FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1991034359> ?p ?o ?g. }

• W1991034359 endingPage "33195" @default.
• W1991034359 startingPage "33188" @default.
• W1991034359 abstract "We have previously shown that adenosine is formed in the intestinal lumen during active inflammation from neutrophil-derived 5′-AMP. Acting through the adenosine A2b receptor (A2bR), the luminally derived adenosine induces vectorial chloride secretion and a polarized secretion of interleukin-6 to the intestinal lumen. Although some G protein-coupled receptors interact with anchoring or signaling molecules, not much is known in this critical area for the A2bR. We used the model intestinal epithelial cell line, T84, and Caco2-BBE cells stably transfected with GFP-A2b receptor to study the intestinal A2bR. The A2bR is present in both the apical and basolateral membranes of intestinal epithelia. Apical or basolateral stimulation of the A2bR induces recruitment of the receptor to the plasma membrane and caveolar fractions. The A2bR co-immunoprecipitates with E3KARP and ezrin upon agonist stimulation. Ezrin interacts with E3KARP and PKA and the interaction between ezrin and E3KARP is enhanced by agonist stimulation. Our data suggest that the A2bR is recruited to the plasma membrane upon apical or basolateral agonist stimulation and interacts with E3KARP and ezrin. We speculate that such an interaction may not only anchor the A2bR to the plasma membrane but may also function to stabilize the receptor in a signaling complex in the plasma membrane. We have previously shown that adenosine is formed in the intestinal lumen during active inflammation from neutrophil-derived 5′-AMP. Acting through the adenosine A2b receptor (A2bR), the luminally derived adenosine induces vectorial chloride secretion and a polarized secretion of interleukin-6 to the intestinal lumen. Although some G protein-coupled receptors interact with anchoring or signaling molecules, not much is known in this critical area for the A2bR. We used the model intestinal epithelial cell line, T84, and Caco2-BBE cells stably transfected with GFP-A2b receptor to study the intestinal A2bR. The A2bR is present in both the apical and basolateral membranes of intestinal epithelia. Apical or basolateral stimulation of the A2bR induces recruitment of the receptor to the plasma membrane and caveolar fractions. The A2bR co-immunoprecipitates with E3KARP and ezrin upon agonist stimulation. Ezrin interacts with E3KARP and PKA and the interaction between ezrin and E3KARP is enhanced by agonist stimulation. Our data suggest that the A2bR is recruited to the plasma membrane upon apical or basolateral agonist stimulation and interacts with E3KARP and ezrin. We speculate that such an interaction may not only anchor the A2bR to the plasma membrane but may also function to stabilize the receptor in a signaling complex in the plasma membrane. protein kinase A cystic fibrosis transmembrane conductance regulator adenosine 2b receptor green fluorescent protein Chinese hamster ovary 5′-ectonucleotidase Hank's balanced salt solution Adenosine is an ubiquitous extracellular signaling molecule that is released during inflammation and acts as a paracrine factor with diverse effects on the inflammatory cascade (1Olah M.E. Stiles G.L. Annu. Rev. Pharmacol. Toxicol. 1995; 35: 581-606Crossref PubMed Google Scholar, 2Feoktistov I. Biaggioni I. J. Clin. Invest. 1995; 96: 1979-1986Crossref PubMed Scopus (306) Google Scholar, 3Feoktistov I. Biaggioni I. Pharmacol. Rev. 1997; 49: 381-402PubMed Google Scholar, 4Linden J. Auchampach J.A. Xiaowei J. Figler R.A. Life Sci. 1995; 62: 1519-1524Crossref Scopus (44) Google Scholar, 5Roman R.M. Fitz J.G. Gastroenterologia. 1999; 116: 964-979Abstract Full Text Full Text PDF Scopus (113) Google Scholar, 6Van Belle H. Gossens F. Wynants J. Am. J. Physiol. 1987; 252: H886-H893PubMed Google Scholar, 7Zidek Z. Eur. Cytokine Netw. 1999; 10: 319-328PubMed Google Scholar). In the intestine, neutrophil transmigration into the lumen to form crypt abscesses is the pathologic hallmark of the active phase of many intestinal disorders, including inflammatory bowel disease. We have previously shown that neutrophils, upon transmigration into the intestinal lumen, release 5′-AMP (8Nash S. Parkos C. Nusrat A. Delp C. Madara J.L. J. Clin. Invest. 1991; 87: 1474-1477Crossref PubMed Scopus (60) Google Scholar, 9Madara J.L. Patapoff T.W. Gillece-Castro B. Colgan S. Parkos C. Delp C. Mrsny R. J. Clin. Invest. 1993; 91: 5716-5723Crossref Scopus (233) Google Scholar). Adenosine is derived from 5′-AMP when it is converted by the intestinal apical membrane 5′-ectonucleotidase (CD 73) (11Strohmeier G.R. Lencer W.I. Thompson L.F. Carlson S.L. Moe S.J. Carnes D.K. Mrsny R.J. Madara J.L. J. Clin. Invest. 1997; 99: 2588-2601Crossref PubMed Scopus (144) Google Scholar) and can subsequently interact with the intestinal adenosine receptor (10Strohmeier G.R. Reppert S.M. Lencer W.I. Madara J.L. J. Biol. Chem. 1995; 270: 2387-2394Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). The adenosine receptor belongs to the family of the G protein-coupled group of cell surface receptors (12Palmer T.M. Stiles G.L. Neuropharmacology. 1995; 34: 683-694Crossref PubMed Scopus (261) Google Scholar, 13Ralevic V. Burnstock G. Pharmacol. Rev. 1998; 50: 413-492PubMed Google Scholar). On the basis of initial pharmacological criteria, adenosine is known to interact with one of the four adenosine receptor subtypes A1, A2a, A2b, and A3 (3Feoktistov I. Biaggioni I. Pharmacol. Rev. 1997; 49: 381-402PubMed Google Scholar, 4Linden J. Auchampach J.A. Xiaowei J. Figler R.A. Life Sci. 1995; 62: 1519-1524Crossref Scopus (44) Google Scholar, 12Palmer T.M. Stiles G.L. Neuropharmacology. 1995; 34: 683-694Crossref PubMed Scopus (261) Google Scholar,13Ralevic V. Burnstock G. Pharmacol. Rev. 1998; 50: 413-492PubMed Google Scholar), all of which have now been cloned. Using molecular, pharmacologic, and biochemical approaches we characterized the intestinal adenosine receptor as the A2b subtype in both T84 cells, a model intestinal epithelial cell line, and intact human intestinal epithelia (10Strohmeier G.R. Reppert S.M. Lencer W.I. Madara J.L. J. Biol. Chem. 1995; 270: 2387-2394Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). Furthermore, the A2bR appears to be the only adenosine receptor present in T84 cells (10Strohmeier G.R. Reppert S.M. Lencer W.I. Madara J.L. J. Biol. Chem. 1995; 270: 2387-2394Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar, 14Christofi F.L. Zhang H., Yu, J.G. Guzman J. Xue J. Kim M. Wang Y.Z. Cooke H.J. J. Comp. Neurol. 2001; 439: 46-64Crossref PubMed Scopus (110) Google Scholar). In these cells, the A2bR is functionally coupled to Gαs and the stimulation of the apical or basolateral surface with adenosine results in cAMP-mediated vectorial chloride secretion (9Madara J.L. Patapoff T.W. Gillece-Castro B. Colgan S. Parkos C. Delp C. Mrsny R. J. Clin. Invest. 1993; 91: 5716-5723Crossref Scopus (233) Google Scholar, 10Strohmeier G.R. Reppert S.M. Lencer W.I. Madara J.L. J. Biol. Chem. 1995; 270: 2387-2394Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar, 15Barrett K.E. Cohn J.A. Huott P.A. Wasserman S.I. Dharmsathaphorn K. Am. J. Physiol. 1990; 258: C902-C912Crossref PubMed Google Scholar, 16Barrett K.E. Huott P.A. Shah S. Dharmasathaphorn K. Am. J. Physiol. 1989; 256: C197-C203Crossref PubMed Google Scholar, 17Sitaraman S.V. Merlin D. Wang L. Wong M. Gewirtz A.T., Si- Tahar M. Madara J.L. J. Clin. Invest. 2001; 107: 861-869Crossref PubMed Scopus (155) Google Scholar) and interleukin-6 synthesis and secretion (18Sitaraman S.V., Si- Tahar M. Merlin D. Strohmeier G.R. Madara J.L. Am. J. Physiol. 2000; 278: C1230-C1236Crossref PubMed Google Scholar). The distribution and coupling of A2bR upon agonist stimulation with cytoplasmic structural proteins and the potential significance of this is not known. On the basis of effective coupling of minute second messenger signals to protein kinase A (PKA)1 we hypothesized sometime ago that A2bR might be compartmentalized with signaling molecules and their targets (10Strohmeier G.R. Reppert S.M. Lencer W.I. Madara J.L. J. Biol. Chem. 1995; 270: 2387-2394Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). Huang et al. (19Huang P. Lazarowski E.R. Tarran R. Milgram S.L. Boucher R.C. Stutts M.J. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 14120-14125Crossref PubMed Scopus (175) Google Scholar) recently provided functional evidence for such an organized complex including Gαs; adenylate cyclase, PKA, and CFTR are compartmentalized in microdomains in the apical plasma membrane. Such compartmentalization of signaling networks in a multiprotein complex has been shown to result in both the stabilization of constituent proteins at the cell surface and enhanced efficiency of signaling (20Sheng M. Sala C. Annu. Rev. Neurosci. 2001; 24: 1-29Crossref PubMed Scopus (1041) Google Scholar). A common mechanism for establishing multiple protein complexes is via protein-protein interaction with submembrane scaffolding proteins. PSD-95/Dlg/ZO-1 (PDZ) domain proteins localized to the membrane-cytoskeletal interface have emerged as important organizing centers for regulatory complexes, and these scaffold-based regulatory proteins are often polarized to specific sites in polarized epithelial cells (20Sheng M. Sala C. Annu. Rev. Neurosci. 2001; 24: 1-29Crossref PubMed Scopus (1041) Google Scholar, 21Sun F. Hug M.J. Lewarchik C.M. Yun C.H. Bradbury N.A. Frizzell R.A. J. Biol. Chem. 2000; 275: 29539-29546Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar). For example, ERM (ezrin-radixin-moesin)-binding protein (EBP50 or NHERF-1) and its related homolog NHE-3 kinase regulatory proteins (E3KARP or NHERF-2) appear to coordinate specific cAMP-mediated secretory responses (21Sun F. Hug M.J. Lewarchik C.M. Yun C.H. Bradbury N.A. Frizzell R.A. J. Biol. Chem. 2000; 275: 29539-29546Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar). The PDZ interacting motif (S/T)XL at the C terminus of proteins such as β-adrenergic receptor (22Hall R.A. Premont R.T. Chow C.W. Blitzer J.T. Pitcher J.A. Claing A. Stoffel R.H. Barak L.S. Shenolikar S. Weinman E.J. Grinstein S. Lefkowitz R.J. Nature. 1998; 392: 626-630Crossref PubMed Scopus (522) Google Scholar) and CFTR (23Sun F. Hug M.J. Bradbury N.A. Frizzell R.A. J. Biol. Chem. 2000; 275: 14360-14366Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar), binds to NHERF, which in turn interacts with ezrin. Ezrin is known to act as a protein kinase A anchoring protein (21Sun F. Hug M.J. Lewarchik C.M. Yun C.H. Bradbury N.A. Frizzell R.A. J. Biol. Chem. 2000; 275: 29539-29546Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar) in addition to associating with the actin cytoskeleton (reviewed in Ref. 24Bretscher A. Chambers D. Nguyen R. Reczek D. Annu. Rev. Cell Dev. Biol. 2000; 16: 113-143Crossref PubMed Scopus (324) Google Scholar). The interaction between NHERF, ezrin, and PKA has been shown to be critical for the functional response of transporters including CFTR (21Sun F. Hug M.J. Lewarchik C.M. Yun C.H. Bradbury N.A. Frizzell R.A. J. Biol. Chem. 2000; 275: 29539-29546Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar) and NHE-3 (25Yun C.H. Lamprecht G. Forster D.V. Sidor A. J. Biol. Chem. 1998; 273: 25856-26863Abstract Full Text Full Text PDF PubMed Scopus (250) Google Scholar). In this study we examined the association of A2bR at rest and after stimulation with E3KARP, ezrin, and PKA. We show that the A2bR is recruited to the plasma membrane fraction upon stimulation with adenosine. The recruitment of the A2bR to the membrane is paralleled by its interaction with E3KARP and ezrin. Ezrin directly interacts with the A2bR and is activated in response to adenosine stimulation. Taken together, our data suggest that the A2bR, and its signaling complex, exists in the microdomain in the membrane, and adenosine signaling through the A2bR may be mediated by such close interaction and recruitment of the receptor to the membrane. All tissue culture supplies were obtained from Invitrogen. Adenosine and 5′-(N-ethylcarboxamido)adenosine were obtained from Research Biochemicals Int. (Natick, MA). Reagents for SDS-PAGE and nitrocellulose membranes (0.45-μm pores) were from Bio-Rad. Anti-A2bR antibody was obtained from Alpha Diagnostics Inc. (San Antonio, TX), anti-NHERF antibodies were obtained from Dr. Yun (Emory University, GA), and mouse monoclonal anti-CD 73 was a gift from Dr. Thompson (University of Oklahoma). Anti-ezrin antibody was obtained from Sigma; anti-caveolin 1, anti-β1 integrin, and anti-GFP were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Other antibodies include fluorescein isothiocyanate-labeled goat anti-rabbit antibody and horseradish peroxidase-conjugated Ig were obtained from Jackson ImmunoResearch Laboratory (West Grove, PA) andAmersham Biosciences, respectively. T84 cells were grown and maintained in culture as previously described (8Nash S. Parkos C. Nusrat A. Delp C. Madara J.L. J. Clin. Invest. 1991; 87: 1474-1477Crossref PubMed Scopus (60) Google Scholar) in a 1:1 mixture of Dulbecco’s modified Eagle’s medium and Ham’s F-12 medium supplemented with penicillin (40 mg/liter), ampicillin (8 mg/liter), streptomycin (90 mg/liter), and 5% newborn calf serum. Confluent stock monolayers were subcultured by trypsinization. Experiments were done on cells plated for 7–8 days on permeable supports of 0.33 cm2 or 4.5 cm2(inserts). Inserts with rat tail collagen-coated polycarbonate membrane filter (0.4-μm pore size, Costar, Cambridge, MA) rested in wells containing media until steady-state resistance was achieved, as previously described (8Nash S. Parkos C. Nusrat A. Delp C. Madara J.L. J. Clin. Invest. 1991; 87: 1474-1477Crossref PubMed Scopus (60) Google Scholar). This permits apical and basolateral membranes to be separately interfaced with apical and basolateral buffer, a configuration identical to that previously developed for various microassays (8Nash S. Parkos C. Nusrat A. Delp C. Madara J.L. J. Clin. Invest. 1991; 87: 1474-1477Crossref PubMed Scopus (60) Google Scholar). The T84 cells had a high electrical resistance (1200–1500 Ω cm2). All experiments were performed on T84 cells between passages 69 and 83. Caco2-BBE were grown as confluent monolayers in a 1:1 mixture of Dulbecco’s modified Eagle’s medium and Ham’s F-12 medium supplemented with 15 mm HEPES buffer, pH 7.5, 14 mm NaHCO3, and 10% newborn calf serum. Transfected cell lines were maintained in the same media containing 1.2 mg/ml G418. Cell surface biotinylation studies were carried out with confluent monolayers plated on collagen-coated permeable supports. CHO cells (ATCC) were grown in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine calf serum supplemented with penicillin and streptomycin. Full-length A2bR cDNA was cloned into the pEGFP-C vector (CLONTECH) using HindIIIand BamHI restriction enzymes. Point mutation was introduced into the stop codon of the wild-type human A2bR cDNA (sense primer: CGGTGTGGGCCTACTCAGTTAGGCTCTCG and antisense primer: CGAGAGCCTAGACTGAGTAGGCCCACACCG) by site-directed mutagenesis using PCR-mediated overlap extension to facilitate fusion of the cDNA sequence using the QuikChange site-directed mutagenesis kit (Stratagene). The constructed plasmid cDNA sequences were verified by sequencing. Plasmids were purified using the Qiagen Maxiprep kit. Subconfluent Caco2-BBE cells were transfected with A2b-GFP vector using Lipofectin (Invitrogen) for 20 h in serum-free medium. Serum was added for the subsequent 48 h and stable transfectants were selected in medium containing 1.2 mg/ml G418. The 10 clones selected from each construct were maintained in 1.2 mg/ml G418 and were expanded. Clones showing the highest expression were generated by repeated sorting of fluorescent clones using fluorescence-activated cell sorter. PRK vector containing full-length A2bR was a generous gift from R. J. Mrsny (Genentech Inc., San Francisco, CA). Monolayers of T84 or Caco2-BBE cells were washed in HBSS, fixed in buffered formaldehyde for 20 min, incubated with the respective primary antibodies overnight in a humidity chamber, washed with HBSS, and subsequently incubated with fluorsceinated secondary antibodies (Jackson ImmunoResearch). Monolayers were also counterstained with rhodamine/phalloidin to visualize actin. Monolayers, mounted inp-phenylenediamine/glycerol (1:1) were analyzed by confocal microscopy (Zeiss dual laser confocal microscope) as described (18Sitaraman S.V., Si- Tahar M. Merlin D. Strohmeier G.R. Madara J.L. Am. J. Physiol. 2000; 278: C1230-C1236Crossref PubMed Google Scholar). In the case of Caco2-BBE cells transfected with GFP containing vector, monolayers were directly fixed, stained with rhodamine/phalloidin, mounted on glass slides, and analyzed by confocal microscopy. Using actin staining, the apical most surface of the cell was marked as 0 μm and the basolateral surface was marked at the level of actin stress fiber (∼18.7 μm from the top of the cell). xysections taken at ∼1.2 μm from the top (above the level of tight junction) and at the level of actin stress fiber was used for quantitation of apical and basolateral surfaces, respectively. Cells were lysed with phosphate-buffered saline containing 1% Triton X-100 and 1% Nonidet P-40 (v/v), protease inhibitor mixture (Roche Molecular Biochemicals), EDTA, SDS, sodium orthovanadate, and sodium fluoride. SDS-PAGE was performed according to the Laemmli procedure using a 10% acrylamide gel. Proteins were electrotransferred to nitrocellulose membranes and probed with primary antibody (diluted 1:1000). Then membranes were incubated with corresponding peroxidase-linked secondary antibody diluted 1:2000, washed, and subsequently incubated with ECL reagents (Amersham Biosciences) before exposure to high performance chemiluminescence films (Amersham Biosciences). ForMr determination, polyacrylamide gels were calibrated using standard proteins (Bio-Rad) with Mrmarkers within the range 7,700 to 214,000. Apical or basolateral sides of the filter-grown monolayers were biotinylated using sulfosuccinimidyl-biotin (s-NHS-biotin, Pierce, Rockford, IL) as previously described (26Merlin D., Si- Tahar M. Sitaraman S.V. Eastburn K. Williams I. Liu X. Hediger M.A. Madara J.L. Gastroenterology. 2001; 120: 1666-1679Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). The cell lysate was then incubated with streptavidin-agarose (Pierce) to bind biotinylated proteins. Proteins were separated by SDS-PAGE and Western blotting was done as described previously (26Merlin D., Si- Tahar M. Sitaraman S.V. Eastburn K. Williams I. Liu X. Hediger M.A. Madara J.L. Gastroenterology. 2001; 120: 1666-1679Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar) Cell fractionation to isolate pure plasma membrane and caveolae was done as described (27Smart E.J. Ying Y.S. Mineo C. Anderson R.G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10104-10108Crossref PubMed Scopus (676) Google Scholar) using a detergent-free method. Briefly, confluent T84 monolayers grown in 45-cm2 inserts were washed with HBSS, equilibrated for 20 min at 37 °C, and stimulated with apical or basolateral adenosine (100 μm). A plasma membrane fraction was prepared from two 4.5-cm2 inserts/condition. The plasma membrane fraction obtained by this method, as previously shown, was not contaminated with cytoplasm or membranes from other compartments. This approach was chosen because the detergent solubility of some proteins such as the subunit of heterotrimeric G-proteins or certain G protein-coupled receptors is well established. Caveolae were purified from the plasma membrane fraction using Opti-Prep gradient (27Smart E.J. Ying Y.S. Mineo C. Anderson R.G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10104-10108Crossref PubMed Scopus (676) Google Scholar). Adherent monolayers were detached with EDTA in HBSS (without Ca2+ or Mg2+), pelleted by centrifugation, and re-suspended in HBSS containing 1% bovine serum albumin. Cells transfected with GFP-tagged A2bR were directly analyzed with FAC-Sort flow cytometer apparatus (BD PharMingen) as described (28Merlin D. Sitaraman S. Liu X. Eastburn K. Sun J. Kucharzik T. Lewis B. Madara J.L. J. Biol. Chem. 2001; 276: 39282-39289Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Measurements of cAMP were performed on ethanol extracts of cells obtained from monolayers grown on permeable supports, using the radioimmunoassay kit as described by the supplier (PerkinElmer Life Sciences). Briefly, after monolayers were washed with HBSS and incubated 10 min, baseline Isc readings were taken and then adenosine was added. Cells were lysed in the extract buffer (66% ethanol, 33% HBSS, 1 mmphosphodiesterase inhibitor 3-isobutyl-1-methylxanthine). Monolayers were compacted, centrifuged, and an aliquot (100 μl) was used for radioimmunoassay (10Strohmeier G.R. Reppert S.M. Lencer W.I. Madara J.L. J. Biol. Chem. 1995; 270: 2387-2394Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). The band intensity of Western blot was quantitated using a gel documentation system (Alpha Innotech Co., San Leandro, CA). Quantitation of confocal images were performed on unprocessed images using the Metamorph Imaging System software (Universal Imaging Corp., West Chester, PA) as described (29Volpicelli L.A. Lah J.J. Levey A.I. J. Biol. Chem. 2001; 276: 47590-47598Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). The average grayscale pixel intensity +1 S.D. of a small region was measured and defined as background. To subtract background, the threshold of each channel was set at the value obtained for background. The average pixel intensity +1 S.D. was measured for the threshold images. The data are presented as the mean ± S.D. Statistical analysis was performed using unpaired Student’st test. p value < 0.05 was considered statistically significant. We first characterized the commercially available antibody to the second extracellular loop of the A2bR. T84 cells, which we have shown previously express the A2bR, exhibited an immunoreactive band at 42–44 kDa (Fig. 1, lane 2). In addition, membrane fractions from HEK 293 cells overexpressing A2bR also showed a similar immunoreactive band at 42–44 kDa (Fig. 1,lane 1). The immunoreactive band was competed by peptide used to raise the antibody (data not shown). CHO cells, which lack expression of A2bR mRNA and cAMP response to agonist stimulation, showed no immunoreactivity at 42–44 kDa (Fig. 1, lane 4) and as seen in lane 3, CHO cells transfected with full-length A2bR showed an immunoreactive band at 42–44 kDa similar to that seen in T84 cells and HEK 293 cells. These data demonstrate that the antibody specifically recognizes the 42–44-kDa A2bR. We next examined the polarity of the A2bR. Using cell surface biotinylation, we show that the A2bR is present at both the apical and basolateral membranes of the model intestinal epithelial cells. However, as shown in Fig. 2A, the A2bR expression is significantly higher at the basolateral membrane compared with the apical membrane (apical:basolateral ratio, 1:3.1 ± 0.9, mean ± S.D., n = 6, p < 0.001). CD 73, an apically expressed protein (11Strohmeier G.R. Lencer W.I. Thompson L.F. Carlson S.L. Moe S.J. Carnes D.K. Mrsny R.J. Madara J.L. J. Clin. Invest. 1997; 99: 2588-2601Crossref PubMed Scopus (144) Google Scholar), showed an apical:basolateral ratio of 5 ± 0.9:1 (mean ± S.D.,n = 3, p < 0.01), whereas β1 integrin, a basolaterally expressed protein (30McCormick B.A. Nusrat A. Parkos C.A. D'Andrea L. Hofman P.M. Carnes D. Liang T.W. Madara J.L. Infect. Immun. 1997; 65: 1414-1421Crossref PubMed Google Scholar) showed an apical:basoateral ratio of 1:7 ± 0.5 (relative band density mean ± S.D., n = 3, p < 0.001) (Fig. 2B). Next we examined the distribution of A2bR using confocal microscopy (Fig. 3). Consistent with our data on cell surface biotinylation, the A2bR is expressed both at the apical and basolateral surface of T84 cells (Fig.3A). The en face (xy plane) images of the T84 epithelia were taken at the apical and basolateral membranes. To quantitate the cell surface expression of A2bR, the pixel intensity of the confocal images taken at the apical and basolateral surfaces were measured as described under “Materials Methods.” As seen in Fig. 3B, the ratio of pixel intensity of apical:basolateral A2b receptor was 1:1.7 ± 0.2 (relative units mean ± S.D.,n = 8, p < 0.001) compared with the CD 73 and β1 integrin apical:basolateral ratio of 5 ± 0.2:1 and 1:3 ± 0.3, respectively (relative units, mean ± S.D., n = 3, p < 0.01).Figure 3Confocal microscopy of A2bR.A, monolayers were fixed and stained with anti-A2b antibody followed by fluoroscein isothiocyanate-conjugated secondary antibody (A2bR , anti-CD 73, or anti-β1integrin; green). Monolayers were also stained with rhodamine/phalloidin (actin, red). Vertical sections (xz) were taken off the monolayers to define the top (set at 0 μm) and bottom of the monolayer. En facesections (xy) were then generated from apical and basolateral planes in the vertical section. Shown here are en face (xy) images taken at the level of apical (at 1.2 μm, above the level of tight junction) and basolateral (at 18.7 μm, level of stress fiber) pole of the epithelial monolayer and computer reconstructed vertical section (xz) images taken through full thickness of the monolayer. B, the pixel intensity frompanel A was quantitated as described under “Materials and Methods.” The bar graphs represent the relative pixel intensity apical (A) versus basolateral (B) membrane, mean ± S.D.; *, p < 0.001; **, p < 0.01.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Based on its cDNA sequence, A2bR is predicted to have a molecular mass of 36 kDa. However, our data suggest that the A2bR in T84 cells is 42–44 kDa. To verify the molecular mass of the A2bR in intestinal epithelial cells we stably transfected the intestinal cell line, Caco2-BBE, with GFP-tagged A2bR. As shown in Fig.4A, GFP-A2b-transfected Caco2-BBE cells show a shift in fluorescence compared with untransfected cells demonstrating a high level of fusion-protein expression. We then used an anti-GFP antibody to immunoprecipitate the GFP-A2bR fusion protein from whole cell lysates and detected the A2bR on a Western blot using anti-A2bR antibodies. As seen in Fig.4B, transfected cells exhibit a ∼68–70-kDa band corresponding to the GFP-A2bR fusion protein. This band was not present in the wild-type Caco2-BBE cells or in cells transfected with GFP vector alone (lanes 1 and 2, respectively). The GFP-A2b fusion protein expression was enhanced after the second and third round of fluorescence-activated cell sorting of fluorescent clones (lanes 3 and 4, respectively). We next determined the steady-state distribution of GFP-A2bR fusion protein expression using cell surface biotinylation. Similar to the T84 cells, the A2bR was present at both the apical and basolateral surface but predominant at the basolateral surface (apical to basolateral ratio of 1:6 ± 0.5, relative units from a densitometric scan, mean ± S.D., n = 3, p < 0.003) (Fig.4C). CD 73, an apically expressed protein in Caco2-BBE cells (11Strohmeier G.R. Lencer W.I. Thompson L.F. Carlson S.L. Moe S.J. Carnes D.K. Mrsny R.J. Madara J.L. J. Clin. Invest. 1997; 99: 2588-2601Crossref PubMed Scopus (144) Google Scholar, 31Ellis J.A. Jackman M.R. Luzio J.P. Biochem. J. 1992; 283: 553-560Crossref PubMed Scopus (21) Google Scholar), showed an apical:basolateral ratio of 5 ± 0.9:1, whereas β1 integrin (30McCormick B.A. Nusrat A. Parkos C.A. D'Andrea L. Hofman P.M. Carnes D. Liang T.W. Madara J.L. Infect. Immun. 1997; 65: 1414-1421Crossref PubMed Google Scholar) showed an apical:basoateral ratio of 1:6 ± 0.3 (relative units from densitometric scan, mean ± S.D., n = 3, p < 0.01 andp < 0.001, respectively, data not shown). Confocal images of transfected Caco2-BBE cells also show the expression of the A2bR at the apical and basolateral surface (Fig. 4D). To quantitate the cell surface expression of GFP-A2bR, the pixel intensity of the confocal images taken at the apical and basolateral surfaces were measured. The ratio of pixel intensity of apical:basolateral A2b receptor was 1:3 ± 0.5 (relative pixel units, mean ± S.D.,n = 3, p < 0.01). CD 73 and β1 integrin showed an apical:basolateral ratio of 4.6 ± 0.6:1 and 1:3.8 ± 0.2, respectively (relative pixel units, mean ± S.D., n = 3, p < 0.005 and p < 0.001, respectively, data not shown). To determine whether the GFP-A2bR fusion protein was functional, the cells were stimulated with adenosine and intracellular cAMP was measured 5 min after stimulation. Apical or basolateral stimulation of GFP-A2bR-transfected cells with adenosine induced an 8-fold increase in cAMP compared with cells transfected with vector alone (Fig.4E). These data demonstrate that Caco2-BBE cells transfected with GFP-tagged A2bR has a similar molecular mass as the endogenous A2bR in T84 cells. Having established the specificity of the antibody to the native receptor in T84 cells, we next studied the effect of agonist stimulation on the distribution of A2bR. Since Caco2-BBE cells are known to possess more than one type of adenosine receptor, T84 cells in which A2bR is the only adenosine receptor present were used to further characterize the A2bR. As seen in Fig. 5, there was a small amount of A2bR detected in the plasma membrane fraction in resting cells and the bulk of the receptor was present in the postnuclear supernatant. In contrast, receptor density was significantly increased in the plasma membrane 5 min after apical or basolater" @default.
• W1991034359 created "2016-06-24" @default.
• W1991034359 creator A5009268385 @default.
• W1991034359 creator A5012188262 @default.
• W1991034359 creator A5023229653 @default.
• W1991034359 creator A5026735416 @default.
• W1991034359 creator A5054398705 @default.
• W1991034359 creator A5079796884 @default.
• W1991034359 creator A5086215160 @default.
• W1991034359 creator A5091113051 @default.
• W1991034359 date "2002-09-01" @default.
• W1991034359 modified "2023-09-29" @default.
• W1991034359 title "The Adenosine 2b Receptor Is Recruited to the Plasma Membrane and Associates with E3KARP and Ezrin upon Agonist Stimulation" @default.
• W1991034359 cites W1483932465 @default.
• W1991034359 cites W1972691680 @default.
• W1991034359 cites W2002978565 @default.
• W1991034359 cites W2014507223 @default.
• W1991034359 cites W2022992564 @default.
• W1991034359 cites W2023681929 @default.
• W1991034359 cites W2028799706 @default.
• W1991034359 cites W2032190558 @default.
• W1991034359 cites W2033335450 @default.
• W1991034359 cites W2033782232 @default.
• W1991034359 cites W2035600812 @default.
• W1991034359 cites W2039589874 @default.
• W1991034359 cites W2044695265 @default.
• W1991034359 cites W2057237395 @default.
• W1991034359 cites W2080123385 @default.
• W1991034359 cites W2091962928 @default.
• W1991034359 cites W2092087879 @default.
• W1991034359 cites W2095560794 @default.
• W1991034359 cites W2101535048 @default.
• W1991034359 cites W2105006060 @default.
• W1991034359 cites W2107832423 @default.
• W1991034359 cites W2107889592 @default.
• W1991034359 cites W2112998606 @default.
• W1991034359 cites W2114174960 @default.
• W1991034359 cites W2133817647 @default.
• W1991034359 cites W2143208653 @default.
• W1991034359 cites W2147469756 @default.
• W1991034359 cites W2173637498 @default.
• W1991034359 cites W2188445161 @default.
• W1991034359 cites W2205864322 @default.
• W1991034359 cites W2416053501 @default.
• W1991034359 cites W2437213803 @default.
• W1991034359 cites W4236341500 @default.
• W1991034359 cites W55735123 @default.
• W1991034359 doi "https://doi.org/10.1074/jbc.m202522200" @default.
• W1991034359 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12080047" @default.
• W1991034359 hasPublicationYear "2002" @default.
• W1991034359 type Work @default.
• W1991034359 sameAs 1991034359 @default.
• W1991034359 citedByCount "90" @default.
• W1991034359 countsByYear W19910343592012 @default.
• W1991034359 countsByYear W19910343592013 @default.
• W1991034359 countsByYear W19910343592014 @default.
• W1991034359 countsByYear W19910343592015 @default.
• W1991034359 countsByYear W19910343592016 @default.
• W1991034359 countsByYear W19910343592017 @default.
• W1991034359 countsByYear W19910343592018 @default.
• W1991034359 countsByYear W19910343592019 @default.
• W1991034359 countsByYear W19910343592020 @default.
• W1991034359 countsByYear W19910343592021 @default.
• W1991034359 countsByYear W19910343592022 @default.
• W1991034359 countsByYear W19910343592023 @default.
• W1991034359 crossrefType "journal-article" @default.
• W1991034359 hasAuthorship W1991034359A5009268385 @default.
• W1991034359 hasAuthorship W1991034359A5012188262 @default.
• W1991034359 hasAuthorship W1991034359A5023229653 @default.
• W1991034359 hasAuthorship W1991034359A5026735416 @default.
• W1991034359 hasAuthorship W1991034359A5054398705 @default.
• W1991034359 hasAuthorship W1991034359A5079796884 @default.
• W1991034359 hasAuthorship W1991034359A5086215160 @default.
• W1991034359 hasAuthorship W1991034359A5091113051 @default.
• W1991034359 hasBestOaLocation W19910343591 @default.
• W1991034359 hasConcept C126322002 @default.
• W1991034359 hasConcept C134018914 @default.
• W1991034359 hasConcept C142669718 @default.
• W1991034359 hasConcept C1491633281 @default.
• W1991034359 hasConcept C170493617 @default.
• W1991034359 hasConcept C182683403 @default.
• W1991034359 hasConcept C185592680 @default.
• W1991034359 hasConcept C24998067 @default.
• W1991034359 hasConcept C2776991684 @default.
• W1991034359 hasConcept C2778938600 @default.
• W1991034359 hasConcept C2780246058 @default.
• W1991034359 hasConcept C41625074 @default.
• W1991034359 hasConcept C55493867 @default.
• W1991034359 hasConcept C67907053 @default.
• W1991034359 hasConcept C71924100 @default.
• W1991034359 hasConcept C86803240 @default.
• W1991034359 hasConcept C95444343 @default.
• W1991034359 hasConcept C98274493 @default.
• W1991034359 hasConceptScore W1991034359C126322002 @default.
• W1991034359 hasConceptScore W1991034359C134018914 @default.
• W1991034359 hasConceptScore W1991034359C142669718 @default.
• W1991034359 hasConceptScore W1991034359C1491633281 @default.
• W1991034359 hasConceptScore W1991034359C170493617 @default.

• next