @default.
• W1990687537 cites W2039422399 @default.
• W1990687537 cites W2048437870 @default.
• W1990687537 cites W2050206304 @default.
• W1990687537 cites W2052042646 @default.
• W1990687537 cites W2060333964 @default.
• W1990687537 cites W2083295035 @default.
• W1990687537 cites W2084892947 @default.
• W1990687537 cites W2098797177 @default.
• W1990687537 cites W2111428392 @default.
• W1990687537 cites W2133710414 @default.
• W1990687537 cites W2137868994 @default.
• W1990687537 cites W2142071465 @default.
• W1990687537 cites W2142342476 @default.
• W1990687537 cites W2144206181 @default.
• W1990687537 cites W2144515939 @default.
• W1990687537 cites W2151396228 @default.
• W1990687537 cites W2183826319 @default.
• W1990687537 cites W4231995437 @default.
• W1990687537 cites W4243222296 @default.
• W1990687537 cites W4243463421 @default.
• W1990687537 cites W4245041423 @default.
• W1990687537 cites W4249637701 @default.
• W1990687537 cites W4252346318 @default.
• W1990687537 cites W4252461177 @default.
• W1990687537 doi "https://doi.org/10.1074/jbc.270.25.14989" @default.
• W1990687537 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7797480" @default.
• W1990687537 hasPublicationYear "1995" @default.
• W1990687537 type Work @default.
• W1990687537 sameAs 1990687537 @default.
• W1990687537 citedByCount "12" @default.
• W1990687537 countsByYear W19906875372013 @default.
• W1990687537 crossrefType "journal-article" @default.
• W1990687537 hasAuthorship W1990687537A5003744134 @default.
• W1990687537 hasAuthorship W1990687537A5013115400 @default.
• W1990687537 hasAuthorship W1990687537A5020223413 @default.
• W1990687537 hasAuthorship W1990687537A5063569210 @default.
• W1990687537 hasAuthorship W1990687537A5083150135 @default.
• W1990687537 hasAuthorship W1990687537A5085860314 @default.
• W1990687537 hasBestOaLocation W19906875371 @default.
• W1990687537 hasConcept C101762097 @default.
• W1990687537 hasConcept C104317684 @default.
• W1990687537 hasConcept C111936080 @default.
• W1990687537 hasConcept C150194340 @default.
• W1990687537 hasConcept C153911025 @default.
• W1990687537 hasConcept C165864922 @default.
• W1990687537 hasConcept C21592294 @default.
• W1990687537 hasConcept C2522874641 @default.
• W1990687537 hasConcept C2776147627 @default.
• W1990687537 hasConcept C2781196997 @default.
• W1990687537 hasConcept C54355233 @default.
• W1990687537 hasConcept C86339819 @default.
• W1990687537 hasConcept C86803240 @default.
• W1990687537 hasConceptScore W1990687537C101762097 @default.
• W1990687537 hasConceptScore W1990687537C104317684 @default.
• W1990687537 hasConceptScore W1990687537C111936080 @default.
• W1990687537 hasConceptScore W1990687537C150194340 @default.
• W1990687537 hasConceptScore W1990687537C153911025 @default.
• W1990687537 hasConceptScore W1990687537C165864922 @default.
• W1990687537 hasConceptScore W1990687537C21592294 @default.
• W1990687537 hasConceptScore W1990687537C2522874641 @default.
• W1990687537 hasConceptScore W1990687537C2776147627 @default.

• next