FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1991521210> ?p ?o ?g. }

• W1991521210 endingPage "896" @default.
• W1991521210 startingPage "884" @default.
• W1991521210 abstract "Corticosteroid-binding globulin (CBG) is a non-inhibitory serine proteinase inhibitor (serpin) that transports cortisol and progesterone in blood. Crystal structures of rat CBG and a thrombin-cleaved human CBG:anti-trypsin (Pittsburgh) chimera show how structural transitions after proteolytic cleavage of the CBG reactive center loop (RCL) could disrupt steroid binding. This ligand release mechanism is assumed to involve insertion of the cleaved RCL into the β-sheet A of the serpin structure. We have, therefore, examined how amino acid substitutions in the human CBG RCL influence steroid binding before and after its cleavage by neutrophil elastase. Elastase-cleaved wild-type CBG or variants with substitutions at P15 and/or P16 (E334G/G335N or E334A) lost steroid binding completely, whereas deletion of Glu-334 resulted in no loss of steroid binding after RCL cleavage, presumably because this prevents its insertion into β-sheet A. Similarly, the steroid binding properties of CBG variants with substitutions at P15 (G335P), P14 (V336R), or P12 (T338P) in the RCL hinge were largely unaffected after elastase cleavage, most likely because the re-orientation and/or insertion of the cleaved RCL was blocked. Substitutions at P10 (G340P, G340S) or P8 (T342P, T342N) resulted in a partial loss of steroid binding after proteolysis which we attribute to incomplete insertion of the cleaved RCL. Remarkably, several substitutions (E334A, V336R, G340S, and T342P) increased the steroid binding affinities of human CBG even before elastase cleavage, consistent with the concept that CBG normally toggles between a high affinity ligand binding state where the RCL is fully exposed and a lower affinity state in which the RCL is partly inserted into β-sheet A. Corticosteroid-binding globulin (CBG) is a non-inhibitory serine proteinase inhibitor (serpin) that transports cortisol and progesterone in blood. Crystal structures of rat CBG and a thrombin-cleaved human CBG:anti-trypsin (Pittsburgh) chimera show how structural transitions after proteolytic cleavage of the CBG reactive center loop (RCL) could disrupt steroid binding. This ligand release mechanism is assumed to involve insertion of the cleaved RCL into the β-sheet A of the serpin structure. We have, therefore, examined how amino acid substitutions in the human CBG RCL influence steroid binding before and after its cleavage by neutrophil elastase. Elastase-cleaved wild-type CBG or variants with substitutions at P15 and/or P16 (E334G/G335N or E334A) lost steroid binding completely, whereas deletion of Glu-334 resulted in no loss of steroid binding after RCL cleavage, presumably because this prevents its insertion into β-sheet A. Similarly, the steroid binding properties of CBG variants with substitutions at P15 (G335P), P14 (V336R), or P12 (T338P) in the RCL hinge were largely unaffected after elastase cleavage, most likely because the re-orientation and/or insertion of the cleaved RCL was blocked. Substitutions at P10 (G340P, G340S) or P8 (T342P, T342N) resulted in a partial loss of steroid binding after proteolysis which we attribute to incomplete insertion of the cleaved RCL. Remarkably, several substitutions (E334A, V336R, G340S, and T342P) increased the steroid binding affinities of human CBG even before elastase cleavage, consistent with the concept that CBG normally toggles between a high affinity ligand binding state where the RCL is fully exposed and a lower affinity state in which the RCL is partly inserted into β-sheet A. Corticosteroid-binding globulin (CBG) 2The abbreviations used are: CBG, corticosteroid-binding globulin; AAT, α1-anti-trypsin; DCC, dextran-coated charcoal; RCL, reactive center loop; S→R, stressed to relaxed.2The abbreviations used are: CBG, corticosteroid-binding globulin; AAT, α1-anti-trypsin; DCC, dextran-coated charcoal; RCL, reactive center loop; S→R, stressed to relaxed. is the major carrier protein for natural glucocorticoids (cortisol and corticosterone) and progesterone in blood (1Hammond G.L. Endocr. Rev. 1990; 11: 65-79Crossref PubMed Scopus (263) Google Scholar), and it regulates the bioavailability of steroids that control numerous physiological processes including reproduction, inflammation, stress responses, and tissue development (2Hammond G.L. Obstet. Gynecol. Clin. North Am. 2002; 29: 411-423Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Because CBG binds up to 90% of the glucocorticoids in blood plasma, it serves as a reservoir of anti-inflammatory steroids that can be released at their sites of action (3Breuner C.W. Orchinik M. J. Endocrinol. 2002; 175: 99-112Crossref PubMed Scopus (357) Google Scholar). The latter concept was proposed when it was discovered that human CBG exhibits remarkable sequence identity with the archetypal serine proteinase inhibitor, α1-anti-trypsin (AAT), and was based on the realization that CBG might also be a target of specific classes of proteinases (4Hammond G.L. Smith C.L. Goping I.S. Underhill D.A. Harley M.J. Reventos J. Musto N.A. Gunsalus G.L. Bardin C.W. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 5153-5157Crossref PubMed Scopus (233) Google Scholar). The close structural relationship between CBG and AAT defines it as a clade A serine proteinase inhibitor (serpin) family member (5Law R.H. Zhang Q. McGowan S. Buckle A.M. Silverman G.A. Wong W. Rosado C.J. Langendorf C.G. Pike R.N. Bird P.I. Whisstock J.C. Genome Biology. 2006; 7: 216Crossref PubMed Scopus (475) Google Scholar). Many of these serpin A family members, including CBG, are encoded by genes in the human 14q21.1 chromosome cluster and are thought to have arisen by gene duplication to produce serpins with similar properties and physiological functions (6Gettins P.G. Chem. Rev. 2002; 102: 4751-4804Crossref PubMed Scopus (983) Google Scholar). Unlike most clade A serpins, CBG is not known to act as a proteinase inhibitor but appears to be a suicide substrate of specific proteinases and is particularly sensitive to attack by neutrophil elastase, the activity of which is normally controlled by AAT (7Hammond G.L. Smith C.L. Underhill D.A. J. Steroid Biochem. Mol. Biol. 1991; 40: 755-762Crossref PubMed Scopus (108) Google Scholar). Structurally, serpins are defined by a single core domain of three β-sheets (termed A, B, and C) and 8–9 α-helices (termed hA-hI) (6Gettins P.G. Chem. Rev. 2002; 102: 4751-4804Crossref PubMed Scopus (983) Google Scholar). For inhibitory serpins in the native state, a reactive center loop (RCL) is fully exposed for target proteinases to recognize and interact. Upon cleavage by proteinase, the RCL is inserted into β-sheet A to form a novel β-strand (s4A), which results in a profound “stressed to relaxed” (S→R) conformational transition (8Irving J.A. Pike R.N. Lesk A.M. Whisstock J.C. Genome Res. 2000; 10: 1845-1864Crossref PubMed Scopus (507) Google Scholar). The S→R transition is associated with an increase in thermostability and is crucial for the inhibitory mechanism that yields the serpin-proteinase complex. Intriguingly, the RCLs are perhaps the most poorly conserved regions of individual serpins with the same function (6Gettins P.G. Chem. Rev. 2002; 102: 4751-4804Crossref PubMed Scopus (983) Google Scholar), and the reasons for this are not fully understood. It has been proposed that the serpin structure has been adapted by CBG and the closely related thyroxin-binding globulin to control hormone release at their sites of action after the RCL is cleaved by proteinases (9Pemberton P.A. Stein P.E. Pepys M.B. Potter J.M. Carrell R.W. Nature. 1988; 336: 257-258Crossref PubMed Scopus (335) Google Scholar, 10Hammond G.L. Smith C.L. Paterson N.A. Sibbald W.J. J. Clin. Endocrinol. Metab. 1990; 71: 34-39Crossref PubMed Scopus (220) Google Scholar, 11Janssen O.E. Golcher H.M. Grasberger H. Saller B. Mann K. Refetoff S. J. Clin. Endocrinol. Metab. 2002; 87: 1217-1222Crossref PubMed Scopus (25) Google Scholar, 12Jirasakuldech B. Schussler G.C. Yap M.G. Drew H. Josephson A. Michl J. J. Clin. Endocrinol. Metab. 2000; 85: 3996-3999Crossref PubMed Scopus (50) Google Scholar). This is based on evidence that the S→R conformational transition of CBG is accompanied by a marked increase in thermostability (9Pemberton P.A. Stein P.E. Pepys M.B. Potter J.M. Carrell R.W. Nature. 1988; 336: 257-258Crossref PubMed Scopus (335) Google Scholar) and decrease in steroid binding affinity (9Pemberton P.A. Stein P.E. Pepys M.B. Potter J.M. Carrell R.W. Nature. 1988; 336: 257-258Crossref PubMed Scopus (335) Google Scholar, 10Hammond G.L. Smith C.L. Paterson N.A. Sibbald W.J. J. Clin. Endocrinol. Metab. 1990; 71: 34-39Crossref PubMed Scopus (220) Google Scholar) after cleavage by neutrophil elastase. Recently we showed the 1.9 Å crystal structure of cortisol-bound rat CBG displays a typical native serpin conformation, with the RCL fully exposed from the β-sheet A (13Klieber M.A. Underhill C. Hammond G.L. Muller Y.A. J. Biol. Chem. 2007; 282: 29594-29603Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). The crystal structure of a thrombin-cleaved human CBG-AAT chimera has since been reported in which the RCL of human CBG was replaced with an AAT (Pittsburg) variant sequence (14Zhou A. Wei Z. Stanley P.L. Read R.J. Stein P.E. Carrell R.W. J. Mol. Biol. 2008; 380: 244-251Crossref PubMed Scopus (58) Google Scholar), presumably to facilitate cleavage by thrombin. In this structure the cleaved AAT RCL was fully incorporated into the β-sheet A of CBG, and soaking the crystals in cortisol led to the surprising observation that the cortisol-binding site of the cleaved CBG-AAT chimera adopts a configuration that resembles that of native CBG (14Zhou A. Wei Z. Stanley P.L. Read R.J. Stein P.E. Carrell R.W. J. Mol. Biol. 2008; 380: 244-251Crossref PubMed Scopus (58) Google Scholar). However, elastase cleavage of CBG results in an irreversible loss of steroid binding that cannot be restored by adding an excess of steroid ligand (9Pemberton P.A. Stein P.E. Pepys M.B. Potter J.M. Carrell R.W. Nature. 1988; 336: 257-258Crossref PubMed Scopus (335) Google Scholar, 10Hammond G.L. Smith C.L. Paterson N.A. Sibbald W.J. J. Clin. Endocrinol. Metab. 1990; 71: 34-39Crossref PubMed Scopus (220) Google Scholar), and crystal packing effects and high ligand soaking concentrations might have allowed the binding of cortisol with low affinity to the cleaved CBG-AAT chimera. Moreover, the effect of replacing the CBG RCL with the corresponding AAT (Pittsburgh) sequence may itself have influenced steroid binding because previous studies have indicated that human thyroxin-binding globulin-AAT chimeras containing various AAT RCL sequences have either increased or reduced ligand binding affinities (15Grasberger H. Golcher H.M. Fingerhut A. Janssen O.E. Biochem. J. 2002; 365: 311-316Crossref PubMed Google Scholar). It should also be noted that the proteolytic cleavage site (P1-P1′) in human AAT (16Whisstock J.C. Skinner R. Carrell R.W. Lesk A.M. J. Mol. Biol. 2000; 296: 685-699Crossref PubMed Scopus (59) Google Scholar) differs in location to that in human CBG, i.e. Val-344—Thr-345, which correspond to the P6 and P5 residues in the AAT RCL (9Pemberton P.A. Stein P.E. Pepys M.B. Potter J.M. Carrell R.W. Nature. 1988; 336: 257-258Crossref PubMed Scopus (335) Google Scholar). In other words, the cleaved RCL of human CBG is five residues shorter than that of AAT or the AAT (Pittsburgh) variant, and thus, the composition and length of the cleaved RCL in the thrombin-cleaved human CBG-AAT chimera structure (14Zhou A. Wei Z. Stanley P.L. Read R.J. Stein P.E. Carrell R.W. J. Mol. Biol. 2008; 380: 244-251Crossref PubMed Scopus (58) Google Scholar) are likely quite different from those in normal human CBG. Analyses of the human CBG-AAT chimera structure (14Zhou A. Wei Z. Stanley P.L. Read R.J. Stein P.E. Carrell R.W. J. Mol. Biol. 2008; 380: 244-251Crossref PubMed Scopus (58) Google Scholar) also led to the conclusion that a flip-flop movement of the intact RCL into and out of β-sheet A allows the equilibrated release of cortisol, but direct evidence for this is lacking. To address the issue in a different way, we have substituted specific residues within the RCL of human CBG and determined how this influences its proteolytic cleavage by neutrophil elastase in relation to its cortisol binding properties. This has not only enabled us to identify key residues within the RCL that control the S→R transition of CBG, which results in hormone release, but has provided evidence that partial insertion of the intact RCL within the human CBG β-sheet A exerts an allosteric effect on its cortisol binding activity. Cell Culture—Chinese hamster ovary cells were maintained in α-minimum essential medium (Invitrogen) containing 10% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin at 37 °C with 5% CO2. Human CBG Constructs and Site-directed Mutagenesis—A full-length cDNA encoding the human CBG precursor (4Hammond G.L. Smith C.L. Goping I.S. Underhill D.A. Harley M.J. Reventos J. Musto N.A. Gunsalus G.L. Bardin C.W. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 5153-5157Crossref PubMed Scopus (233) Google Scholar, 17Avvakumov G.V. Warmels-Rodenhiser S. Hammond G.L. J. Biol. Chem. 1993; 268: 862-866Abstract Full Text PDF PubMed Google Scholar) was subcloned into a HindIII/XbaI-digested eukaryotic expression vector pRc/CMV (Invitrogen). All mutations were performed on the wild-type human CBG expression vector template with the QuikChange II XL site-directed mutagenesis kit (Stratagene, Inc., La Jolla, CA) according to the manufacturer's instructions. The forward and reverse primers used for mutagenesis are summarized in Table 1. All constructs were sequenced to confirm that only the targeted mutations had occurred.TABLE 1Primer sequences used for site-directed mutagenesisMutationPositionPrimers (5′-3′)E334delP16Forward: GCTGCAACTCAATGAGGGTGTGGACACAGCTGGReverse: CCAGCTGTGTCCACACCCTCATTGAGTTGCAGCE334AP16Forward: GCTGCAACTCAATGAGGCGGGTGTGGACACAGCReverse: GCTGTGTCCACACCCGCCTCATTGAGTTGCAGCG335PP15Forward: GCAACTCAATGAGGAGCCTGTGGACACAGCTGGCReverse: GCCAGCTGTGTCCACAGGCTCCTCATTGAGTTGCE334G/G335NP16+P15Forward: GCTGCAACTCAATGAGGGGAATGTGGACACAGCTGGCReverse: GCCAGCTGTGTCCACATTCCCCTCATTGAGTTGCAGCV336RP14Forward: CTCAATGAGGAGGGTCGGGACACAGCTGGCTCCReverse: GGAGCCAGCTGTGTCCCGACCCTCCTCATTGAGT338P/A339NP12+P11Forward: GAGGAGGGTGTGGACCCAAATGGCTCCACTGGGGTCReverse: GACCCCAGTGGAGCCATTTGGGTCCACACCCTCCTCT338PP12Forward: GAGGAGGGTGTGGACCCAGCTGGCTCCACTGGReverse: CCAGTGGAGCCAGCTGGGTCCACACCCTCCTCG340PP10Forward: GGTGTGGACACAGCTCCCTCCACTGGGGTCACCReverse: GGTGACCCCAGTGGAGGGAGCTGTGTCCACACCG340SP10Forward: GGTGTGGACACAGCTAGCTCCACTGGGGTCACCReverse: GGTGACCCCAGTGGAGCTAGCTGTGTCCACACCT342PP8Forward: GGACACAGCTGGCTCCCCTGGGGTCACCCTAAACCReverse: GGTTTAGGGTGACCCCAGGGGAGCCAGCTGTGTCCT342NP8Forward: GTGGACACAGCTGGCTCCAATGGGGTCACCCTAAACCTGReverse: CAGGTTTAGGGTGACCCCATTGGAGCCAGCTGTGTCCAC Open table in a new tab Expression of Wild-type and Variant Human CBGs—To establish cell lines expressing wild-type or variant human CBGs, Chinese hamster ovary cells were cultured at 60% confluence in 6-well dishes and then transfected with 2 μg of expression plasmids using Lipofectamine2000 (Invitrogen) as suggested by the manufacturer. One day later, cells were sub-cultured at a dilution of 1:10 and selected in the presence of 1.5 mg/ml neomycin (Invitrogen) for 1 week. Stably transfected Chinese hamster ovary cells were then grown to near confluence. After washing twice with phosphate-buffered saline, the cells were cultured for 4 days in phenol red-free, high glucose Dulbecco's modified Eagle's medium (Invitrogen) containing 100 nm cortisol. The culture media were collected, dialyzed in a buffer containing 20 mm Tris (pH 8.0) and 100 nm cortisol at 4 °C overnight, and subjected to ion exchange chromatography on a Mono Q fast protein liquid chromatography column (GE Healthcare) to semi-purify the recombinant CBGs for functional analysis. Elastase Digestion—Human neutrophil elastase (Elastin Products Co., Inc., Owensville, MO) was reconstituted in 0.05 m NaAc (pH 5.0) and 0.1 m NaCl. Unless otherwise stated, elastase digestions were performed with 1 μg of semi-purified CBGs and 0.05 μg of elastase for 5 min at 37 °C, as described previously (10Hammond G.L. Smith C.L. Paterson N.A. Sibbald W.J. J. Clin. Endocrinol. Metab. 1990; 71: 34-39Crossref PubMed Scopus (220) Google Scholar). Reaction products were analyzed by Western blotting after reduction by boiling in the presence of 0.1 m β-mercaptoethanol and 1% SDS. Human neutrophil elastase typically cleaves human CBG in a single location and reduces its apparent molecular mass by 5 kDa, which can be resolved by 10% SDS-PAGE, as described previously (10Hammond G.L. Smith C.L. Paterson N.A. Sibbald W.J. J. Clin. Endocrinol. Metab. 1990; 71: 34-39Crossref PubMed Scopus (220) Google Scholar). Western Blot Analysis—Proteins were resolved by SDS-PAGE (5% stacking and 10% separating gels) and transferred to a nitrocellulose membrane. After incubation with blocking buffer (5% fat-free milk in phosphate-buffered saline containing 0.1% Tween 20), blots were incubated with rabbit anti-human CBG anti-serum at a 1:1000 dilution (18Robinson P.A. Langley M.S. Hammond G.L. J. Endocrinol. 1985; 104: 259-267Crossref PubMed Scopus (42) Google Scholar). Immunoreactive proteins were further detected with a horseradish peroxidase-labeled goat anti-rabbit IgG (Sigma-Aldrich) and chemiluminescent substrates (Pierce) by exposure to x-ray film. Steroid Binding Analyses—[1,2-3H]Cortisol (55 Ci/mmol) was purchased from PerkinElmer Life Sciences. Unlabeled steroids were purchased from Sigma-Aldrich. The steroid binding capacities of equivalent amounts of immuno-reactive CBGs, determined by Western blotting, were then assayed by a routine saturation analysis employing [3H]cortisol as the labeled ligand and dextran-coated charcoal (DCC) as a separation agent (19Hammond G.L. Lahteenmaki P.L. Clin. Chim. Acta. 1983; 132: 101-110Crossref PubMed Scopus (200) Google Scholar). To compare the steroid binding capacities of CBG before and after elastase cleavage, purified protein was first stripped of endogenous steroid by incubation with DCC for 30 min at room temperature and then saturated with an excess of [3H]cortisol for 1 h at room temperature. Half of the [3H]cortisol-saturated proteins were then subjected to elastase cleavage, as described above, whereas the remainder was held under the same conditions without the addition of elastase. Aliquots of cleaved and uncleaved CBG-[3H]cortisol complexes were subjected to Western blot analysis, and the rest was rapidly chilled and used to measure the amount of bound [3H]cortisol in samples after absorption of free steroid with DCC for 10 min at 0 °C (19Hammond G.L. Lahteenmaki P.L. Clin. Chim. Acta. 1983; 132: 101-110Crossref PubMed Scopus (200) Google Scholar). The apparent dissociation rates of CBG-bound [3H]cortisol were also assessed by the exposure of the cleaved or non-treated [3H]cortisol-saturated sample to DCC for different time intervals at 0 °C (19Hammond G.L. Lahteenmaki P.L. Clin. Chim. Acta. 1983; 132: 101-110Crossref PubMed Scopus (200) Google Scholar). In addition, equilibrium binding constants of untreated wild-type CBG and the CBG variants were determined by Scatchard analysis using [3H]cortisol as the labeled ligand (19Hammond G.L. Lahteenmaki P.L. Clin. Chim. Acta. 1983; 132: 101-110Crossref PubMed Scopus (200) Google Scholar). Amino Acid Substitutions at P16 and P15 in the Human CBG RCL Type I β-Turn—Alignment of the CBG sequences from different mammalian species, including human (NCBI accession code NP_001747), rat (NP_001009663), mouse (NP_031644), rabbit (P23775), pig (AAG45431), and sheep (CAA52000) against human AAT (NP_000286) shows that their RCL sequences are hyper-variable (Fig. 1A). The numbering of residues in the RCL is generally made in relation to the P1-P1′ (Met-Ser) proteinase cleavage site of human AAT (Fig. 1A). Although the normal elastase cleavage sites of human CBG and AAT are in quite different locations within their RCLs (Fig. 1A), neutrophil elastase will cleave AAT in almost the same relative (P6-P7) location as the CBG cleavage site at P5-P6 (Fig. 1A) if the Met residue at P1 in human AAT is oxidized (20Banda M.J. Clark E.J. Sinha S. Travis J. J. Clin. Investig. 1987; 79: 1314-1317Crossref PubMed Scopus (32) Google Scholar). The amino acid substitutions we have made within the CBG RCL (Fig. 1B) are also shown in relation to the P1-P1′ cleavage site in AAT together with a model of how the cleaved CBG RCL is thought to reposition itself between the β-strands s5A and s3A. We first examined the effects of several substitutions within the type I β-turn of the RCL (residues 332 to 335) and focused our attention on Glu-334 and Glu-335 in human CBG to determine whether they represent critical elements of the hinge that allows repositioning of the RCL after proteinase cleavage (Fig. 1B). The amino terminus of the CBG RCL is not well conserved across species and in human CBG is represented by Glu-334 at P16 (Fig. 1A). By contrast, the Glu-335 at P15 in human CBG is conserved in mammalian species apart from rodents (Fig. 1A). However, it has been suggested that the glycine residue at P16 in rodent CBGs plays an equivalent role to Glu-335 in human CBG in allowing the RCL to reposition itself after cleavage (13Klieber M.A. Underhill C. Hammond G.L. Muller Y.A. J. Biol. Chem. 2007; 282: 29594-29603Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). We, therefore, first converted the P16 (Glu-334) and P15 (Gly-335) residues of the human CBG RCL into the corresponding residues in rat CBG, i.e. Gly-334 and Asn-335, and tested this mutant for its ability to be cleaved by neutrophil elastase and to bind steroid before and after elastase cleavage. As in the case of wild-type CBG, it is evident that these amino acid substitutions do not limit elastase cleavage, as assessed by Western blotting (Fig. 2A), or influence the loss of steroid binding capacity that typically occurs after proteolysis of the RCL of human CBG (Fig. 2B). The Western blotting data (Fig. 2A) show the typical reduction in the apparent size of human CBG by about 5 kDa, consistent with the loss of the 39 carboxyl-terminal residues that are not recognized by our antibodies after cleavage by elastase (21Hammond G.L. Smith C.L. Underhill C.M. Nguyen V.T. Biochem. Biophys. Res. Commun. 1990; 172: 172-177Crossref PubMed Scopus (32) Google Scholar). The steroid binding activities of various CBG mutants were also compared with wild-type CBG in a simple assay to assess the apparent rate of [3H]cortisol dissociation from their steroid-binding sites before and after treatment with elastase (see “Experimental Procedures” for details). Although this method provides an indirect measure of binding affinity, it can be performed immediately after elastase treatment, thereby circumventing further proteolysis of CBG beyond cleavage of the RCL, which can be monitored in parallel by Western blotting (Fig. 2A). In the cases of wild-type CBG and the E334G/G335N human CBG variant, elastase cleavage clearly results in a substantial (5–10-fold) reduction in the amount of [3H]cortisol bound to the proteins (Fig. 3, left panels of A and B). The small amount of specifically bound [3H]cortisol that remains after the 5-min elastase treatment likely represents the sum of (a) the steroid binding of residual uncleaved proteins and (b) the contribution made by the relative large amounts of cleaved proteins with much reduced binding affinity. To assess this further, we expressed the bound [3H]cortisol at each time point of DCC exposure as a percentage of the extrapolated values at the zero time point, and this shows that the dissociation of [3H]cortisol from these proteins after elastase cleavage is only about 50% faster than that measured for the intact proteins (Fig. 3, right panels of A and B). We, therefore, conclude that the bound [3H]cortisol, remaining after elastase cleavage, primarily reflects binding to a small amount of intact proteins plus a minor contribution from the cleaved proteins from which [3H]cortisol dissociates very much more rapidly and which would be very difficult to accurately measure. To assess the individual contributions of Glu-334 and Glu-335 to the loss of steroid binding from the E334G/G335N CBG variant after elastase cleavage, we first focused on Glu-334 and either deleted it or substituted it with an alanine residue. Because the glutamic acid (Glu-333) at P17 in human CBG is highly conserved in serpin structures (Fig. 1A), deletion of Glu-334 would mean that the Glu-335 would still be adjacent to the P17 glutamic acid, as it is in rat CBG (Fig. 1A). The loss of Glu-334 had no impact on the cleavage of CBG by elastase (Fig. 2A), but surprisingly, its binding capacity after elastase cleavage was essentially unchanged (Fig. 2B). This was confirmed in our assay of the apparent dissociation of [3H]cortisol from its binding site when expressed either in terms of the actual amounts (cpm) of bound [3H]cortisol (Fig. 3C, left panel) or a percentage of the bound counts remaining at set time points after DCC exposure (Fig. 3C, right panel). By contrast, when the Glu-334 in human CBG was substituted with an alanine residue and this variant was cleaved by elastase (Fig. 2A), it clearly behaved like the wild-type protein and lost about 80% of its [3H]cortisol binding capacity (Figs. 2B and 3D). We then replaced the P15 Glu-335 with proline to stiffen the segment of the RCL that is tethered to s5B, as the reduced flexibility should greatly impair conformational changes in this region during RCL insertion. When this G335P CBG variant was examined, we found that it retained its steroid binding activity after proteolytic cleavage (Fig. 2, A and B), and this was confirmed in our dissociation rate assay (Fig. 3E). In Western blotting experiments the G335P variant and two other variants (T338P/A339N and G340P) were consistently less immuno-reactive after elastase cleavage, without any evidence of more extensive proteolysis, and we attribute this to the loss of an epitope within the cleaved RCL. Amino Acid Substitutions at P14 and P12 of the CBG RCL Have Profound Effects on Steroid Binding—When we replaced the Val-336 at P14 of human CBG with a large, charged residue (arginine), this did not influence its cleavage by elastase (Fig. 4A). Moreover, cleavage of the V336R variant did not reduce its steroid binding capacity (Fig. 4B) or the rate of [3H]cortisol dissociation from its binding site (Fig. 5A). We also substituted the Thr-338 at P12 with a proline alone or together with an A339N substitution at P11 because this would then introduce an N-glycosylation site, as found in the corresponding position within the rat CBG RCL (Fig. 1A). As in the case of the V336R CBG variant, the T338P and T338P/A339N substitutions had no effect on the proteolytic cleavage of the RCL by elastase (Fig. 4A), and their steroid binding capacities appeared to even increase after elastase cleavage (Fig. 4B). In the case of the T338P and T338P/A339N human CBG variants, the latter observation was confirmed in our analysis of the rate of [3H]cortisol dissociation from their binding sites before and after elastase cleavage (Fig. 5, B and C, respectively). However, in these cases it appears that the rate of [3H]cortisol dissociation from the elastase-cleaved proteins is slightly more rapid than from their intact counterparts (Fig. 5, B and C).FIGURE 5Dissociation of [3H]cortisol from untreated and elastase-cleaved P14 Val-336, P12 Thr-338, and P11 Ala-339 human CBG variants. DCC was added to [3H]cortisol-saturated CBGs (untreated or elastase-cleaved) at 0 °C, and the samples were incubated for 5, 10, 15, or 20 min at 0 °C before centrifugation to separate CBG-bound from free [3H]cortisol. Aliquots of the corresponding samples were also run on a Western blot to confirm the cleavage by elastase, as illustrated in Fig. 4A. A, V336R CBG. B, T338P/A339N CBG. C, T338P CBG. The results are presented as CBG-bound [3H]cortisol in cpm (left panel) or the percentage of the CBG-bound [3H]cortisol at different times of DCC exposure in relation to the extrapolated CBG-bound [3H]cortisol at zero time of DCC exposure (right panel). Linear regression was used to fit the data, and the r values for the [3H]cortisol binding data were >0.969.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Human CBG Variants with Substitutions at P10 and P8 in the RCL Only Partially Lose Steroid Binding after Elastase Cleavage—When we replaced Gly-340 at P10 with a proline or serine (the corresponding rat CBG residue) and Thr-342 at P8 with proline or Asn (the corresponding residue in rat CBG), the cortisol binding capacities of these four variants (G340P, G340S, T342P, and T342N) were all partially reduced after elastase cleavage (Fig. 6). To further assess this, the apparent dissociation rates of [3H]cortisol from the native and elastase-cleaved forms of these variants were measured. As shown in Fig. 7, the [3H]cortisol binding capacities of the G340P, G340S, and T342N CBG variants were reduced (left panel), and their [3H]cortisol dissociation rates were clearly increased (right panel) after elastase cleavage, thus indicating that the steroid binding properties of these CBG variants are not completely disrupted when their RCLs are cleaved.FIGURE 7Dissociation of [3H]cortisol from untreated and elastase-cleaved P10 Gly-340 and P8 Thr-342 human CBG variants. DCC was added to [3H]cortisol-saturated CBGs (untreated" @default.
• W1991521210 created "2016-06-24" @default.
• W1991521210 creator A5002374109 @default.
• W1991521210 creator A5003290065 @default.
• W1991521210 creator A5017533864 @default.
• W1991521210 creator A5029961192 @default.
• W1991521210 creator A5066698175 @default.
• W1991521210 date "2009-01-01" @default.
• W1991521210 modified "2023-10-16" @default.
• W1991521210 title "Residues in the Human Corticosteroid-binding Globulin Reactive Center Loop That Influence Steroid Binding before and after Elastase Cleavage" @default.
• W1991521210 cites W1498984457 @default.
• W1991521210 cites W1589897785 @default.
• W1991521210 cites W1604209126 @default.
• W1991521210 cites W1858299364 @default.
• W1991521210 cites W1932457795 @default.
• W1991521210 cites W1972328160 @default.
• W1991521210 cites W1973485912 @default.
• W1991521210 cites W1974893615 @default.
• W1991521210 cites W1979669422 @default.
• W1991521210 cites W1981332317 @default.
• W1991521210 cites W1989428737 @default.
• W1991521210 cites W1996362995 @default.
• W1991521210 cites W1998627622 @default.
• W1991521210 cites W2001159361 @default.
• W1991521210 cites W2001570522 @default.
• W1991521210 cites W2001790577 @default.
• W1991521210 cites W2008909934 @default.
• W1991521210 cites W2011479978 @default.
• W1991521210 cites W2011955429 @default.
• W1991521210 cites W2013474205 @default.
• W1991521210 cites W2025905046 @default.
• W1991521210 cites W2026817800 @default.
• W1991521210 cites W2027766635 @default.
• W1991521210 cites W2030563378 @default.
• W1991521210 cites W2032615313 @default.
• W1991521210 cites W2046574852 @default.
• W1991521210 cites W2047947037 @default.
• W1991521210 cites W2053925035 @default.
• W1991521210 cites W2064095852 @default.
• W1991521210 cites W2065918929 @default.
• W1991521210 cites W2072992746 @default.
• W1991521210 cites W2073602116 @default.
• W1991521210 cites W2073740895 @default.
• W1991521210 cites W2076239915 @default.
• W1991521210 cites W2082968333 @default.
• W1991521210 cites W2086358060 @default.
• W1991521210 cites W2095454140 @default.
• W1991521210 cites W2105220294 @default.
• W1991521210 cites W2120475265 @default.
• W1991521210 cites W2133420109 @default.
• W1991521210 cites W2135449612 @default.
• W1991521210 cites W2140339735 @default.
• W1991521210 cites W2153372588 @default.
• W1991521210 cites W4246582722 @default.
• W1991521210 doi "https://doi.org/10.1074/jbc.m807376200" @default.
• W1991521210 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19011238" @default.
• W1991521210 hasPublicationYear "2009" @default.
• W1991521210 type Work @default.
• W1991521210 sameAs 1991521210 @default.
• W1991521210 citedByCount "37" @default.
• W1991521210 countsByYear W19915212102012 @default.
• W1991521210 countsByYear W19915212102013 @default.
• W1991521210 countsByYear W19915212102014 @default.
• W1991521210 countsByYear W19915212102015 @default.
• W1991521210 countsByYear W19915212102016 @default.
• W1991521210 countsByYear W19915212102017 @default.
• W1991521210 countsByYear W19915212102018 @default.
• W1991521210 countsByYear W19915212102019 @default.
• W1991521210 countsByYear W19915212102021 @default.
• W1991521210 countsByYear W19915212102022 @default.
• W1991521210 crossrefType "journal-article" @default.
• W1991521210 hasAuthorship W1991521210A5002374109 @default.
• W1991521210 hasAuthorship W1991521210A5003290065 @default.
• W1991521210 hasAuthorship W1991521210A5017533864 @default.
• W1991521210 hasAuthorship W1991521210A5029961192 @default.
• W1991521210 hasAuthorship W1991521210A5066698175 @default.
• W1991521210 hasBestOaLocation W19915212101 @default.
• W1991521210 hasConcept C107824862 @default.
• W1991521210 hasConcept C134018914 @default.
• W1991521210 hasConcept C151730666 @default.
• W1991521210 hasConcept C175156509 @default.
• W1991521210 hasConcept C181199279 @default.
• W1991521210 hasConcept C185592680 @default.
• W1991521210 hasConcept C2776804153 @default.
• W1991521210 hasConcept C2780902042 @default.
• W1991521210 hasConcept C2781044401 @default.
• W1991521210 hasConcept C43369102 @default.
• W1991521210 hasConcept C51639874 @default.
• W1991521210 hasConcept C55493867 @default.
• W1991521210 hasConcept C71315377 @default.
• W1991521210 hasConcept C81358767 @default.
• W1991521210 hasConcept C86803240 @default.
• W1991521210 hasConcept C90134679 @default.
• W1991521210 hasConceptScore W1991521210C107824862 @default.
• W1991521210 hasConceptScore W1991521210C134018914 @default.
• W1991521210 hasConceptScore W1991521210C151730666 @default.
• W1991521210 hasConceptScore W1991521210C175156509 @default.
• W1991521210 hasConceptScore W1991521210C181199279 @default.

• next