FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W1991746997> ?p ?o ?g. }

• W1991746997 endingPage "21260" @default.
• W1991746997 startingPage "21254" @default.
• W1991746997 abstract "The Gal4p family of yeast zinc cluster proteins comprises over 50 members that are putative transcriptional regulators. For example, Pdr1p and Pdr3p activate multidrug resistance genes by binding to pleiotropic drug response elements (PDREs) found in promoters of target genes such as PDR5, encoding a drug efflux pump involved in resistance to cycloheximide. However, the role of many zinc cluster proteins is unknown. We tested a panel of strains carrying deletions of zinc cluster genes in the presence of various drugs. One deletion strain (Δrdr1) was resistant to cycloheximide, whereas eight strains showed sensitivity to the antifungal ketoconazole or cycloheximide. Unnamed zinc cluster genes identified in our screen were called RDS for regulators of drug sensitivity. RNA levels of multidrug resistance genes such asPDR16, SNQ2, and PDR5 were decreased in many deletion strains. For example, cycloheximide sensitivity of a Δstb5 strain was correlated with decreased RNA levels and promoter activity of the PDR5gene. We tested if activation of PDR5 is mediated via a PDRE by inserting this DNA element in front of a minimal promoter linked to the lacZ gene. Strikingly, activity of the reporter was decreased in a Δstb5 strain. The purified DNA binding domain of Stb5p bound to a PDRE in vitro. Mutations in the PDRE known to affect binding of Pdr1p/Pdr3p showed similar effects when assayed with Stb5p. These results strongly suggest that Stb5p is a transcriptional activator of multidrug resistance genes. Thus, we have identified new regulators of drug sensitivity in the family of zinc cluster proteins. The Gal4p family of yeast zinc cluster proteins comprises over 50 members that are putative transcriptional regulators. For example, Pdr1p and Pdr3p activate multidrug resistance genes by binding to pleiotropic drug response elements (PDREs) found in promoters of target genes such as PDR5, encoding a drug efflux pump involved in resistance to cycloheximide. However, the role of many zinc cluster proteins is unknown. We tested a panel of strains carrying deletions of zinc cluster genes in the presence of various drugs. One deletion strain (Δrdr1) was resistant to cycloheximide, whereas eight strains showed sensitivity to the antifungal ketoconazole or cycloheximide. Unnamed zinc cluster genes identified in our screen were called RDS for regulators of drug sensitivity. RNA levels of multidrug resistance genes such asPDR16, SNQ2, and PDR5 were decreased in many deletion strains. For example, cycloheximide sensitivity of a Δstb5 strain was correlated with decreased RNA levels and promoter activity of the PDR5gene. We tested if activation of PDR5 is mediated via a PDRE by inserting this DNA element in front of a minimal promoter linked to the lacZ gene. Strikingly, activity of the reporter was decreased in a Δstb5 strain. The purified DNA binding domain of Stb5p bound to a PDRE in vitro. Mutations in the PDRE known to affect binding of Pdr1p/Pdr3p showed similar effects when assayed with Stb5p. These results strongly suggest that Stb5p is a transcriptional activator of multidrug resistance genes. Thus, we have identified new regulators of drug sensitivity in the family of zinc cluster proteins. pleiotropic drug resistance major facilitator superfamily ATP binding cassette open reading frame pleiotropic drug resistance element regulator of drug sensitivity electrophoretic mobility shift assay glutathioneS-transferase 4-nitroquinoline N-oxide DNA binding domain Multidrug or pleiotropic drug resistance (PDR)1 is a phenomenon found in various organisms, ranging from prokaryotes to eukaryotes, such as yeast and humans. The ability of cells to become resistant to toxic compounds such as drugs is of major importance because the treatment of many diseases is hampered by the ability of either the body's own malignant cells or of foreign pathogenic organisms to develop PDR and thereby become resistant to drugs. Saccharomyces cerevisiaehas been widely used to study PDR, allowing us to gain insight into the mechanisms behind PDR in pathogenic fungi and in higher eukaryotes. There are mainly three types of proteins involved in PDR: 1) ATP-binding cassette (ABC) proteins, 2) major facilitator superfamily (MFS) proteins, and 3) transcription factors. ABC proteins are found in organisms ranging from bacteria to humans and are involved in many important processes in the cell (1Higgins C.F. Annu. Rev. Cell Biol. 1992; 8: 67-113Crossref PubMed Scopus (3374) Google Scholar, 2Michaelis S. Berkower C. Cold Spring Harbor Symp. Quant. Biol. 1995; 60: 291-307Crossref PubMed Google Scholar). Most ABC proteins are ATP-powered membrane translocators, although some function as ion channels, channel regulators, receptors, proteases, and sensing proteins (3Higgins C.F. Cell. 1995; 82: 693-696Abstract Full Text PDF PubMed Scopus (340) Google Scholar). ABC proteins are able to translocate a wide variety of compounds including ions, heavy metals, anticancer drugs, steroids, mycotoxins, antibiotics, and whole proteins (1Higgins C.F. Annu. Rev. Cell Biol. 1992; 8: 67-113Crossref PubMed Scopus (3374) Google Scholar, 4Bauer B.E. Wolfger H. Kuchler K. Biochim. Biophys. Acta. 1999; 1461: 217-236Crossref PubMed Scopus (228) Google Scholar, 5Kuchler K. Thorner J. Endocr. Rev. 1992; 13: 499-514PubMed Google Scholar, 6Dean M. Allikmets R. Curr. Opin. Genet. Dev. 1995; 5: 779-785Crossref PubMed Scopus (208) Google Scholar). Two well characterized ABC transporters, Pdr5p and Snq2p, confer PDR. They are functional homologues of mammalian P-glycoprotein (7Balzi E. Goffeau A. J. Bioenerg. Biomembr. 1995; 27: 71-76Crossref PubMed Scopus (229) Google Scholar, 8Decottignies A. Goffeau A. Nat. Genet. 1997; 15: 137-145Crossref PubMed Scopus (392) Google Scholar). In contrast to ABC proteins, MFS members do not use ATP. Instead, proton-motive force is used to transport substrates across the membrane. Atr1p is one member of the MFS shown to be involved in drug resistance (9Gompel-Klein P. Curr. Genet. 1990; 18: 93-96Crossref PubMed Scopus (35) Google Scholar). Various transcription factors have been shown to regulate the expression of genes encoding ABC or MFS proteins (10Koloczkowska A. Goffeau A. Drug Resist. Updates. 1999; 2: 403-414Crossref PubMed Scopus (106) Google Scholar). There are two major families of transcription factors involved in PDR: 1) the bZip protein family (Yap family), and 2) zinc cluster proteins. Yap1p is the best characterized member of the bZip family and is an important regulator in the stress response (11Wu A. Wemmie J.A. Edgington N.P. Goebl M. Guevara J.L. Moye-Rowley W.S. J. Biol. Chem. 1993; 268: 18850-18858Abstract Full Text PDF PubMed Google Scholar, 12Schnell N. Entian K.D. Eur. J. Biochem. 1991; 200: 487-493Crossref PubMed Scopus (63) Google Scholar, 13Gounalaki N. Thireos G. EMBO J. 1994; 13: 4036-4041Crossref PubMed Scopus (117) Google Scholar). Yap1p regulates the expression of the ABC transporter, Ycf1p (14Wemmie J.A. Szczypka M.S. Thiele D.J. Moye-Rowley W.S. J. Biol. Chem. 1994; 269: 32592-32597Abstract Full Text PDF PubMed Google Scholar). Another class of transcription factors involved in PDR is composed of zinc cluster or binuclear zinc cluster proteins. They form a family of transcription factors found exclusively in fungi. Zinc cluster proteins are characterized by a zinc finger, which contains the Zn(II)2Cys6 (or C6 zinc) binuclear cluster DNA-binding motif with the consensus sequence of CysX2CysX6CysX5–12CysX2CysX6–8Cys. The cysteines mediate the binding of two zinc atoms, which are necessary for the zinc finger to bind DNA (15Pan T. Coleman J.E. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 2077-2081Crossref PubMed Scopus (162) Google Scholar, 16Gardner K.H. Pan T. Narula S. Rivera E. Coleman J.E. Biochemistry. 1991; 30: 11292-11302Crossref PubMed Scopus (56) Google Scholar). Many zinc cluster proteins bind DNA as homodimers to recognition sites that usually fall within three types: inverted, direct, and everted repeats (17Schwabe J.W. Rhodes D. Nat. Struct. Biol. 1997; 4: 680-683Crossref PubMed Scopus (16) Google Scholar). These proteins have been shown to be involved in various processes in the cell including regulation of primary and secondary metabolism, drug resistance, and meiotic development (18Todd R.B. Andrianopoulos A. Fungal Genet. Biol. 1997; 21: 388-405Crossref PubMed Scopus (235) Google Scholar), e.g. Gal4p is involved in the activation of genes that encode enzymes for galactose metabolism (19Lohr D. Venkov P. Zlatanova J. FASEB J. 1995; 9: 777-787Crossref PubMed Scopus (338) Google Scholar), whereas Hap1p activates genes involved in respiration (20Pfeifer K. Kim K.S. Kogan S. Guarente L. Cell. 1989; 56: 291-301Abstract Full Text PDF PubMed Scopus (238) Google Scholar, 21Creusot F. Verdiere J. Gaisne M. Slonimski P.P. J. Mol. Biol. 1988; 204: 263-276Crossref PubMed Scopus (104) Google Scholar). Two zinc cluster proteins, Pdr1p and Pdr3p, have been shown to positively control the expression of genes involved in multidrug resistance (10Koloczkowska A. Goffeau A. Drug Resist. Updates. 1999; 2: 403-414Crossref PubMed Scopus (106) Google Scholar). Target genes of Pdr1p and Pdr3p include PDR5, SNQ2, and YOR1 encoding ABC transporters, as well as HXT9 and HXT11 encoding hexose transporters which belong to the MFS family (22Decottignies A. Lambert L. Catty P. Degand H. Epping E.A. Moye-Rowley W.S. Balzi E. Goffeau A. J. Biol. Chem. 1995; 270: 18150-18157Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 23Katzmann D.J. Burnett P.E. Golin J. Mahe Y. Moye-Rowley W.S. Mol. Cell. Biol. 1994; 14: 4653-4661Crossref PubMed Scopus (180) Google Scholar, 24Mahe Y. Parle-McDermott A. Nourani A. Delahodde A. Lamprecht A. Kuchler K. Mol. Microbiol. 1996; 20: 109-117Crossref PubMed Scopus (103) Google Scholar, 25Nourani A. Wesolowski-Louvel M. Delaveau T. Jacq C. Delahodde A. Mol. Cell. Biol. 1997; 17: 5453-5460Crossref PubMed Scopus (91) Google Scholar). Overexpression of the ABC transporters renders yeast resistant to drugs. However, the overexpression of the hexose transporters leads to drug sensitivity. Even though Pdr1p and Pdr3p recognize the same pleiotropic drug response element (PDRE), with Pdr3p binding an everted repeat CCGCGG, they have different roles (26Delahodde A. Delaveau T. Jacq C. Mol. Cell. Biol. 1995; 15: 4043-4050Crossref PubMed Scopus (120) Google Scholar, 27Hellauer K. Rochon M.-H. Turcotte B. Mol. Cell. Biol. 1996; 16: 6096-6102Crossref PubMed Scopus (57) Google Scholar). The PDR3 promoter contains two PDREs, allowing for autoregulation (26Delahodde A. Delaveau T. Jacq C. Mol. Cell. Biol. 1995; 15: 4043-4050Crossref PubMed Scopus (120) Google Scholar). Another zinc cluster protein, Yrr1p, is implicated in PDR, e.g. Yrr1p has been shown to regulate the expression of SNQ2 (28Cui Z. Shiraki T. Hirata D. Miyakawa T. Mol. Microbiol. 1998; 29: 1307-1315Crossref PubMed Scopus (57) Google Scholar). The yeast genome contains 55 genes encoding putative zinc cluster proteins (for a complete list, see Refs. 29Akache B., Wu, K. Turcotte B. Nucleic Acids Res. 2001; 29: 2181-2190Crossref PubMed Scopus (79) Google Scholar and 30Angus-Hill M.L. Schlichter A. Roberts D. Erdjument-Bromage H. Tempst P. Cairns B.R. Mol. Cell. 2001; 7: 741-751Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar). However, the function of many of these putative zinc cluster proteins is unknown. A phenotypic analysis was carried out on 33 genes encoding yeast zinc cluster proteins to better understand their role (29Akache B., Wu, K. Turcotte B. Nucleic Acids Res. 2001; 29: 2181-2190Crossref PubMed Scopus (79) Google Scholar). For example, we have shown that deletion of eight different zinc cluster genes impairs growth on nonfermentable carbon sources. In this study, we have extended our previous analysis by assaying the growth of these deletion strains in the presence of various drugs. Our results show that nine of these deletion strains are either resistant or sensitive to at least one drug. The wild-type strain used was BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0; Ref. 31Brachmann C.B. Davies A. Cost G.J. Caputo E., Li, J. Hieter P. Boeke J.D. Yeast. 1998; 14: 115-132Crossref PubMed Scopus (2623) Google Scholar). The deletion strains were obtained from Research Genetics (Huntsville, AL) (32Winzeler E.A. Shoemaker D.D. Astromoff A. Liang H. Anderson K. Andre B. Bangham R. Benito R. Boeke J.D. Bussey H. Chu A.M. Connelly C. Davis K. Dietrich F. Dow S.W. Bakkoury M.E. Foury F. Friend S.H. Gentalen E. Giaever G. Hegemann J.H. Jones T. Laub M. Liao H. Liebundguth N. Davis R.W. et al.Science. 1999; 285: 901-906Crossref PubMed Scopus (3191) Google Scholar). Deletions for a number of strains were verified by Southern blot analysis (see list below). Research Genetics strain 11677 does not carry a deletion of the ORFYOR380W. 2K. Hellauer and B. Turcotte, unpublished results Deletion of the YOR380W ORF was performed using the PCR method of Baudin et al. (33Baudin A. Ozier-Kalogeropoulos O. Denouel A. Lacroute F. Cullin C. Nucleic Acids Res. 1993; 21: 3329-3330Crossref PubMed Scopus (1120) Google Scholar) using oligonucleotides with homology to the target gene at their 5′ end and 3′ sequences complementary to the KanMX (G418R) selection marker. Plasmid pFA6 (34Wach A. Brachat A. Pohlmann R. Philippsen P. Yeast. 1994; 10: 1793-1808Crossref PubMed Scopus (2237) Google Scholar) was used as a template for PCR with the oligonucleotides TAACTTAGCGCACACTTTCCTACTTTAAGCTCACCAAATGTGGGCCACAGAAGCAACTCACGTACGCTGCAGGTCGAC and AATTTGCTTCTCGATACACATAATCTATAATACTCTTTTATCTGGCGACGCTATGACGTATCGAT- GAATTCGAGCTCG. Media were prepared according to Adams et al. (35Adams A. Gottschling D.E. Stearns T. Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1997Google Scholar). YPD contained 1% yeast extract, 2% peptone, 2% glucose. SD contained 2% glucose, 0.67% yeast nitrogen base (without amino acids) and was supplemented with adenine and appropriate amino acids at a final concentration of 0.004%. Drugs were obtained from Sigma. Stock solutions were prepared as described below and stored at −20 °C: cycloheximide, 2 mg/ml in 100% ethanol; ketoconazole, 5 mg/ml in H2O; chloramphenicol, 34 mg/ml in 100% ethanol; 4-nitroquinoline N-oxide (4-NQO), 10 mg/ml in dimethyl sulfoxide; rhodamine 6-G, 10 mg/ml in 100% ethanol; oligomycin, 5 mg/ml in 100% ethanol. Cycloheximide, ketoconazole, chloramphenicol, and 4-nitroquinoline N-oxide assays were performed with glucose as a carbon source, whereas rhodamine 6-G and oligomycin were tested with glycerol as a carbon source. Concentrations of drugs used for the assays are indicated in Table II.Table IIConditions used for drug assaysDrugTargetDrug concentration usedGrowth timedaysChloramphenicolInhibits DNA synthesis3 mg/ml2CycloheximideInhibits protein translation1 μg/ml9KetoconazoleAntifungal; inhibitor of the ERG11 gene product involved in ergosterol synthesis4 μg/ml24-NQODNA mutagen0.35 μg/ml2OligomycinInhibits oxidative phosphorylation1 μg/ml4Rhodamine 6-GInhibits oxidative phosphorylation5 μg/ml4 Open table in a new tab The lacZ reporters PDR5-lacZ and SNQ2-lacZ have been described previously (36Hellauer K. Akache B. MacPherson S. Sirard E. Turcotte B. J. Biol. Chem. 2002; 277 (in press)Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Briefly, the reporters are low copy plasmids (ARSCEN) containing aURA3 marker. The PDR5 and SNQ2reporters contain 1000 and 700 bp of sequences upstream of the ATG, respectively. Reporters PDRE3-lacZ, PDRE3A-lacZ, and PDRE3B-lacZ are high copy (2-μm) URA3-marked plasmids containing a single Pdr1/Pdr3p binding site inserted upstream of minimal CYC1promoter driving lacZ transcription (36Hellauer K. Akache B. MacPherson S. Sirard E. Turcotte B. J. Biol. Chem. 2002; 277 (in press)Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). β-Galactosidase assays were performed as described previously (36Hellauer K. Akache B. MacPherson S. Sirard E. Turcotte B. J. Biol. Chem. 2002; 277 (in press)Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) with permeabilized cells. Results were obtained from at least two independent transformations performed at least with duplicate samples. Variation between duplicates was typically less than 20%. Northern blot analysis and probes have been described previously (36Hellauer K. Akache B. MacPherson S. Sirard E. Turcotte B. J. Biol. Chem. 2002; 277 (in press)Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Southern blot analysis was performed as described (37Hellauer K. Sirard E. Turcotte B. J. Biol. Chem. 2001; 276: 13587-13592Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar), and the probe was obtained by purifying a KANR fragment by digesting pFA6 (34Wach A. Brachat A. Pohlmann R. Philippsen P. Yeast. 1994; 10: 1793-1808Crossref PubMed Scopus (2237) Google Scholar) withClaI. Strains YBR033W, YBR150C, YBR239C, YDR520C, YJL103C, YKR064W, YLR228C, YLR278C, YMR019W, and YPR196W were verified by Southern blot analysis; strains YBL066C, YDR213W, YDR421W, YHR178W, YJL089W, YML076C, and YPR094W had been characterized previously (29Akache B., Wu, K. Turcotte B. Nucleic Acids Res. 2001; 29: 2181-2190Crossref PubMed Scopus (79) Google Scholar). Research Genetics deletion strain 11677 (YOR380W) did not give a band of the expected size with a probe corresponding to the promoter region of the YOR380Wgene (data not shown; see also “Strains”). A DNA fragment encoding the DNA-binding domain of Stb5p (amino acids 1–163) was amplified by PCR using the oligonucleotides CGGGATCCATGGATGGTCCCAATTTTGC and GGAATTCCTTGGTACGTCTTGGGGCTC and genomic DNA (isolated from strain YPH499; Ref. 38Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar) as a template. The PCR product was digested with BamHI and EcoRI and subcloned into plasmid pGEX-F (27Hellauer K. Rochon M.-H. Turcotte B. Mol. Cell. Biol. 1996; 16: 6096-6102Crossref PubMed Scopus (57) Google Scholar) cut with the same enzymes to give pGST-STB5. The DNA-binding domains of Stb5 and Pdr3p fused to GST were expressed in Escherichia coli and purified as described (27Hellauer K. Rochon M.-H. Turcotte B. Mol. Cell. Biol. 1996; 16: 6096-6102Crossref PubMed Scopus (57) Google Scholar). The GST moiety was removed by thrombin cleavage. EMSA was performed according to Ref. 27Hellauer K. Rochon M.-H. Turcotte B. Mol. Cell. Biol. 1996; 16: 6096-6102Crossref PubMed Scopus (57) Google Scholar. The probes used in the EMSA correspond to site number 3 of the PDR5 promoter (39Katzmann D.J. Hallstrom T.C. Mahe Y. Moye-Rowley W.S. J. Biol. Chem. 1996; 271: 23049-23054Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar) and span sequences −372 to −337 bp relative to the ATG. Oligonucleotides were annealed and filled-in with Klenow and dGTP, dTTP, dATP, and [32P]dCTP. Oligonucleotides for PDRE3 were TCGAAAAAGAGAAATGTCTCCGCGGAACTCTTCTACGCCG and its complement TCGACGGCGTAGAAGAGTTCCGCGGAGACATTTCTCTTTT. Oligonucleotides for PDRE3A were TCGAAAAAGAGAAATGTCTCTGCGGAACTCTTCTACGCCG and its complement TCGACGGCGTAGAAGAGTTCCGCAGAGACATTTCTCTTTT. Oligonucleotides for PDRE3B were TCGAAAAAGAGAAATGTCTCCGCAGAACTCTTCTACGCCG and its complement TCGACGGCGTAGAAGAGTTCTGCGGAGACATTTCTCTTTT (mutations are in bold characters and underlined). Our study focused on 32 members of the Gal4p family of yeast zinc cluster proteins (Table I). Many members are putative proteins of unknown function. We determined whether these zinc cluster genes play a role in multidrug resistance by testing the ability of strains carrying deletions of these genes to grow in the presence of six different drugs: cycloheximide, ketoconazole, chloramphenicol, 4-NQO, rhodamine 6-G, and oligomycin. The mode of action of these drugs is listed in Table II. Wild-type and deletion strains were serially diluted and spotted on plates containing the drugs and grown for the time indicated in Table II. As expected (28Cui Z. Shiraki T. Hirata D. Miyakawa T. Mol. Microbiol. 1998; 29: 1307-1315Crossref PubMed Scopus (57) Google Scholar), deletion ofYRR1 resulted in hypersensitivity to the mutagen 4-NQO (Table III). However, none of the 31 other strains showed altered sensitivity to 4-NQO, oligomycin, rhodamine 6-G, and chloramphenicol (data not shown).Table IGenes tested in this studySystematic nameGeneFunctionRef.YBL066CSEF1Suppressor of essential function(55Groom K.R. Heyman H.C. Steffen M.C. Hawkins L. Martin N.C. Yeast. 1998; 14: 77-87Crossref PubMed Scopus (15) Google Scholar)YBR033WUnknownYBR150CUnknownYBR239CUnknownYBR240CTHI2(PHO6)Activator of thiamin biosynthetic genes(56Nishimura H. Kawasaki Y. Kaneko Y. Nosaka K. Iwashima A. FEBS Lett. 1992; 297: 155-158Crossref PubMed Scopus (40) Google Scholar, 57Crowley J.H. Leak F.W., Jr. Shianna K.V. Tove S. Parks L.W. J. Bacteriol. 1998; 180: 4177-4183Crossref PubMed Google Scholar)YCR106WRDS1Regulator of drug sensitivityThis studyYDR213WUPC2Activator of sterol biosynthetic genesThis study (45,57)YDR421WARO80Activator of the gene encoding aromatic aminotransferase(58Iraqui I. Vissers S. Andre B. Urrestarazu A. Mol. Cell. Biol. 1999; 19: 3360-3371Crossref PubMed Scopus (91) Google Scholar, 59Lesage P. Yang X. Carlson M. Mol. Cell. Biol. 1996; 16: 1921-1928Crossref PubMed Scopus (105) Google Scholar, 60Vincent O. Carlson M. EMBO J. 1998; 17: 7002-7008Crossref PubMed Scopus (106) Google Scholar)YDR520CUnknownYER184CUnknownYFL052WUnknownYHR178WSTB5Binds Sin3p in two-hybrid assayThis study (51Kasten M.M. Stillman D.J. Mol. Gen. Genet. 1997; 256: 376-386Crossref PubMed Scopus (50) Google Scholar)YIL130WUnknownYJL089WSIP4Involved in Snf1p-regulated transcriptional activation(59,60)YJL103CUnknownYJL206CUnknownYKL222CUnknownYKR064WUnknownYLL054CUnknownYLR228CECM22Activator of sterol biosynthetic genesThis study (45Vik A. Rine J. Mol. Cell. Biol. 2000; 20: 4381-4392Crossref PubMed Scopus (81) Google Scholar)YLR266CUnknownYLR278CUnknownYML076CUnknownYMR019WSTB4Binds Sin3p in two-hybrid assay(51Kasten M.M. Stillman D.J. Mol. Gen. Genet. 1997; 256: 376-386Crossref PubMed Scopus (50) Google Scholar)YNR063WUnknownYOL089CHAL9Involved in salt toleranceThis study (44Mendizabal I. Rios G. Mulet J.M. Serrano R. de Larrinoa I.F. FEBS Lett. 1998; 425: 323-328Crossref PubMed Scopus (116) Google Scholar)YOR162CYRR1Activator of multidrug resistance genesThis study (28Cui Z. Shiraki T. Hirata D. Miyakawa T. Mol. Microbiol. 1998; 29: 1307-1315Crossref PubMed Scopus (57) Google Scholar)YOR172WUnknownYOR380WRDR1Repressor of multidrug resistance genes(36Hellauer K. Akache B. MacPherson S. Sirard E. Turcotte B. J. Biol. Chem. 2002; 277 (in press)Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar)YPL133CRDS2Regulator of drug sensitivityThis studyYPR094WRDS3Regulator of drug sensitivityThis studyYPR196WMAL63Activator of maltose genes(61Needleman R. Mol. Microbiol. 1991; 5: 2079-2084Crossref PubMed Scopus (86) Google Scholar) Open table in a new tab Table IIISummary of the drug sensitivity assaysSystematic nameGenePhenotype of deletion strainsKetoconazoleCycloheximide4-NQOYCR106WRDS1–Sensitive–YDR213WUPC2Sensitive––YHR178WSTB5–Sensitive–YIL130W––Slightly resistant–YKL222C––Slightly resistant–YLR228CECM22–Sensitive–YOL089CHAL9–Sensitive–YOR162CYRR1–SensitiveSensitiveYOR380WRDR1–Resistant–YPL133CRDS2Sensitive––YPR094WRDS3Slightly sensitiveSensitive––, no phenotype. Open table in a new tab –, no phenotype. When assayed with the antifungal ketoconazole or the translation inhibitor cycloheximide, nine strains demonstrated a clear phenotype with at least one drug (Table III). Three of the genes deleted were not named previously. Because they potentially encode transcriptional regulators and show altered drug sensitivity, we named themRDS1–RSD3 (for regulator of drugsensitivity; see Tables II and III). Two strains (Δupc2 and Δrds2) were hypersensitive to ketoconazole (Fig. 1). Deletion ofRDS3 resulted in a slightly decreased resistance, as seen from the reduced number of colonies at low cell concentration. The Δrds3 strain was also hypersensitive to cycloheximide (see below). Moreover, seven strains revealed a phenotype when grown in the presence of cycloheximide. One strain (Δrdr1) was resistant to that drug. The same phenotype was observed whenRDR1 was deleted in the strain FY73 (36Hellauer K. Akache B. MacPherson S. Sirard E. Turcotte B. J. Biol. Chem. 2002; 277 (in press)Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). A more detailed analysis of RDR1 will be presented elsewhere (36Hellauer K. Akache B. MacPherson S. Sirard E. Turcotte B. J. Biol. Chem. 2002; 277 (in press)Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Strains carrying deletions of YIL130W or YKL222C were slightly resistant to cycloheximide (data not shown). Because of the subtle phenotype observed with these two genes, they were not scored as regulators of drug sensitivity. Six other deletion strains showed sensitivity to cycloheximide (Fig. 2). For example, deletion of STB5 or RDS3 abolished growth on plates containing cycloheximide, whereas normal growth was observed in the absence of the drug when compared with the wild-type strain. Two strains showed phenotypes on more than one drug: strain Δyrr1 was sensitive to 4-NQO and cycloheximide, whereas Δrds3 was sensitive to both ketoconazole and cycloheximide. In summary, our study has assigned new drug sensitivity phenotypes for nine genes encoding zinc cluster proteins.FIG. 2Deletion of various genes encoding zinc cluster proteins results in altered sensitivity to cycloheximide.Wild-type or deletion strains were grown overnight in YPD. Cells were spun down, resuspended in water, and serially diluted (leftto right: ∼1.25 × 104, 2.5 × 103, 5 × 102, and 1 × 102 cells). Cells were then spotted on YPD plates either with (lower panel) or without (upper panel) cycloheximide. Gene deletions are indicated on theright part of the figure. WT, wild-type strain.View Large Image Figure ViewerDownload (PPT) Deletion strains that showed a phenotype most probably lack a transcriptional regulator. Thus, we tested whether these strains had altered expression of selected genes involved in multidrug resistance. RNA was isolated from the wild-type strain and the deletion strains that showed altered drug sensitivity and probed for PDR5, SNQ2, and PDR16 mRNAs (Fig.3). As stated above, SNQ2 and PDR5 encode multidrug transporters. For example, Pdr5p has been shown to be a major mediator of cycloheximide resistance (40Leppert G. McDevitt R. Falco S.C. Van Dyk T.K. Ficke M.B. Golin J. Genetics. 1990; 125: 13-20Crossref PubMed Google Scholar, 41Meyers S. Schauer W. Balzi E. Wagner M. Goffeau A. Golin J. Curr. Genet. 1992; 21: 431-436Crossref PubMed Scopus (124) Google Scholar, 42Hirata D. Yano K. Miyahara K. Miyakawa T. Curr. Genet. 1994; 26: 285-294Crossref PubMed Scopus (133) Google Scholar). As expected (28Cui Z. Shiraki T. Hirata D. Miyakawa T. Mol. Microbiol. 1998; 29: 1307-1315Crossref PubMed Scopus (57) Google Scholar), the level of SNQ2 mRNA was reduced in cells lacking YRR1 (Fig. 3, lane 8). Interestingly, SNQ2 RNA was also reduced in aΔstb5 strain (Fig. 3, lane 11). However, actin level was also reduced with that strain. We doubled the amount ofΔstb5 RNA and repeated the Northern blot analysis (Fig. 3, lanes 12 and 13). Clearly, the levels ofSNQ2 RNA were reduced in a Δstb5 strain, whereas signals with an actin probe were similar in wild-type and deletion strains. The levels of PDR16 mRNA were reduced in Δecm22, Δrds2, Δhal9, and Δstb5 strains as compared with the wild-type strain (Fig.3, compare lanes 4, 6, 7, and 11 with lane 1). PDR5 mRNA levels were reduced in many strains, but the decrease was not as severe as with PDR16 and SNQ2. Strains Δecm22and Δstb5 had the lowest amount of PDR5mRNA when compared with a wild-type strain, whereas a decrease was also observed in Δrds1, Δrds2, Δhal9, Δupc2, and Δrds3 strains. No major changes in PDR5, PDR16, and SNQ2 mRNAs were observed with deletion of ORFsYKL22C and YIL130W, in agreement with their slight resistance to cycloheximide. All the drug-sensitive strains had lower mRNA levels for either one or more of the tested RNAs. Thus, the observed phenotypes correlate with the reduced amount of the tested mRNAs. Strikingly, a strain deleted of STB5 is sensitive to cycloheximide and has reduced mRNA levels for PDR5(as well as SNQ2 and PDR16). Our data strongly suggest that Stb5p is an additional regulator of genes encoding ABC transporters. To determine whether changes in PDR5 and SNQ2mRNA levels are because of altered promoter activity, we transformed PDR5 and SNQ2 lacZreporters into the wild-type and the deletion strains (Table IV). Only a slightly reduced activity of the SNQ2 reporter was observed with the Δyrr1strain, even though SNQ2 mRNA levels were drastically reduced in the absence of Yrr1p. Similar results were obtained in another study (43Cui Z.F. Hirata D. Miyakawa T. Biosci. Biotechnol. Biochem. 1999; 63: 162-167Crossref PubMed Scopus (12) Google Scholar). We do not know the reason for the discrepancy between the Northern blot analysis and the reporter assay. The activity of the PDR5 reporter in strain Δhal9 was decreased ∼2-fold, whereas the activity of the SNQ2reporter was slightly decreased (Table IV). Deletion of STB5decreased activity of the PDR5 and SNQ2 reporters 2- and 7-fold, respectively. In addition, deletion of RDS3decreased activity of the SNQ2 and PDR5 promoters 2- and 3-fold, respectively.Table IVAc" @default.
• W1991746997 created "2016-06-24" @default.
• W1991746997 creator A5025414080 @default.
• W1991746997 creator A5087717580 @default.
• W1991746997 date "2002-06-01" @default.
• W1991746997 modified "2023-10-17" @default.
• W1991746997 title "New Regulators of Drug Sensitivity in the Family of Yeast Zinc Cluster Proteins" @default.
• W1991746997 cites W1521778811 @default.
• W1991746997 cites W1531819701 @default.
• W1991746997 cites W1561654220 @default.
• W1991746997 cites W1578589309 @default.
• W1991746997 cites W1763161027 @default.
• W1991746997 cites W1883142664 @default.
• W1991746997 cites W1919194185 @default.
• W1991746997 cites W1980902708 @default.
• W1991746997 cites W1992927522 @default.
• W1991746997 cites W1992992274 @default.
• W1991746997 cites W1994876071 @default.
• W1991746997 cites W1995977462 @default.
• W1991746997 cites W1999788391 @default.
• W1991746997 cites W2000173643 @default.
• W1991746997 cites W2000250937 @default.
• W1991746997 cites W2003084652 @default.
• W1991746997 cites W2005528479 @default.
• W1991746997 cites W2006555839 @default.
• W1991746997 cites W2010623159 @default.
• W1991746997 cites W2015573128 @default.
• W1991746997 cites W2020930773 @default.
• W1991746997 cites W2024014185 @default.
• W1991746997 cites W2024431605 @default.
• W1991746997 cites W2025526564 @default.
• W1991746997 cites W2025744458 @default.
• W1991746997 cites W2032976908 @default.
• W1991746997 cites W2033749460 @default.
• W1991746997 cites W2037402061 @default.
• W1991746997 cites W2041006851 @default.
• W1991746997 cites W2050231834 @default.
• W1991746997 cites W2053085669 @default.
• W1991746997 cites W2063130153 @default.
• W1991746997 cites W2067270794 @default.
• W1991746997 cites W2072776553 @default.
• W1991746997 cites W2080408951 @default.
• W1991746997 cites W2081982625 @default.
• W1991746997 cites W2081995991 @default.
• W1991746997 cites W2085202744 @default.
• W1991746997 cites W2094328836 @default.
• W1991746997 cites W2095185893 @default.
• W1991746997 cites W2095462096 @default.
• W1991746997 cites W2095513278 @default.
• W1991746997 cites W2100057937 @default.
• W1991746997 cites W2104266802 @default.
• W1991746997 cites W2109423022 @default.
• W1991746997 cites W2113976732 @default.
• W1991746997 cites W2122882694 @default.
• W1991746997 cites W2134080276 @default.
• W1991746997 cites W2140948740 @default.
• W1991746997 cites W2141408636 @default.
• W1991746997 cites W2145842435 @default.
• W1991746997 cites W2146503498 @default.
• W1991746997 cites W2158735148 @default.
• W1991746997 cites W2159654630 @default.
• W1991746997 cites W2162097287 @default.
• W1991746997 cites W2169333620 @default.
• W1991746997 cites W2185853395 @default.
• W1991746997 cites W297756241 @default.
• W1991746997 doi "https://doi.org/10.1074/jbc.m202566200" @default.
• W1991746997 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11943786" @default.
• W1991746997 hasPublicationYear "2002" @default.
• W1991746997 type Work @default.
• W1991746997 sameAs 1991746997 @default.
• W1991746997 citedByCount "71" @default.
• W1991746997 countsByYear W19917469972012 @default.
• W1991746997 countsByYear W19917469972013 @default.
• W1991746997 countsByYear W19917469972014 @default.
• W1991746997 countsByYear W19917469972015 @default.
• W1991746997 countsByYear W19917469972016 @default.
• W1991746997 countsByYear W19917469972017 @default.
• W1991746997 countsByYear W19917469972018 @default.
• W1991746997 countsByYear W19917469972019 @default.
• W1991746997 countsByYear W19917469972020 @default.
• W1991746997 countsByYear W19917469972022 @default.
• W1991746997 countsByYear W19917469972023 @default.
• W1991746997 crossrefType "journal-article" @default.
• W1991746997 hasAuthorship W1991746997A5025414080 @default.
• W1991746997 hasAuthorship W1991746997A5087717580 @default.
• W1991746997 hasBestOaLocation W19917469971 @default.
• W1991746997 hasConcept C127413603 @default.
• W1991746997 hasConcept C164866538 @default.
• W1991746997 hasConcept C178790620 @default.
• W1991746997 hasConcept C185592680 @default.
• W1991746997 hasConcept C199360897 @default.
• W1991746997 hasConcept C21200559 @default.
• W1991746997 hasConcept C24326235 @default.
• W1991746997 hasConcept C2779222958 @default.
• W1991746997 hasConcept C2780035454 @default.
• W1991746997 hasConcept C41008148 @default.
• W1991746997 hasConcept C535196362 @default.
• W1991746997 hasConcept C54355233 @default.

• next