FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1991740116> ?p ?o ?g. }

• W1991740116 endingPage "17660" @default.
• W1991740116 startingPage "17652" @default.
• W1991740116 abstract "Products of lipid peroxidation such as 4-hydroxy-trans-2-nonenal (HNE) trigger multiple signaling cascades that variably affect cell growth, differentiation, and apoptosis. Because glutathiolation is a significant metabolic fate of these aldehydes, we tested the possibility that the bioactivity of HNE depends upon its conjugation with glutathione. Addition of HNE or the cell-permeable esters of glutathionyl-4-hydroxynonenal (GS-HNE) or glutathionyl-1,4-dihydroxynonene (GS-DHN) to cultures of rat aortic smooth muscle cells stimulated protein kinase C, NF-κB, and AP-1, and increased cell growth. The mitogenic effects of HNE, but not GS-HNE or GS-DHN, were abolished by glutathione depletion. Pharmacological inhibition or antisense ablation of aldose reductase (which catalyzes the reduction of GS-HNE to GS-DHN) prevented protein kinase C, NF-κB, and AP-1 stimulation and the increase in cell growth caused by HNE and GS-HNE, but not GS-DHN. The growth stimulating effect of GS-DHN was enhanced in cells treated with antibodies directed against the glutathione conjugate transporters RLIP76 (Ral-binding protein) or the multidrug resistance protein-2. Overexpression of RLIP76 abolished the mitogenic effects of HNE and its glutathione conjugates, whereas ablation of RLIP76 using RNA interference promoted the mitogenic effects. Collectively, our findings suggest that the mitogenic effects of HNE are mediated by its glutathione conjugate, which has to be reduced by aldose reductase to stimulate cell growth. These results raise the possibility that the glutathione conjugates of lipid peroxidation products are novel mediators of cell signaling and growth. Products of lipid peroxidation such as 4-hydroxy-trans-2-nonenal (HNE) trigger multiple signaling cascades that variably affect cell growth, differentiation, and apoptosis. Because glutathiolation is a significant metabolic fate of these aldehydes, we tested the possibility that the bioactivity of HNE depends upon its conjugation with glutathione. Addition of HNE or the cell-permeable esters of glutathionyl-4-hydroxynonenal (GS-HNE) or glutathionyl-1,4-dihydroxynonene (GS-DHN) to cultures of rat aortic smooth muscle cells stimulated protein kinase C, NF-κB, and AP-1, and increased cell growth. The mitogenic effects of HNE, but not GS-HNE or GS-DHN, were abolished by glutathione depletion. Pharmacological inhibition or antisense ablation of aldose reductase (which catalyzes the reduction of GS-HNE to GS-DHN) prevented protein kinase C, NF-κB, and AP-1 stimulation and the increase in cell growth caused by HNE and GS-HNE, but not GS-DHN. The growth stimulating effect of GS-DHN was enhanced in cells treated with antibodies directed against the glutathione conjugate transporters RLIP76 (Ral-binding protein) or the multidrug resistance protein-2. Overexpression of RLIP76 abolished the mitogenic effects of HNE and its glutathione conjugates, whereas ablation of RLIP76 using RNA interference promoted the mitogenic effects. Collectively, our findings suggest that the mitogenic effects of HNE are mediated by its glutathione conjugate, which has to be reduced by aldose reductase to stimulate cell growth. These results raise the possibility that the glutathione conjugates of lipid peroxidation products are novel mediators of cell signaling and growth. Incomplete reduction of oxygen leads to the generation of highly reactive species. When generated in high concentrations, the reactive oxygen species (ROS) 2The abbreviations used are: ROS, reactive oxygen species; AR, aldose reductase; HNE, 4-hydroxy-trans-2-nonenal; GS-HNE-ester, glutathionyl 4-hydroxynonanal-ester; GS-DHN-ester, glutathionyl 1,4-dihydroxynonanol-ester; GS-ester, glutathione-monoethylester; MRP, multidrug resistance protein; VSMC, vascular smooth muscle cells; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; GST, glutathione S-transferase; DMEM, Dulbecco's modified Eagle's medium; HPLC, high performance liquid chromatography; PKC, protein kinase C; siRNA, small interfering RNA; FBS, fetal bovine serum; ESI/MS, electrospray ionization mass spectrometry; BSO, l-buthionine-(S, R)-sulfoximine. 2The abbreviations used are: ROS, reactive oxygen species; AR, aldose reductase; HNE, 4-hydroxy-trans-2-nonenal; GS-HNE-ester, glutathionyl 4-hydroxynonanal-ester; GS-DHN-ester, glutathionyl 1,4-dihydroxynonanol-ester; GS-ester, glutathione-monoethylester; MRP, multidrug resistance protein; VSMC, vascular smooth muscle cells; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; GST, glutathione S-transferase; DMEM, Dulbecco's modified Eagle's medium; HPLC, high performance liquid chromatography; PKC, protein kinase C; siRNA, small interfering RNA; FBS, fetal bovine serum; ESI/MS, electrospray ionization mass spectrometry; BSO, l-buthionine-(S, R)-sulfoximine. cause tissue injury and cell death. Excessive ROS production has been linked to a number of degenerative diseases including atherosclerosis (1Chen K. Thomas S. Keaney Jr., J. Free Radic. Biol. Med. 2003; 35: 117-132Crossref PubMed Scopus (152) Google Scholar, 2Glass C. Witztum J. Cell. 2001; 104: 503-516Abstract Full Text Full Text PDF PubMed Scopus (2630) Google Scholar, 3Madamanchi N. Vendrov A. Runge M.S. Arterioscler. Thromb. Vasc. Biol. 2005; 25: 29-38Crossref PubMed Scopus (71) Google Scholar), Alzheimer disease (4Chong Z.Z. Li F. Maiese K. Brain Res. Rev. 2005; 49: 1-21Crossref PubMed Scopus (121) Google Scholar, 5Floyd R.A. Free Radic. Biol. Med. 1999; 26: 1346-1355Crossref PubMed Scopus (201) Google Scholar), and heart failure (6Giordano F. J. Clin. Investig. 2005; 115: 500-508Crossref PubMed Scopus (1197) Google Scholar, 7Nian M. Lee P. Khaper N. Liu P. Circ. Res. 2004; 94: 1543-1553Crossref PubMed Scopus (834) Google Scholar, 8Sawyer D.B. Siwik D.A. Xiao L. Pimentel D. Singh K. Colucci W.S. J. Mol. Cell Cardiol. 2002; 34: 379-388Abstract Full Text PDF PubMed Scopus (476) Google Scholar), as well as tissue injury and dysfunction associated with myocardial ischemia and reperfusion (9Downey J.M. Annu. Rev. Physiol. 1990; 52: 487-504Crossref PubMed Scopus (238) Google Scholar, 10Kloner R.A. Przyklenk K. Whittaker P. Circulation. 1989; 80: 1115-1127Crossref PubMed Scopus (508) Google Scholar) and diabetes (11Beckman J.A. Creager M.A. Libby P. J. Am. Med. Assoc. 2002; 287: 2570-2581Crossref PubMed Scopus (2191) Google Scholar, 12Brownlee M. Nature. 2001; 414: 813-820Crossref PubMed Scopus (7030) Google Scholar). Additionally, recent evidence suggests that ROS are physiological regulators and mediators of cell signaling due to cytokines and growth factors (13Chiarugi P. Cirri P. Trends Biochem. Sci. 2003; 28: 509-514Abstract Full Text Full Text PDF PubMed Scopus (297) Google Scholar, 14Droge W. Physiol. Rev. 2002; 82: 47-95Crossref PubMed Scopus (7493) Google Scholar, 15Nakamura H. Nakamura K. Yodoi J. Annu. Rev. Immunol. 1997; 15: 351-369Crossref PubMed Scopus (997) Google Scholar, 16Nathan C. J. Clin. Investig. 2003; 111: 769-778Crossref PubMed Scopus (385) Google Scholar). Under physiological conditions, the biological effects of ROS are tightly regulated by chemical and enzymatic antioxidant defenses. However, when these defenses are overwhelmed by disease or injury, ROS attack many cell constituents, with unsaturated lipids being the main target. Unsaturated lipids provide a readily extractable proton to oxygen-free radicals. The resultant lipid radical is stabilized by the bis-allylic double bond system and rapidly accepts molecular oxygen to form peroxyl radicals. This initiates a series of complex, autocatalytic reactions that generate a variety of carbonyl compounds as their end products (17Porter N.A. Caldwell S.E. Mills K.A. Lipids. 1995; 30: 277-290Crossref PubMed Scopus (1001) Google Scholar). Of these, aldehydes, such as 4-hydroxy-trans-2-nonenal (HNE) are the most abundant and hence of greater biological significance (18Esterbauer H. Schaur R.J. Zollner H. Free Radic. Biol. Med. 1991; 11: 81-128Crossref PubMed Scopus (5889) Google Scholar). Recently, it has been shown that lipid aldehydes such as malonaldehyde can also be formed by free radical attack to deoxyribose (19Zhou X. Taghizadeh K. Dedon P. J. Biol. Chem. 2005; 280: 25377-25382Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). The formation of HNE and related aldehydes is symptomatic of oxidative stress, and these aldehydes or their protein adducts accumulate in diseased tissues such as atherosclerotic lesions (20Napoli C. D'Armiento F.P. Mancini F.P. Postiglione A. Witztum J.L. Palumbo G. Palinski W. J. Clin. Investig. 1997; 100: 2680-2690Crossref PubMed Scopus (800) Google Scholar, 21Olsson M. Thyberg J. Nilsson J. Arterioscler. Thromb. Vasc. Biol. 1999; 19: 1218-1222Crossref PubMed Scopus (346) Google Scholar, 22Salomon R.G. Kaur K. Podrez E. Hoff H.F. Krushinsky A.V. Sayre L.M. Chem. Res. Toxicol. 2000; 13: 557-564Crossref PubMed Scopus (85) Google Scholar), inflamed arteries (23Rittner H.L. Hafner V. Klimiuk P.A. Szweda L.I. Goronzy J.J. Weyand C.M. J. Clin. Investig. 1999; 103: 1007-1013Crossref PubMed Scopus (194) Google Scholar), hypertrophic (24Benderdour M. Charron G. deBlois D. Comte B. Des Rosiers C. J. Biol. Chem. 2003; 278: 45154-45159Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 25Srivastava S. Chandrasekar B. Bhatnagar A. Prabhu S.D. Am. J. Physiol. 2002; 283: H2612-H2619Crossref PubMed Scopus (77) Google Scholar) and ischemic hearts (26Eaton P. Li J.M. Hearse D.J. Shattock M. Am. J. Physiol. 1999; 276: H935-H943Crossref PubMed Google Scholar, 27Lucas D.T. Szweda L.I. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6689-6693Crossref PubMed Scopus (127) Google Scholar), and the neuronal lesions associated with Parkinson (28Yoritaka A. Hattori N. Uchida K. Tanaka M. Stadtman E.R. Mizuno Y. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 2696-2701Crossref PubMed Scopus (871) Google Scholar) and Alzheimer (29Montine K.S. Kim P.J. Olson S.J. Markesbery W.R. Montine T.J. J. Neuropathol. Exp. Neurol. 1997; 56: 866-871Crossref PubMed Scopus (145) Google Scholar) diseases. The accumulation of HNE and its protein adducts in diseased tissues indicates that lipid peroxidation products could contribute to disease pathology and progression. Indeed, in isolated cells, HNE activates several signaling pathways, including c-Jun NH2-terminal kinase (JNK) (30Cheng J.Z. Singhal S.S. Sharma A. Saini M. Yang Y. Awasthi S. Zimniak P. Awasthi Y. Arch. Biochem. Biophys. 2001; 392: 197-207Crossref PubMed Scopus (101) Google Scholar, 31Parola M. Robino G. Marra F. Pinzani M. Bellomo G. Leonarduzzi G. Chiarugi P. Camandola S. Poli G. Waeg G. Gentilini P. Dianzani M.U. J. Clin. Investig. 1998; 102: 1942-1950Crossref PubMed Scopus (275) Google Scholar, 32Soh Y. Jeong K.S. Lee I.J. Bae M.A. Kim Y.C. Song B.J. Mol. Pharmacol. 2000; 58: 535-541Crossref PubMed Scopus (115) Google Scholar, 33Uchida K. Shiraishi M. Naito Y. Torii Y. Nakamura Y. Osawa T. J. Biol. Chem. 1999; 274: 2234-2242Abstract Full Text Full Text PDF PubMed Scopus (522) Google Scholar, 34Usatyuk P.V. Natarajan V. J. Biol. Chem. 2004; 279: 11789-11797Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar) and Nrf2-dependent induction of the scavenger receptor (35Ishii T. Itoh K. Ruiz E. Leake D.S. Unoki H. Yamamoto M. Mann G.E. Circ. Res. 2004; 94: 609-616Crossref PubMed Scopus (356) Google Scholar). Significantly, HNE is a potent vascular smooth muscle cell (VSMC) mitogen (36Ruef J. Rao G.N. Li F. Bode C. Patterson C. Bhatnagar A. Runge M.S. Circulation. 1998; 97: 1071-1078Crossref PubMed Scopus (135) Google Scholar) and therefore could contribute to VSMC proliferation in atherosclerotic lesions. Nevertheless, the mechanisms by which HNE affects cell growth remain obscure. Our previous studies show that VSMC transform HNE into multiple metabolites (37Ruef J. Liu S.Q. Bode C. Tocchi M. Srivastava S. Runge M.S. Bhatnagar A. Arterioscler. Thromb. Vasc. Biol. 2000; 20: 1745-1752Crossref PubMed Scopus (93) Google Scholar, 38Srivastava S. Conklin D.J. Liu S.Q. Prakash N. Boor P.J. Srivastava S.K. Bhatnagar A. Atherosclerosis. 2001; 158: 339-350Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). These include direct oxidation and reduction of HNE to 4-hydroxynonanoic acid and 1,4-dihydroxynonene (DHN), respectively. In addition, HNE also undergoes glutathione S-transferase (GST)-catalyzed conjugation to form GS-HNE, which is further reduced to GS-DHN by aldose reductase (AR; AKR1B4) (39Dixit B.L. Balendiran G.K. Watowich S.J. Srivastava S. Ramana K.V. Petrash J.M. Bhatnagar A. Srivastava S.K. J. Biol. Chem. 2000; 275: 21587-21595Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar, 40Ramana K.V. Dixit B.L. Srivastava S. Balendiran G.K. Srivastava S.K. Bhatnagar A. Biochemistry. 2000; 39: 12172-12180Crossref PubMed Scopus (92) Google Scholar, 41Srivastava S. Chandra A. Wang L.F. Seifert Jr., W.E. DaGue B.B. Ansari Srivastava N.H. Bhatnagar S. K.A. J. Biol. Chem. 1998; 273: 10893-10900Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar, 42Srivastava S. Watowich S.J. Petrash J.M. Srivastava S.K. Bhatnagar A. Biochemistry. 1999; 38: 42-54Crossref PubMed Scopus (153) Google Scholar). Both GS-HNE and GS-DHN can be actively extruded via membrane transport mechanisms. However, the functional significance of this metabolism is unclear and it is not known whether the mitogenic effects are directly due to HNE or mediated by one of its metabolites. Therefore, we tested the hypothesis that GS-DHN, the product of AR-catalyzed reduction of the glutathione conjugate of HNE, is the active metabolite that mediates HNE signaling and mitogenesis. This view is consistent with our previous observations that inhibition of AR (AKR1B4) prevents protein kinase C activation and NF-κB activation (43Ramana K. Chandra D. Srivastava S. Bhatnagar A. Aggarwal B.B. Srivastava S.K. J. Biol. Chem. 2002; 277: 32063-32070Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 44Ramana K. Friedrich B. Srivastava S. Bhatnagar A. Srivastava S.K. Diabetes. 2004; 53: 2910-2920Crossref PubMed Scopus (145) Google Scholar, 45Ramana K.V. Friedrich B. Tammali R. West M.B. Bhatnagar A. Srivastava S.K. Diabetes. 2005; 54: 818-829Crossref PubMed Scopus (107) Google Scholar) and inhibits VSMC growth (37Ruef J. Liu S.Q. Bode C. Tocchi M. Srivastava S. Runge M.S. Bhatnagar A. Arterioscler. Thromb. Vasc. Biol. 2000; 20: 1745-1752Crossref PubMed Scopus (93) Google Scholar, 43Ramana K. Chandra D. Srivastava S. Bhatnagar A. Aggarwal B.B. Srivastava S.K. J. Biol. Chem. 2002; 277: 32063-32070Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Our current results demonstrate the selective ability of GS-DHN in mediating HNE-induced VSMC growth and support the view that AR-catalyzed reduction of glutathione conjugates in general may be a critical and essential interface between detoxification and signaling. Materials—Dulbecco's modified Eagle's medium (DMEM), phosphate-buffered saline, penicillin/streptomycin solution, trypsin, and fetal bovine serum (FBS) were purchased from Invitrogen. Consensus oligonucleotide for NF-κB (5′-AGTTGAGGGGACTTTCCCAGGC-3′) and AP-1 (5′-TTCCGGCTGACTCATCAAGCG-3′) transcription factors were obtained from Promega Corp. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), glutathione monoethyl ester, and polyclonal antibodies against MRP-2 were obtained from Sigma. All other reagents used were of analytical grade. Cell Culture—Rat VSMC were isolated from healthy rat aorta and characterized by smooth muscle cell-specific α-actin expression. VSMC were maintained and grown in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin at 37 °C in a humidified atmosphere of 5% CO2. Preparation of Cell Permeable GS-aldehyde Esters—HNE was synthesized as described previously (41Srivastava S. Chandra A. Wang L.F. Seifert Jr., W.E. DaGue B.B. Ansari Srivastava N.H. Bhatnagar S. K.A. J. Biol. Chem. 1998; 273: 10893-10900Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar). The radiolabeled [4-3H]HNE was synthesized from the dimethylacetal of HNE, which was oxidized to the 4-keto derivative using polymer-supported chromic acid as an oxidizing agent. The resulting ketone was further reduced to the dimethylacetal of HNE by using tritiated NaBH4. The [4-3H]HNE obtained by acid hydrolysis was purified on HPLC and stored in methyline chloride at –20 °C until further use. The conjugate of glutathione-reduced ethyl ester with HNE (GS-HNE-ester) was prepared by incubating 1 μmol of [4-3H]HNE (55,000 cpm/nmol) with 5 μmol of GSH ethyl ester in 0.1 m potassium phosphate, pH 7.0, for 1 h at room temperature. The reaction was monitored by following the consumption of HNE at 224 nm. The GS-HNE-ester conjugate was purified by reverse phase HPLC as described below. For the synthesis of the reduced form of the esterified glutathione-HNE conjugate (GS-DHN-ester), 100 nmol of GS-HNE-ester was incubated with 300 nmol of NADPH and 100 μg of aldose reductase in 0.1 m potassium phosphate, pH 6.0, for 3 h at 37°C. The reaction was monitored by following the consumption of NADPH at 340 nm. At the end of the incubation, the GS-DHN-ester conjugate was separated from GS-HNE-ester by reverse phase HPLC as described below. HPLC Analysis—Synthesized standards and metabolites of GS-HNE and GS-DHN-esters were separated by HPLC using a Varian reverse phase ODS C18 column pre-equilibrated with 0.1% aqueous trifluoroacetic acid. The compounds were eluted using a gradient consisting of solvent A (0.1% aqueous trifluoroacetic acid) and solvent B (100% acetonitrile) at a flow rate of 1 ml/min. The gradient was established such that solvent B reached 24% in 20 min, 26% in 30 min, and was held at this value for 10 min. Furthermore, in the next 10 min solvent B reached 60%, and in an additional 5 min it reached 100% and was held at this value for 10 min. Electrospray Ionization Mass Spectrometry—Chemical identities of the GS-HNE and GS-DHN-esters were established by electrospray ionization mass spectrometry (ESI/MS). The samples were analyzed on a single quadrapole Micromass LCZ instrument as described before (40Ramana K.V. Dixit B.L. Srivastava S. Balendiran G.K. Srivastava S.K. Bhatnagar A. Biochemistry. 2000; 39: 12172-12180Crossref PubMed Scopus (92) Google Scholar). The ESI+/MS operating parameters were as follows: capillary voltage, 3.0 kV; cone voltage, 13 V; extractor voltage, 9 V; source block temperature, 100 °C; and dissolvation temperature, 200 °C. Nitrogen at 3 p.s.i. was used as nebulizer gas. Samples were reconstituted in 50 μl of acetonitrile/water/acetic acid (50/50/0.1) (v/v/v), and applied to the mass spectrophotometer using a Harvard syringe pump at a rate of 5 μl/min. Spectra were acquired at the rate of 200 atomic mass units/s over the range of 20 –2000 atomic mass units. Metabolism of GS-HNE and GS-DHN-esters in VSMC—The growth arrested rat VSMC (2 × 106/well in six-well plates) were incubated with radiolabeled GS-[3H]HNE and GS-[3H]DHN esters (1 μm; ∼51,000 cpm) for 0, 30, 60, 120 min, and 24 h in a humidified CO2 incubator. The culture media were separated, filtered by using Amicon Centriprep 3-kDa membrane, and subjected to HPLC analysis as described above. Cell Growth Studies—The rat VSMC were grown in DMEM and harvested by trypsinization and plated in a 96-well plate at a density of 5,000 cells/well. Cells were grown for 24 h in the indicated media and growth-arrested at 60–80% confluency for 24 h in media containing 0.1% FBS. Low serum levels were maintained during growth arrest to prevent slow apoptosis that accompanies complete serum deprivation of these cells. The growth-arrested cells were treated with (0.5-μm each of) HNE, GS-HNE-ester, and GS-DHN-ester, in the absence and presence of AR inhibitors, sorbinil or tolrestat (10 μm each). The rate of cell proliferation or apoptosis was determined by cell counts and MTT assay. To examine the role of RLIP76 (76-kDa Ral-binding, Rho/Rac-GAP, and Ral effector protein) and MRP-2 (multidrug resistance-associated protein-2) in mediating cell growth, growth-arrested VSMC were treated with peptide-specific antibodies raised against RLIP76 or MRP-2 for 1 h followed by incubation with GS-DHN-ester (0 –5 μm) and the rates of cell proliferation or apoptosis were determined as described above. To study the effect of glutathione depletion, VSMC grown in DMEM containing 10% FBS were treated with or without 25 μm BSO for 12 h. The media was then replaced with fresh DMEM containing 0.1% FBS. The cells were continuously cultured in the 0.1% FBS media without or with BSO in the absence or presence of HNE (1 μm), GS-HNE-ester (0.75 μm), or GS-DHN-ester (0.75 μm) for another 24 h. The rate of cell proliferation or apoptosis was determined by cell count and MTT assay. Antisense Ablation of AR—Antisense ablation of AR (AKR1B4) was carried out as described (43Ramana K. Chandra D. Srivastava S. Bhatnagar A. Aggarwal B.B. Srivastava S.K. J. Biol. Chem. 2002; 277: 32063-32070Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Briefly, VSMC were transfected with 1 μm AR antisense and mismatch control oligonucleotides in Opti-MEM for 12 h using Lipofectamine Plus (15 μg/ml) as a transfection reagent as described by the supplier's instructions. After 12 h, the medium was replaced with DMEM (10% FBS). The cells were grown in this medium for another 12 h and were then incubated with low serum DMEM (0.1% FBS) for 24 h for serum starvation. Overexpression and RNA Interference Ablation of RLIP76—The VSMC were transiently transfected with pcDNA3.1 vector containing RLIP76 cDNA, or with the vector alone, using a Lipofectamine Plus reagent as per supplier's instructions (Invitrogen). Overexpression of RLIP was monitored by Western blot analysis, using peptide-specific RLIP76 antibodies. To ablate RLIP76, siRNAs were designed to target the coding sequence of RLIP76. The target sequences (AAGAAAAAGCCAATTCAGGAGCC corresponding to nucleotide 508 –528 of RLIP76 starting from AUG codon in the open reading frame) were directed to the single-strand region according to the predicted secondary RNA structure. Sequences of the form (AA/CA) N19 with GC content <55% were selected from this region. Control non-silencing siRNA (fluorescein) was obtained from Qiagen. VSMC grown in DMEM containing 10% FBS and 1% penicillin and streptomycin at 37 °C and 5% CO2 were seeded on 6- or 96-well plates. When the cells reached 60 –70% confluence (in 24 h), the media was replaced with fresh DMEM without serum, and the cells were incubated with siRNA to a final concentration of 100 nmol/liter and the RNAiFect™ transfection reagent (Qiagen) as per the supplier's instructions. After incubation for 15 min at 25 °C, the medium was aspirated and replaced with fresh DMEM containing 10% serum added dropwise to the cells. The cells were cultured for 48 h at 37 °C (5% CO2), and changes in RLIP76 expression were determined by Western blotting using anti-RLIP76 antibodies. Electrophoretic Mobility Gel Shift Assays—Cytosolic and nuclear extracts were prepared as described (43Ramana K. Chandra D. Srivastava S. Bhatnagar A. Aggarwal B.B. Srivastava S.K. J. Biol. Chem. 2002; 277: 32063-32070Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Consensus oligonucleotides for NF-κB and AP-1 transcription factors were 5′-end labeled using T4 polynucleotide kinase. The assay procedure was as described before (43Ramana K. Chandra D. Srivastava S. Bhatnagar A. Aggarwal B.B. Srivastava S.K. J. Biol. Chem. 2002; 277: 32063-32070Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Briefly, nuclear extracts prepared from various control and treated cells were incubated with the labeled oligonucleotides for NF-κB or AP-1 for 15 min at 37 °C, and the DNA-protein complex formed was resolved on 6.5% native polyacrylamide gels. The specificity of binding was examined by competition with an excess of unlabeled oligonucleotide. Supershift assay was also performed to determine the specificity of NF-κB binding to its specific consensus sequence by using anti-p65 antibodies. After electrophoresis, the gels were dried by using a vacuum gel dryer and autoradiographed on Kodak x-ray films. The radiolabeled bands were quantified by an Alpha Imager 2000 Scanning Densitometer equipped with AlphaEase™ version 3.3b software. Measurement of PKC—The PKC activity was measured by using the Promega-Signa TECT™ total PKC assay system according to the manufacturer's instructions. Briefly, aliquots of the reaction (25 mm Tris-HCl, pH 7.5, 1.6 mg/ml phosphatidylserine, 0.16 mg/ml diacylglycerol, and 50 mm MgCl2) were mixed with [γ-32P]ATP (3,000 Ci/mmol, 10 μCi/μl) and incubated at 30 °C for 10 min. To stop the reaction, 7.5 m guanidine hydrochloride was added and the phosphorylated peptide was separated on binding paper. The extent of phosphorylation was detected by measuring radioactivity retained on the paper. Statistical Analysis—Data are presented as mean ± S.D. and the p values were determined using the unpaired Student's t test. Purification and Characterization of GS-HNE and GS-DHN-esters—Because glutathione conjugates do not readily traverse cell membranes, to facilitate their entry GS-HNE and GS-DHN-esters were synthesized and purified by HPLC with retention times of 28 and 31 min, respectively (Fig. 1A). ESI+/MS of HPLC peak I (Fig. 1B) showed a strong molecular ion with an m/z value of 494.2, consistent with GS-DHN-ester, and that of peak II showed molecular ions with m/z values of 492.2 and 274.2 representing GS-HNE-ester and its dehydrated daughter ion, respectively (Fig. 1C). Metabolism of GS-HNE and GS-DHN-esters in VSMC—The metabolism of GS-HNE and GS-DHN-esters in VSMC was investigated by quantifying their metabolites in the culture media and cell extracts. The results indicate that at 120 min only ∼30% of GS-DHN-ester added was de-esterified in VSMC and transported out as only GS-DHN (Table 1). Furthermore, when GS-HNE-ester was added to the VSMC, 69% recovered as the GS-HNE-ester and 25% as free GS-HNE in the media. Only 7% radioactivity was eluted at the peak that corresponded to the elution time for DHN/4-hydroxynonanoic acid. No significant amounts (>2%) of the radiolabeled GS-HNE-ester or GS-DHN-ester and their metabolites were found in cell extracts. However, in the culture media, we have observed a time-dependent increase (30, 60, and 120 min, and 24 h) in the GS-HNE and GS-DHN levels and a time-dependent decrease in GS-HNE- and GS-DHN-esters (Table-1). These results suggest that GS-DHN does not dissociate, whereas some dissociation of GS-HNE could occur in VSMC.TABLE 1Metabolism of GS-HNE and GS-DHN-esters in VSMCIncubation timeCulture media applied to HPLCRecoveryPeak 1Peak2Peak 3cpmcpm (%)GS-HNE-ester 0 min48,95847,786 (98.0) 30 min44,1903,790 (8.2)40,105 (87.2)580 (1.1) 60 min46,3107,466 (16.1)36,897 (76.8)2,080 (4.5) 120 min45,86911,755 (25.6)31,258 (69.1)3,084 (6.8) 24 h46,50912,105 (26.0)22,340 (56.7)3,896 (8.7)GS-DHN-ester 0 min50,15049,852 (99.0) 30 min46,5894,160 (8.9)40,370 (86.6) 60 min42,3607,248 (17.1)32,030 (75.6) 120 min45,58113,810 (30.2)30,865 (67.7) 24 h45,67514,235 (31.1)29,670 (64.9) Open table in a new tab Mitogenic Effects of HNE and Its Metabolites in VSMC—To examine changes in cell growth, early passage, serum-starved rat VSMC were incubated with either HNE or its glutathione conjugates: GS-HNE and GS-DHN. In agreement with our previous observations (36Ruef J. Rao G.N. Li F. Bode C. Patterson C. Bhatnagar A. Runge M.S. Circulation. 1998; 97: 1071-1078Crossref PubMed Scopus (135) Google Scholar), we found that incubation with HNE increased cell growth. A similar increase in growth was observed when the cells were incubated with GS-HNE- and GS-DHN-esters. As shown in Fig. 2, all three reagents, HNE, GS-HNE, and GS-DHN, increased cell proliferation at low concentrations, as determined by counting the number of cells and the MTT assay. With HNE, maximal stimulation of cell growth was evident at a concentration of 1 μm. Similarly, the glutathione conjugates stimulated cell growth at a maximal concentration of 0.75 μm, indicating that conjugation with glutathione does not abolish the mitogenic effects of HNE and that the glutathione conjugate of HNE whether untransformed or reduced is as potent a mitogen as the parent aldehyde. Incubation of the cells with HNE or its glutathione conjugates at concentrations >1 μm led to a concentration-dependent increase in cell death. Significant loss of viability was observed when the cells were incubated with HNE or its conjugates at concentrations exceeding 5 μm. Such biphasic effects of HNE, with growth stimulation at low concentrations and cytotoxicity at high concentrations, have been reported before (36Ruef J. Rao G.N. Li F. Bode C. Patterson C. Bhatnagar A. Runge M.S. Circulation. 1998; 97: 1071-1078Crossref PubMed Scopus (135) Google Scholar) and are consistent with the behavior of other oxidants such as hydrogen peroxide (46Griendling K.K. Sorescu D. Lassegue B. Ushio-Fukai M. Arterioscler. Thromb. Vasc. Biol. 2000; 20: 2175-2183Crossref PubMed Scopus (827) Google Scholar). Interestingly, high concentrations of the glutathione conjugates were also cytotoxic and both GS-HNE and GS-DHN at concentrations exceeding 5 μm induced cell death (Fig. 2, A and B). Similar effects of HNE and its glutathione conjugates on cell growth suggest that all three reagents (HNE, GS-HNE, and GS-DHN) are equally mitogenic. Alternatively, conjugation with glutathione may be an essential “activation” step such that the glutathione conjugate, but not HNE per se, is the proximal mitogen. To distinguish between" @default.
• W1991740116 created "2016-06-24" @default.
• W1991740116 creator A5009312646 @default.
• W1991740116 creator A5012248310 @default.
• W1991740116 creator A5016646185 @default.
• W1991740116 creator A5021056534 @default.
• W1991740116 creator A5022942037 @default.
• W1991740116 creator A5064352695 @default.
• W1991740116 creator A5084284454 @default.
• W1991740116 date "2006-06-01" @default.
• W1991740116 modified "2023-10-03" @default.
• W1991740116 title "Mitogenic Responses of Vascular Smooth Muscle Cells to Lipid Peroxidation-derived Aldehyde 4-Hydroxy-trans-2-nonenal (HNE)" @default.
• W1991740116 cites W1650965741 @default.
• W1991740116 cites W1767331507 @default.
• W1991740116 cites W1965795556 @default.
• W1991740116 cites W1980038357 @default.
• W1991740116 cites W1980058237 @default.
• W1991740116 cites W1980322984 @default.
• W1991740116 cites W1981347404 @default.
• W1991740116 cites W1992377755 @default.
• W1991740116 cites W1994071190 @default.
• W1991740116 cites W1994863097 @default.
• W1991740116 cites W1996182204 @default.
• W1991740116 cites W2007635795 @default.
• W1991740116 cites W2016451375 @default.
• W1991740116 cites W2025237767 @default.
• W1991740116 cites W2035349175 @default.
• W1991740116 cites W2039601697 @default.
• W1991740116 cites W2039973839 @default.
• W1991740116 cites W2040066345 @default.
• W1991740116 cites W2044437167 @default.
• W1991740116 cites W2047195787 @default.
• W1991740116 cites W2050138059 @default.
• W1991740116 cites W2051978776 @default.
• W1991740116 cites W2052436553 @default.
• W1991740116 cites W2053837324 @default.
• W1991740116 cites W2053995474 @default.
• W1991740116 cites W2057067964 @default.
• W1991740116 cites W2057129789 @default.
• W1991740116 cites W2057522312 @default.
• W1991740116 cites W2057651652 @default.
• W1991740116 cites W2060108253 @default.
• W1991740116 cites W2060532751 @default.
• W1991740116 cites W2060678423 @default.
• W1991740116 cites W2063018977 @default.
• W1991740116 cites W2063429313 @default.
• W1991740116 cites W2065718536 @default.
• W1991740116 cites W2067517632 @default.
• W1991740116 cites W2069488209 @default.
• W1991740116 cites W2071794599 @default.
• W1991740116 cites W2072465339 @default.
• W1991740116 cites W2075023730 @default.
• W1991740116 cites W2075112531 @default.
• W1991740116 cites W2079098491 @default.
• W1991740116 cites W2081110896 @default.
• W1991740116 cites W2086216959 @default.
• W1991740116 cites W2093143336 @default.
• W1991740116 cites W2094001761 @default.
• W1991740116 cites W2095282566 @default.
• W1991740116 cites W2109698138 @default.
• W1991740116 cites W2111504832 @default.
• W1991740116 cites W2127444056 @default.
• W1991740116 cites W2132878122 @default.
• W1991740116 cites W2133833958 @default.
• W1991740116 cites W2134146305 @default.
• W1991740116 cites W2135277493 @default.
• W1991740116 cites W2135774343 @default.
• W1991740116 cites W2138070633 @default.
• W1991740116 cites W2141802124 @default.
• W1991740116 cites W2142804176 @default.
• W1991740116 cites W2145845829 @default.
• W1991740116 cites W2147993424 @default.
• W1991740116 cites W2155568044 @default.
• W1991740116 cites W2160998626 @default.
• W1991740116 cites W2163411908 @default.
• W1991740116 cites W2169878907 @default.
• W1991740116 cites W4238581030 @default.
• W1991740116 cites W4242509007 @default.
• W1991740116 cites W4254424778 @default.
• W1991740116 doi "https://doi.org/10.1074/jbc.m600270200" @default.
• W1991740116 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16648138" @default.
• W1991740116 hasPublicationYear "2006" @default.
• W1991740116 type Work @default.
• W1991740116 sameAs 1991740116 @default.
• W1991740116 citedByCount "128" @default.
• W1991740116 countsByYear W19917401162012 @default.
• W1991740116 countsByYear W19917401162013 @default.
• W1991740116 countsByYear W19917401162014 @default.
• W1991740116 countsByYear W19917401162015 @default.
• W1991740116 countsByYear W19917401162016 @default.
• W1991740116 countsByYear W19917401162017 @default.
• W1991740116 countsByYear W19917401162018 @default.
• W1991740116 countsByYear W19917401162019 @default.
• W1991740116 countsByYear W19917401162020 @default.
• W1991740116 countsByYear W19917401162021 @default.
• W1991740116 countsByYear W19917401162022 @default.
• W1991740116 countsByYear W19917401162023 @default.
• W1991740116 crossrefType "journal-article" @default.

• next